Strains and chemicals.
Candidemia was defined by a Candida species-positive culture of blood from a patient with cancer (e.g., leukemia, lymphoma, multiple myeloma, or solid tumor) who presented with fever. According to the routine method, C. albicans were identified and screened by Candida CHROMagar medium after cultured according to the routine method. The C. albicans strains used in this work (CA2489, CA3208, CA10 and CA136) were clinical isolates from Shandong Tumor Hospital and Shandong Provincial Qianfoshan Hospital. C. albicans strains were grown routinely on yeast–peptone–dextrose (YPD) agar medium containing 1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose and 2% (w/v) agar at 35℃. RPMI 1640 medium (pH 7.0) with L-glutamine and without sodium bicarbonate was purchased from Gibco and buffered with MOPS (Sigma). Their susceptibilities were determined according to CLSI (Clinical and Laboratory Standards Institute, formerly NCCLS) M27-A3 document with C. albicans ATCC 10231 as reference strain [17]. The break points at 24 and 48 h are described as follows: as for fluconazole (FLC), minimum inhibitory concentration (MIC) ≤ 8 µg/ml (susceptible, S), MIC = 16–32 µg/ml (susceptible dose dependent, SDD), MIC ≥ 64 µg/ml (resistant, R); as for itraconazole (ITR), MIC ≤ 0.12 µg/ml (S), MIC = 0.25/0.5 µg/ml (SDD), MIC ≥ 1 µg/ml (R); as for voriconazole (VOR), MIC ≤ 1 µg/ml (S), MIC = 2 µg/ml (intermediate, I), MIC ≥ 4 µg/ml (R) [18]. FLC, ITR and VOR were kindly provided by Cheng Chuang Pharmaceutical Co., Ltd., China; ORI (chemical structure shown in Fig. 1) was purchased from the National Institute for the Control of Pharmaceutical and Biological Products (Beijing, China). Stock solution of FLC was prepared in sterile distilled water. ITR, VOR and ORI were dissolved in dimethyl sulfoxide (DMSO) to make a stock solution. DMSO concentration was kept below 0.01% in all the cell cultures, and did not exert any detectable effect on cell growth or cell death.
Checkerboard assay.
In order to determine possible synergistic interactions between the azoles and ORI against all Candida strains, checkerboard analysis was used and fractional inhibitory concentration index (FICI) values were calculated. The FICI was calculated by the formula FICI = FICIA + FICIB, where FICIA is calculated as MICA alone/MICA combination and FICIB is calculated as MICB alone/MICB combination. The interpretation of the FICI was as Odds suggested: the value of FICI ≤ 0.5 should be considered synergy, 0.5 < FICI ≤ 4 should be considered no interaction, and FICI > 4 antagonism [19]. Serial 2-fold dilutions were performed in RPMI 1640 medium and 50 µl of each drug dilution was added to each well of a round-bottomed 96-well plate. The final concentration of FLC, ITR, VOR and ORI ranged from 1 to 512 µg/ml, 0.016 to 8 µg/ml, 0.016 to 8 µg/ml and 2 to 128 µg/ml, respectively. The Candida cells in exponential phase of growth were harvested and suspended in sterilized phosphate buffer saline (PBS; pH 7.2). The concentrations of the Candida suspensions were measured by a hemocytometer (Shanghai Qiujing Biochemical Reagent Instrument Co. Ltd., China), followed by serial dilutions. A volume of 100 µl of the inoculum was added to the polystyrene plates and the final size of the inoculum was 2 × 103 CFU/ml for all stains. The plates were incubated at 35 °C. After 24 h and 48 h, 100 µl of the reagent containing 0.5 mg/ml XTT and 10 µmol/L menadione was added, followed by 2 h incubation in the dark at 35 °C. Then the colorimetric changes were measured at 492 nm with a microtiter plate reader (Bio-Rad, USA). The minimum inhibition concentration (MIC) is defined as the lowest drug concentration that caused an 80% reduction in optical density compared with that of drug-free control well. All the experiments were repeated three times.
Plotting of time-kill curve.
To investigate the effect of concentration and exposure time on the antifungal activities of the azoles with or without ORI, a time-killing test was performed against azole-resistant C. albicans, at the starting inoculum of 104 CFU/ml. Time-killing studies were conducted in eight groups: (1) drug-free control; (2) azole (FLC/ITR/VOR) alone; (3) ORI (8 µg/ml); (4) ORI (16 µg/ml); (5) ORI (32 µg/ml); (6) azole + ORI (8 µg/ml); (7) azole + ORI (16 µg/ml); (8) azole + ORI (32 µg/ml) FLC, ITR and VOR were used at the concentration of 8, 0.125 and 0.125 µg/ml, respectively. At predetermined time points (0, 6, 12, 24, and 48 h after incubation at 35 °C), an aliquot (100 µl) was aspirated from each group and transferred to a well of a 96-well plate. Then 100 µl of the reagent containing 0.5 mg/ml XTT and 10 µmol/L menadione was added, followed by 2 h incubation in the dark at 35 °C. After 2 h, the colorimetric changes were measured at 492 nm with a microtiter plate reader (Bio-Rad, USA). All experiments were conducted in triplicate, and the results were reported as mean values ± standard deviation (SD). The OD value for each incubation time point was plotted as the vertical ordinate.
Yeast apoptosis assays.
In yeast, phosphatidylserine is predominantly located on the inner leaflet of the lipid bilayer on the cytoplasmic membrane and is translocated to the outer leaflet during apoptosis [20]. The apoptotic marker, phosphatidylserine externalization, was analysed via staining with FITC-labelled annexin V and PI with the FITC-annexin V apoptosis detection kit (Solarbio Science and Technology Co., Ltd.). C. albicans cells were cultured overnight in YPD liquid medium and collected after 18 h. The exponentially growing yeasts were adjusted to 5⋅106 CFU/ml with PBS, and diluted to 4⋅105 CFU/ml in RPMI 1640 medium. FLC, ORI and combination of both were respectively added to cultures of C. albicans. Cell cultures without drug treatment served as controls. Cells were incubated for 10 h at 35 °C, and afterwards were collected by centrifugation and washed with cold PBS. Then cells in each group were incubated for 15 minutes at room temperature in dark in an annexin-binding buffer containing 5µ l Annexin V-FITC and 5µ l PI, respectively. Samples were then detected with FACS Calibur flow cytometer (Becton Dickinson).
Flow cytometric analysis of the efflux of rhodamine 6G (rh6G).
Rh6G (Sigma) can be absorbed into yeast cells and the efflux of rh6G uses the same membrane transporter as FLC in yeasts [21]. The intracellular rh6G concentration can be used to investigate the drug efflux mechanism in azole-resistant C. albicans [22]. The rh6G efflux was investigated by a flow cytometer (Becton Dickinson FACS Calibur) at 525 nm with the logarithmic-phase C. albicans cells (5 × 106 CFU/ml). C. albicans cells were firstly incubated at 35 °C at 120 rpm in glucose-free PBS buffer containing 10 µM rh6G. When rh6G absorbed into the cell reached equilibrium, uptake of rh6G was stopped by cooling the tubes on ice. The reaction mixture was washed three times with cold PBS buffer to remove rh6G, and then the fluorescence of the cells was determined. After removing the excess rh6G, 8 µg/ml ORI was added to detect efflux. The cells were subjected to a second incubation in PBS buffer containing 5% glucose. Cell cultures in the absence of ORI served as controls. At 90 min after the second incubation, the fluorescence of the cells was measured. Ten thousand cells with similar size and complexity were selected for evaluation in every assay. Experiments were replicated three times. Raw data were analyzed and plotted with GraphPad Prism 5.
Determination of possible resistance mechanisms to FLC by qPCR.
Total RNA was isolated from C. albicans planktonic cells with an RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. All RNA samples were treated with DNase I, RNase-free (Thermo Scientific) to prevent contamination with genomic DNA. The cDNA of each strain was synthesized using the Maxima First-Strand cDNA Synthesis Kit for RT-qPCR (Thermo Scientific) according to the manufacturer’s instructions. The PCR primers used to amplify and identify the C. albicans CDR1, CDR2 and ACT1 primer sequences (5' to 3') were as follows [23]: CDR1-F ACTCCTGCTACCGTGTTGTTATTG,CDR1-R ACCTGGACCACTTGGAACATAT TG, CDR2-F CTGTTACAACCACTATTGCTACTG, CDR2-R TACCTTGGACAACTGTGCTTC, ACT1-F TAAAGAGAAACCAGCGTA, ACT1-R CTCTTCTGGTAGAACCAC. All primers were synthesized by Sangon Biotech. The cDNA samples were mixed with Maxima SYBR Green/ ROX qPCR Master Mix (2 ×) (Thermo Scientific) and qPCR was performed using a 7500HT Fast Real-Time PCR System (Thermo Scientific). The cycling conditions were as follows: 1 cycle of 10 min at 95 °C; followed by 40 cycles of 15 sec at 95 °C, and 1 min at 58 °C for all genes. After amplification, a melting curve was analyzed to ensure the absence of primer dimers; the dissociation cycle was 15 sec at 95 °C 15 sec at 58 °C, and 15 sec at 95 °C. The level of gene expression was calculated using the 2−∆∆CT method with respect to the housekeeping gene ACT1. Samples were compared with the control, which was represented by CA10 cultivated without FLC and normalized to 1. Each experiment was repeated at least three times with three parallel samples in each experiment. Values are mean from three separate experiments. Bars are standard deviations. ANOVA (IBM SPSS Statistics version 23, Armonk, NY) was used for intergroup comparisons. Individual comparisons were done using the Tukey HSD analysis. Differences were considered statistically significant at p < 0.05 (*), strongly significant at p < 0.01 (**), and extremely significant at p < 0.001 (***).