Production And Identification Of Transgenic Mice
The gel-purified pEGFP-N1L-MCK-FHL3 linearized transgene construct (Fig. S1A) was microinjected into the pronuclei of fertilized C57BL wild-type (WT) mice eggs by standard techniques [21]. to produce transgenic (TG) mice. Transgenic founder mice (F0) and their offsprings were identified by PCR using primers shown in Fig. S1. Primer sequences were as follows: F 5-AGGAGACAGCGAGTAGCGAGCTCT-3 and R 5-TGTCATAGCACGGAACGCAGT-3. Transgenic lines were established by breeding F0 mice with wild-type mice to obtain heterozygous F1 TG mice. After that, the transgenic mice were established successively. All the subsequent studies were performed on F5 mice. Animal use and care for this study were approved by Institutional Animal Care and Use Committee of Huazhong Agricultural University.
Lentiviruses mediated FHL3 knockdown and overexpression in muscles
The sequence for the siRNA against mice FHL3 is CCATGAGCGAGGCATTTGA [20]. Mouse FHL3 siRNAs are designed as short hairpin RNA (shRNA) and cloned into the pLKO.1 lentiviral vector (1864, Addgene) according to the addgene manufacturer’s instruction (http://www.Addgene.org/protocols/plko/?tdsourcetag=s_pcqq_aiomsg#C), and the pLKO.1-TRC lentiviral vector (10879, Addgene) was used as the negative control. The coding sequence (CDS) of the pig FHL3 was cloned into the pCDH-MSCV-MCS-EF1a-CopGFP-T2A-Puro lentiviral vector. The amplified CDS was digested with Xba I and EcoR I and then ligated into pCDH-MSCV-MCS-EF1a-CopGFP-T2A-Puro using T4 DNA Ligase (Takara, Japan) to generate pCDH-pFHL3. Recombinant lentiviruses were produced by co-transfecting HEK293T cells with the lentiviral expression plasmid and packaging plasmids psPAX2 (12260, Addgene) and pMD2.G (12259, Addgene), respectively. Lentivirus packaging according to the addgene manufacturer’s instruction (http://www.addgene.org/protocols/lentivirus-production/). Four-week-old wild-type C57/BL6 male mice were used for lentivirus injection. The left and right leg muscles were injected with negative control lentivirus (LV-shNC) and shRNA-mediated FHL3 interference lentivirus (LV-shFHL3) once a week for 4 weeks, respectively. One-week-old Large White male piglets were used for lentivirus injection. The left and right legs were injected with control lentivirus (LV-Control) and pig FHL3 overexpression lentivirus (LV-pFHL3) once a week for 4 weeks, respectively.
Phenotype Measurement
TG mice and WT littermates were weaned at 3-week-old, separated by gender and raised in each cage of 3 mice. Mice were given free access to a chow diet (10% kcal fat, ME3.85 kcal/g). Body weights were measured at 2, 3, 4, 5, 6, 7 and 8 weeks of age. Mice were euthanized by cervical dislocation, and hind limb, Gas, TA, and Qu muscles of TG and WT mice were collected and weighed, separately. Data was normalized to the body weight (mg/g). The strength test was performed using a grip strength meter (BIO-GS3; Bioseb, France). The activities of lactate dehydrogenase (LDH) and SDH in muscle were measured with commercial kits (Jincheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions. Oxygen consumption measurements were performed using TSE lab master systems (TSE Systems, BadHomburg, Germany) [22]. All mice were acclimatized for 24 h prior to measurements, then the volume O2 was measured over the course of the next 24 h. Mice were maintained at 25°C under a 12 h light/12 h darkness cycle with free access to food and water. Hematoxylin-eosin (H&E) staining of muscle sections was performed according to a previous report [23]. Histological images were visualized and captured by alight microscope. Paraffin sections of muscle for immunofluorescence staining were repaired in 0.01 M sodium citrate solution (pH 6.0) for 30 min at 70℃, and permeabilizing in 0.1% Triton X-100, then incubated in blocking buffer (P0100B, Beyotime Biotechnology) 37℃ 2h, and incubated with rabbit anti-dystrophin, (Abcam, UK, ab275391, 1:200) anti-slow myosin skeletal heavy chain (slow-twitch) (Sigam, USA, M8421,1:1000), anti-fast myosin skeletal heavy chain (fast-twitch) (Servicebio, China, GB112130, 1:1000), anti-MyHC2b (Invitrogen, USA,14-6503-80, 1:1000) and anti-Myosin (Abclonal, China, A4963, 1:200) overnight at 4℃. Sections were washed in PBS, incubated with secondary antibody (Beyotime Biotechnology, China, anti-mouse CY3, anti-rabbit CY3, anti-rabbit FITC). The images were visualized with a fluorescence microscope (IX51-A21PH, Olympus, Japan).
Cell Isolation, Culture, And Transfection
Pig skeletal muscle satellite cells (pSMSC) were isolated from 3-day-old Large White piglets. pSMSC were isolated and cultured as described previously [24, 25, 26]. Briefly, Pig skeletal muscle was minced and then digested in 2mg/ml collagenase type I (Sigma-Aldrich, USA, 0130). And digestion was stopped with RPMI 1640 medium containing 20% fetal bovine serum (FBS), the digested liquid was filtered through 100um, 70um and 40um cell sieves. Phosphate buffer solution (PBS) used for cell isolation was 2% penicillin-streptomycin. Cells were cultured in growth medium (RPMI 1640 supplemented with 20% FBS, 4 ng/mL basic fibroblast growth factor, 1% chicken embryo extract, and 1% penicillin-streptomycin) on collagen-coated cell culture plates at 37 ℃ and 5% CO2. C2C12 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) at 37°C and 5% CO2. For myogenic differentiation, cells were transferred to DMEM containing 2% horse serum (HS; Gibco; USA). All cells were grown to 80–90% confluence before differentiation was induced. Transfection of plasmid (4 µg) or siRNA (100 pmol) was performed using Lipofectamine 2000 (9 µl) (Invitrogen, USA) according to the manufacturer's instruction. Plasmids pcDNA3.1-FHL3 and pcDNA3.1-YY1 were used for overexpression experiments. Mouse FHL3 small interfering RNA (siRNA) oligonucleotides (sense: CCAUGAGCGAGGCAUUUGATT; anti-sense: UCAAAUGCCUCGCUCAUGGTT); mouse YY siRNA oligonucleotides (sense: GGACCUUUACUGCCACAAATT; anti-sense: UUUGUGGCAGUAAAGGUCCTT) and pig FHL3 siRNA Oligonucleotides (siRNA1-sense:AGCGCAAAUACAUUCAGACGTT; siRNA1-anti-sense:CGUCUGAAUGUAUUUGCGCTT; siRNA2-sense:GCUCUGUAACGACUGCUACTT; siRNA2-anti-sense: GUAGCAGUCGUUACAGAGCTT; siRNA3-sense:CCGGGACGAUGAUCCUUAUTT; siRNA3-anti-sense: AUAAGGAUCAUCGUCCCGGTT) were designed and synthesized by GenePharma (China, Shanghai).
Cell Immunofluorescence Staining
Cells immunofluorescence staining were performed according to the previously published method [26]. Immunofluorescence staining antibodies included FHL3 (Santa Cruz, USA; sc-166917; 1:50), YY1 (Santa Cruz, USA; sc-281; 1:200), MyHC2a (Santa Cruz, USA; sc-53095; 1:100), MyHC2b (Invitrogen, USA,14-6503-80, 1:1000), MyHC1/slow (Santa Cruz, USA; sc-53090; 1:50). DAPI was used to visualize the cell nuclei with a fluorescence microscope (DP80; OLYMPUS, Tokyo, Japan). The cells were examined by confocal laser scanning microscopy (LSM800; Zeiss, Oberkochen, Germany). The number of nuclei present in one myosin-positive cell indicated myoblast fusion.
Generation of FHL3 knockout C2C12 Cell Lines
FHL3 knockout C2C12 cells were generated using the clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins 9(CRISPR/Cas9). Two small guide RNAs (sgRNAs) (sgRNA-1: TGTACGGCCGCAAATACATCCAGA; sgRNA-2: CTACTGCGTTCCGTGCTATGACAA) were designed using an online CRISPR design tool (http://tools.geneome-engineering.org) to delete the FHL3 transcript. All sgRNA primers were designed with added BbsI (ThermoScientific, FD1014) restriction sites and an extra G/C for increased hU6 promoter efficiency, annealed and ligated to BbsI-linearized pSpCas9(BB)-2A-GFP (PX458) plasmid using the T4-ligase (PX458-FHL3) (ThermoScientific, EL0011). The pSpCas9 (BB)-2A-GFP (PX458) vector was used as the control. The purified PX458, PX458-sgRNA-1 or PX458-sgRNA-2 vector was transfected into C2C12 cells and the cells were FACS-isolated. Gene knockout was validated by PCR amplification with FHL3 specific primers (F: TGCTGCAGTCCTTCTAAGTGAAB; R: CACCAGCCTTCACCTACTCTCT) and sequencing.
Plasmid Construction
Eight truncated fragments of the mouse MyHC2b gene 5' regulatory region spanning the sequence from position − 1510 bp to + 155 bp (1665 bp), − 1310 bp to + 155 bp (1465 bp), − 1110 bp to + 155 bp (1265 bp), − 910 bp to 155 bp (1065 bp), − 710 bp to 155 bp (865 bp), − 510 bp to 155 bp (665 bp), − 310 bp to 155 bp (465 bp), − 110 bp to 155 bp (265 bp) (relative to translation start site) were obtained by PCR. The PCR products were cloned into the pGL3-basic vector. The 5’ and 3’ ends of the primers contained Xho I or Hind III enzyme sites. pcDNA3.1-FHL3 was kept in our laboratory. For FHL3 prokaryotic expression vector, the FHL3 coding sequence (CDS) was cloned into the BamH I and Xho I site of pET-28a (+)-His, pET-21a and pGEX-4T-1 to generate pET-28a (+)-His-FHL3, pET-21a-FHL3 and pGEX-4T-1-FHL3, and the FHL3 truncated constructs FHL3-LIM1/2, FHL3-LIM1, FHL3-LIM2, FHL3-LIM3, FHL3-LIM4 were amplified and cloned into pGEX-4T-1. For the YY1 overexpression plasmids, CDS of the YY1 gene (1245 bp) was amplified with YY1 CDS primers. The amplified CDS was digested with BamH I and Xba I and was then ligated into pcDNA3.1 using T4 DNA Ligase (Takara, Japan) to generate pcDNA3.1-YY1. For YY1 prokaryotic expression vector, the YY1 CDS was cloned into the BamH I and Xho I site of pET-28a (+)-His and pGEX-4T-1 to generate pET-28a (+)-His-YY1 and pGEX-4T-1-YY1, and the YY1 truncated constructs YY1-TD, YY1-RD, YY1-RD1, YY1-RD2, YY1-DD, YY1-ZN1, YY1-ZN2, YY1-ZN3, YY1-ZN4 were amplified and cloned into pGEX-4T-1. For EZH2 (465–519) prokaryotic expression vector, the EZH2(465–519) sequence was cloned into the BamH I and Xho I site of pET-28a (+)-His to generate pET-28a (+)-His-EZH2 (465–519). Above primers are listed in Supplementary information Primers (Supplementary Excel 1:sheet1). The mutants of YY1 binding motifs in MyHC 2b gene 5' regulatory region were generated using the overlapping extension PCR and mutagenic primers (Supplementary Excel 1: sheet2). PCR products were confirmed by sequencing (Sangon, China).
Luciferase Reporter Assay
C2C12 myoblasts were transfected with MyHC2b 5' regulatory region constructs and pcDNA3.1-FHL3 vector by Lipofectamine 2000 (Invitrogen, USA), and differentiated for 2 days in a 24-well plate, washed with PBS, lysed in 100 µl of lysis buffer. The harvested cells were assayed for 5' regulatory region activity using a dual luciferase reporter assay system (Promega, USA). The enzymatic activity of luciferase was measured using a PerkinElmer 2030 Multilabel Reader (PerkinElmer). To normalize the transfection efficiency, the cells were transfected with 0.04 µg of the Renilla luciferase reporter plasmid (pRL-TK, Promega, USA).
Total Rna Extraction, Reverse Transcription, And Quantitative Real-time Pcr (Qrt-pcr)
Total RNAs were extracted using the Trizol reagent (Invitrogen, USA). The concentration and quality of RNA were assessed with a NanoDrop 2000 (Thermo, USA) and agarose gel electrophoresis. 1 µg of total RNA was used for reverse transcription with the PrimeScript RTreagent kit with gDNA Eraser (Takara, Japan). qRT-PCR analysis was performed using performed in a LightCycler 480 II (Roche, Switzerland) system. All primers used in the study were presented in supplementary information Primers Excel 2-sheet3. The relative RNA expression levels were calculated using the Ct (2–ΔΔCt) method.
Rna-seq And Bioinformatics Analyses
WT and FHL3 KO C2C12 cells were differentiated for 4 days. Total RNAs were isolated using Trizol (ThermoFisher, 10296028). Genomic DNA was removed using Turbo DNA-Free Kit (ThermoFisher, AM1907). Total RNA integrity was determined using RNA 6000 Nano Kit (Agilent, 5067–1511). Libraries of amplified RNA were prepared in accordance with the Illumina protocol. The clustering of the index-coded samples was performed using TruSeq PE Cluster Kit v3-cBot-HS (Illumia). The library preparations were sequenced and 150 bp paired-end reads were generated (Novogene, Beijing, China). After adaptor trimming and low-quality reads removing by Trim Galore (v 0.6.6), the high-quality clean reads were aligned to the reference genome (UCSC MM10) with Hisat2 (v2.2.1). The numbers of reads mapped to each gene were counted using FeatureCounts (v2.0.1). Differential expression analysis of the genes was performed using the R package DESeq2(v1.28.1). Genes with an adjusted q value (padj) < 0.05 and |fold change| > 1.5 were assigned as differentially expressed genes (DEGs). Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses of DEGs were performed using the R package Cluster Profler (v3.0.4). We predicted functional factors using Binding Analysis for Regulation of Transcription (BART) (http://bartweb.org//) and predicted putative transcription factor binding sites using PROMO (http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit.cgi?dirDB=TF_8.3). GSEA analysis was performed using the online software (http://www.broadinstitute.org/gsea) with permutation type = gene set, number of permutations = 1000 enrichment; statistic = weighted, and metric for ranking genes = Singal2Noise.
Dna Electrophoretic Mobility Shift Assay (Emsa)
DNA EMSA was performed using a Chemiluminescent EMSA Kit (Beyotime Biotechnology, China, GS009) according to the manufacturer’s instruction. Biotin-labeled DNA probes were generated by in vitro and purchased from AuGCT (Wuhan, China). Briefly, recombinant GST-YY1 or GST-YY1-DD or His-FHL3, and 1µM of biotin-labeled DNA probe were mixed, and then separated in 10% of native poly acrylamide gel. DNA-protein complexes were blotted with HRP-conjugated streptavidin and the results were visualized by autoradiography.
Western Blotting
Cells and tissues were lysed in RIPA buffer containing protease and phosphatase inhibitors according to the manufacturer's instruction (Beyotime, Jiangsu, China). Protein lysates were heated at 95°C for 10 minutes in 5×sodium dodecyl sulfate (SDS) sample buffer and were separated with SDS-PAGE (30 µg each lane). After electrophoresis, proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, USA) using a Mini Trans-Blot Cell system (Bio-Rad, USA). The membrane was blocked with 5% non-fat milk for 1.5 h at room temperature. Then the membrane was incubated with primary antibody specific for FHL3 (Santa Cruz, USA; sc-166917; 1:200), MyHC2a (Santa Cruz, USA; sc-53095; 1:1000), MyHC2b (Invitrogen, USA,14-6503-80, 1:1000), MyHC1/slow (Santa Cruz, USA; sc-53090; 1:500), YY1 (Santa Cruz, USA; sc-281; 1:200), EZH2 (Cell Signaling Technology, USA, mAb2008), GST (Abbkine, USA; 2BT2030; 1:5000), β-actin (Santa Cruz, USA; sc-69879; 1:500), His (Santa Cruz, USA; sc-8036; 1:500) overnight at 4°C. The membrane was incubated with IgG-HRP-conjugated secondary antibodies (Servicebio, China;GB23303 or GB23303༛1:3000) for 1 h at room temperature. The membranes were visualized by ECL (Bio-RAD, USA).
Co-immunoprecipitation (Co-ip) Assays
Co-IP assays were performed as previously described [20]. C2C12 myoblasts were seeded in 10-cm dishes and differentiated for 2 days. Cells were harvested and lysed in 1 ml lysis buffer (Sangon, Shanghai, China) with protease inhibitor (Sangon, Shanghai, China). The lysates were centrifuged to remove insoluble components and incubated with anti-FHL3 monoclonal antibody (Santa Cruz, USA; sc-166917), YY1 (Santa Cruz, USA; sc-281) or IgG antibody (Beyotime, Jiangsu, China) overnight at 4°C in the presence of Protein A + G Agarose beads (Beyotime, Jiangsu, China) after removing 25 µl lysates as the input control. The beads were washed four times using lysis buffer. The proteins were analyzed by western blotting as described above.
Protein Prokaryotic Expression And Gst Pulldown Assays
The recombinant GST, GST-FHL3, GST-YY1, GST-FHL3 truncated proteins, GST-YY1 truncated proteins, His-FHL3, His-YY1 and His-EZH2 (465–519) were produced by auto-induction in E. coli BL21. E. coli BL21 were grown to an OD 600 of 0.5 at 37°C in LB supplemented with 60 ug/ml ampicillin (GST-tagged and FHL3) or 60 ug/ml kanamycin (His-tagged). Protein product was induced with 0.1 mM IPTG for 5 hours at 37°C. All GST-tagged proteins were purified using a GST spin purification kit (Beyotime Biotechnology, P2262) according to the manufacturer’s instruction. In vitro-translated FHL3 proteins were loaded to Superdex S200 SEC column (GE Healthcare). All His-tagged proteins were purified using a His spin purification kit (Beyotime Biotechnology, China, P2226) according to the manufacturer’s instruction. GST pull-down assays were conducted according to the GST pulldown Assay Kit (Boxin, China, Bes3012), and then analyzed by western blotting.
Chromatin Immunoprecipitation (Chip) Assay
ChIP assays were performed after transfection of the pcDNA3.1-FHL3 plasmid or siRNA FHL3 into C2C12 myoblasts using the ChIP Assay Kit (Beyotime, Jiangsu, China). Each ChIP assay was performed using 1 µg of antibodies against YY1 (Cell Signaling Technology, USA; mAb#46395; 1:50), EZH2 (Abcam, UK; ab3748; 1:100) and H3K27me3 (Abcam, UK; ab6002; 1:100). IgG was used as the negative control. qPCR was conducted using the retrieved DNA and the primers for ChIP to check the enrichments of YY1, EZH2 and H3K27me3 at target gene regions. The YY1, EZH2 and H3K27me3 ChIP data were presented as % of Input. The ChIP primers amplification with MyHC2b specific primers (F: GCCATAAGCCTGACGCAGTA; R: CCCAGTGGTCCCCTATCAAA).
Statistical Analyses
All differences among groups were analyzed using unpaired or paired Student’s t-test. P < 0.05 and P < 0.01 were statistical significance. All data are presented as mean ± standard deviation.