Picolinafen exposure induces ROS accumulation and calcium depletion, leading to apoptosis in porcine embryonic trophectoderm and uterine luminal epithelial cells

doi:10.21203/rs.3.rs-2224820/v1

The global use of herbicides accounts for more than 48% of total pesticide usage. Picolinafen is a pyridine carboxylic acid herbicide that is predominantly used to control broadleaf weeds in wheat, barley, corn, and soybeans. Despite its widespread use in agriculture, its toxicity in mammals has rarely been studied. In this study, we first identified the cytotoxic effects of picolinafen on porcine trophectoderm (pTr) and luminal epithelial (pLE) cells, which are involved in the implantation process during early pregnancy. Picolinafen treatment significantly decreased the viability of pTr and pLE cells. Our results demonstrate that picolinafen increased the number of sub-G1 phase cells and early/late apoptosis. In addition, picolinafen disrupted mitochondrial function and resulted in the accumulation of intracellular ROS, leading to a reduction in calcium levels in both the mitochondria and cytoplasm of pTr and pLE cells. Moreover, picolinafen was found to significantly inhibit the migration of pTr. These responses were accompanied by the activation of the MAPK and PI3K signal transduction pathways by picolinafen. Our data suggest that the deleterious effects of picolinafen on the viability and migration of pTr and pLE cells might impair their implantation potential.

Picolinafen

Reactive oxygen species

Intracellular calcium

Apoptosis

Implantation

Trophectoderm

The global use of herbicides accounts for more than 48% of total pesticide usage (Gupta 2011). Picolinafen is a pyridine carboxamide herbicide used to control post-emergence weeds in wheat and barley (Dang et al. 2019). In particular, picolinafen is efficient in the removal of broadleaf weeds, including Galium aparine, Papaver spp., and Veronica spp., which are resistant to other herbicides in the market (2000). Picolinafen targets phytoene desaturase (PDS), which is essential for carotenoid biosynthesis in plants (Arias et al. 2006). The light protective function of carotenoids prevents membrane destruction by harmful oxygen species (Brausemann et al. 2017). Pyridine carboxylic acid herbicides have been known to not be completely degraded during harvest nor in the digestive tract of livestock. Picolinafen is a foliar-active herbicide that is directly applied to the leaves and stems of plants and is absorbed by diffusion from plants (Gaines et al. 2020). As picolinafen is fat-soluble (K_OW = 5.4), it has the potential to accumulate in animal tissues.

Previous research has detected picolinafen in an urban lake in the Philippines (Dimzon et al. 2018). According to risk assessments, picolinafen shows moderate toxicity towards mammals and high toxicity towards fish and aquatic vertebrates (Lewis et al. 2016). The 50% lethal dose was found to be 7 μg/L in fishes and 2.7 mg/kg in mammals. Moreover, developmental toxicity of picolinafen has been demonstrated at 10 μM in zebrafish embryos (Lee et al. 2021). Despite the extensive use of picolinafen, its molecular mechanisms in non-target cells have not been extensively studied. Previous studies have shown high bioaccumulation and reproductive toxicity of herbicides in fish (An et al. 2021; Park et al. 2021; Yang et al. 2021). In addition, research on the toxic effects of herbicides in murine preimplantation embryos revealed that exposure to low-dose herbicides increased apoptosis and inhibited blastocyst development (Greenlee et al. 2004). Therefore, we investigated the potential toxicity of picolinafen during the preimplantation stage.

Implantation is a series of processes that are regulated by intricate molecular mechanisms in the embryo and uterus (Dey et al. 2004; Kim et al. 2021). At the preimplantation stage, the initial step involves physiological contact between the trophectoderm and luminal epithelium, which leads to blastocyst attachment (Bae et al. 2020; Lessey 2002). Therefore, trophectoderm and endometrial epithelial cells are well suited for evaluating the effects of xenobiotics on implantation. Implantation failure accounts for 75% of total pregnancy losses (Bashiri et al. 2018). In particular, exposure to xenobiotics may directly or indirectly cause poor implantation (Mattison and Thomford 1989; Park et al. 2022a; Park et al. 2022b).

In this study, we determined the potential of picolinafen to inhibit implantation by investigating its cytotoxicity towards porcine trophectoderm (pTr) and luminal epithelial (pLE) cells. Notably, we discovered that picolinafen affected the viability of pTr and pLE cells. Moreover, we identified that picolinafen induced apoptosis in 2D monolayer and 3D spheroid culture conditions. To investigate the disruption of cellular physiological homeostasis, mitochondrial integrity and intracellular reactive oxygen species (ROS) levels were assessed following picolinafen treatment. In response to oxidative stress, the depletion of mitochondrial and cytosolic calcium levels was observed in pTr and pLE cells. Additionally, picolinafen reduced migration and altered the expression of implantation-related genes. These cytotoxic responses induced the activation of the MAPK and PI3K signaling pathways in pTr and pLE cells. This is the first study to elucidate the cytotoxic effects of picolinafen on mammalian cells, and our results indicate that picolinafen compromises the implantation potential of pTr and pLE cells.

Reagents

Picolinafen (purity ≥ 98.0 %) was purchased from Sigma-Aldrich (Cat. no. 37912). The powder was dissolved in dimethyl sulfoxide (DMSO) to prepare a working stock (4 mM). The stock solution was diluted with the culture medium to achieve the experimental concentrations (1, 2, and 4 μM). A vehicle control treated with DMSO was used to remove the effect of the solvent. The other reagents used in this study, including the antibodies and inhibitors, are listed in Table 1.

Cell culture

pLE and pTr cell lines originated from the endometrium of pregnant gilts (day 12) and blastocysts (day 12). pTr and pLE cells were cultured in DMEM/F12 1:1 medium containing 10% FBS, 1% ZellShield, and 0.1% insulin. Cells were cultured as monolayers in a CO₂ incubator at 37 °C in a humidified atmosphere. Information about the culture media and supplementary components is listed in Table 1.

Assessment of cell viability

Cell Proliferation Kit I (MTT) (Cat no. 11465007001) was used to measure cell viability. The pTr and pLE cells in 96-well plates were treated with picolinafen (0, 0.2, 0.5, 1, 2, 4, 5, and 6 μM) for 48 h. Next, the labeling solution was reacted for 3 h under the culture conditions. After confirming the formation of formazan crystals, the samples were incubated in lysis buffer overnight. The resulting signal was detected using a microplate reader (BMG LABTECH) at an optimal wavelength of 560 nm. IC₅₀ values were calculated using GraphPad Prism 8 software.

Cell cycle analysis

pTr and pLE cells (5.0 × 10⁴ cells/dish) were seeded in 6-well plates. The growth cycle of the cells was synchronized by culturing them in serum-free conditions for 24 h. After incubation with picolinafen (0, 1, 2, and 4 μM) for 48 h, an overnight incubation with 70% ethanol was used for fixation and permeabilization. RNase A was used to degrade double-stranded RNA. For the analysis of DNA content, pTr and pLE cells were further incubated with propidium iodide (PI). PI signals were measured using a flow cytometer (Accuri C6 Plus, BD Biosciences).

Analysis of apoptotic cell death

Annexin V FITC Apop Dtec Kit I (Cat no. 556547, BD Biosciences) was used to detect apoptosis. pTr and pLE cells incubated with picolinafen (0, 1, 2, and 4 μM) were treated with PI and Annexin V for 20 min. For flow cytometry analysis, the cell suspension was diluted with 1 annexin-binding buffer. The proportion of apoptotic cells was determined by fluorescence detection using a FACSCalibur flow cytometer (BD Biosciences).

Certification of spheroid formation

To create a 3-dimensional environment, pTr and pLE cells were grown in a spheroid form. The cells were seeded in 25 μL (3.0 10⁵ cells/mL) aliquots on the plate lid to allow cells to grow in a hanging position, and the cells were incubated in culture medium containing DMSO or picolinafen (4 μM) for 48 h. Images were obtained using a Leica microscope (5 ) and analyzed using the ImageJ software.

Analysis of mitochondrial integrity

To measure the mitochondrial membrane potential, JC-1 (SIGMA, CS0390) staining was performed in pTr and pLE cell lines. Picolinafen (0, 1, 2, and 4 μM) was added to the cells in 6-well plates for 48 h. Next, the adherent cells were detached and stained with JC-1 dye, which is a fluorescent probe that accumulates in the mitochondria, for 20 min. After resuspension in 1 staining buffer, the fluorescence signal was detected using flow cytometry (BD Accuri C6 Plus).

Measurement of mitochondrial calcium concentration

To assess calcium regulation by the mitochondria, pTr and pLE cells were incubated with picolinafen (0, 1, 2, and 4 μM) for 48 h. The cells were then treated with HBSS medium containing Rhod-2 AM (Invitrogen, R1244) dye at 4 °C for 30 min. After removing the dye solution, the cells were resuspended in prewarmed HBSS medium and incubated at 37 °C for 10 min. Rhod-2 fluorescence was detected by flow cytometry (BD Accuri C6 Plus).

Measurement of intracellular ROS generation

ROS generation was assessed by staining with 2’,7’-dichlorofluorescin diacetate (DCFH-DA). Prior to treatment with picolinafen, 10 μM of DCFH-DA was added to pTr and pLE cell suspensions and allowed to enter the cells for 1 h. Cells were then exposed to picolinafen (0, 1, 2, and 4 μM) at 37 °C for 2 h. The ROS inhibitor N-acetyl-L-cysteine (NAC) was co-treated with 4 μM picolinafen. The reactive oxygen species (ROS) signal was analyzed using a flow cytometer (BD Accuri C6 Plus).

Measurement of cytoplasmic calcium concentration

Fluo-4 AM (Invitrogen, F14201) was used to stain cytoplasmic calcium ions. pTr and pLE cells were incubated with picolinafen (0, 1, 2, and 4 μM) for 48 h. Then, the cells were harvested and incubated in a Fluo-4 AM staining solution for 20 min. The remaining Fluo-4 dye was washed with PBS (Cat. No. SH30256.01, Hyclone). The level of cytosolic calcium was determined by flow cytometric analysis (BD Accuri C6 Plus) of Fluo-4-stained cells.

Wound healing assay

To assess cell migration after the exposure to picolinafen, pTr and pLE cells (1.0 × 10⁶ cells/mL) were seeded in 6-well plates and cultured until the cells reached 100% confluence. Wounds were generated using a sterile 200-μL micropipette tip. Dead cells were washed with PBS, and then 2 mL of complete medium with or without picolinafen (4 μM) was added to each well. Images were taken immediately after treatment (0 h) and 15 h later using a 10 objective lens. Cell-free areas were measured using ImageJ software. The percentage closure was determined by normalizing the difference to the area at 0 h.

Real-time polymerase chain reaction

For RNA isolation, cells were treated with picolinafen (4 μM) for 24 h. The cells were lysed using Transzol-UP reagent (Cat no. ET111-01) and collected in 2 mL tubes. The detailed method for RNA preparation was performed as previously described. After separation with chloroform and precipitation with isopropanol, RNA pellets were dissolved in DEPC-DW. Using the extracted RNA as a template, cDNA was synthesized using the AccuPower® RT-premix. To amplify the target gene, Taq polymerase was added with primers that bind the target sequence. The Ct value of each target gene was calculated relative to that of the endogenous control GAPDH, which is a housekeeping gene. Details of the primers used are described in Table 2. All samples were run in triplicates.

Immunoblotting

Protein was extracted from cells treated with picolinafen (0, 1, 2, and 4 μM) for 3 h. For quantification of protein, a Bradford assay was performed using a spectrophotometer. Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. For antibody probing, proteins were transferred from the gel to the membrane using a Bio-Rad transblot module. After transfer, blocking with TBS-T solution containing 5% BSA was performed using an orbital shaker at room temperature (25 ℃) for 1 h. Following blocking, the membrane was incubated with antibody to probe target protein at 4 ℃ for overnight. For visualization, chemiluminescent substrates were applied to the membranes. Images of the blots were obtained using a Vilber. Antibodies used for immunoblotting are listed in Table 2.

Statistical analysis

One-way analysis of variance (ANOVA) was performed to determine the statistical significance of the differences between more than two groups. Based on the ANOVA results, post hoc tests were performed to confirm the groups where the differences occurred. P-values less than 0.05 indicates that the result is significant. Data are reported as the mean ± standard deviation.

Picolinafen decreases cell viability and alters cell cycle progression in pTr and pLE cells

To identify the toxic effects of picolinafen on pTr and pLE cells, cell viability was determined using an MTT assay. Viable cells were exposed to different picolinafen concentrations (0, 0.2, 0.5, 1, 2, 4, 5, and 6 μM) for 48 h. The results showed that picolinafen decreased the viability of both cell lines (Fig. 1A and B). The IC₅₀ values of picolinafen were 4.33 and 5.54 μM in pTr and pLE cells, respectively. The following experiments were performed at a concentration range of less than 4 μM. We confirmed the cell cycle regulation by picolinafen in pTr and pLE cells (Fig. 1C and D). The ratio of cells in the G2/M phase decreased by picolinafen by approximately 0.65- and 0.6-fold in both cell lines. In contrast, the sub G1 phase was observed to increase approximately 5.68- and 4.03-fold in pTr and pLE cells, respectively. Additionally, an increase in the G1 phase was observed in pLE cells, and both G1 and S phases were decreased in pTr cells. We further investigated the expression of cyclin D1, which significantly decreased only in pLE cells (Fig. 1E and F). This result suggested that picolinafen induced G1 phase arrest in pLE cells.

Picolinafen induces apoptosis in pTr and pLE cells and impairs self-assembly of cell spheroids.

Since the sub-G1 cell population was evaluated in the cell cycle analysis, we confirmed apoptotic cell death by picolinafen through Annexin V/PI staining (Fig. 2A and B). Picolinafen increased early apoptosis by 3.23 and 1.5 fold in pTr and pLE cells, respectively. In addition, late apoptosis increased by 3.1 and 1.73 fold, respectively. For a more accurate evaluation of picolinafen toxicity, we investigated the effects of picolinafen in the 3-dimensional hanging-drop spheroid culture condition. After 48 h, the DMSO-treated spheroids showed distinct outlines, whereas the picolinafen-treated spheroids showed loose aggregates (Fig. 2C). The percentage of area was reduced by 0.71 and 0.72 fold in pTr and pLE cells, respectively, and the integrated density of cell spheroids also decreased by 0.72 and 0.8 fold, respectively, in both cell lines (Fig. 2D). These results suggest that picolinafen exerts cytotoxicity in pTr and pLE cells in a 3D environment.

Picolinafen interferes with mitochondrial integrity and calcium homeostasis in pTr and pLE cells

Mitochondrial function was evaluated using the fluorochrome JC-1, which accumulates depending on membrane potential.Mitochondria depolarization was indicated by an increase in green/red fluorescence ratio. The ratio of the green fluorescence signal increased upon treatment with picolinafen (Fig. 3A-D). Picolinafen increased JC-1 green signal by approximately 1.9 fold in both pTr and pLE cells. Rhod-2 AM staining showed a reduction in mitochondrial calcium levels upon picolinafen treatment in both cell lines (Fig. 3E-H). The concentration of mitochondrial calcium ions reduced by 0.56 and 0.36 fold in pTr and pLE cells, respectively, in response to picolinafen treatment, in a dose-dependent manner.

Picolinafen causes ROS accumulation and disrupts intracellular Ca²⁺ regulation

We suspected that the mitochondrial membrane potential disruption by picolinafen treatment occurred due to intracellular ROS dysregulation. The results showed that picolinafen significantly increased the level of intracellular ROS by 1.93 and 2 fold in pTr and pLE cells, respectively (Fig. 4A-D). The increased ROS levels were effectively restored in response to treatment with the ROS inhibitor N-acetyl-L-cysteine (NAC). Under the same conditions, cytoplasmic calcium levels significantly reduced by 0.61 and 0.58 fold in pTr and pLE cells, respectively (Fig. 4E-H).

Picolinafen inhibits pTr cell migration and alters the transcriptional regulation of genes involved in apoptosis and implantation

Given that picolinafen compromised cellular homeostasis and induced cell death, we investigated the expression of apoptotic factors, including BAX, BAK1, and Caspase 3. The results showed that picolinafen increased BAX by 1.31 fold, BAK1 by 1.3 fold, and CASP3 by 1.4 fold compared to the DMSO-treated group in pTr cells (Fig. 5A). In pLE cells, BAX and BAK1 expression levels increased in the presence of picolinafen by approximately 1.72 and 1.34 fold, respectively, whereas the expression of CASP3 was unchanged (Fig. 5B). Next, the effects of picolinafen on cell migration were assessed using a wound healing assay. We generated gaps by scratching the fully seeded plate and observed gap closure in the presence and absence of picolinafen (4 μM) (Fig. 5C and D). Furthermore, picolinafen significantly decreased the percentage of wound closure in pTr cells by 0.31 fold compared with that in DMSO-treated cells (Fig. 5F). We also identified the expression of genes that could affect implantation potential in pTr and pLE cells (Fig. 5G and H). In pTr cells, the expression level of the cytochrome P450 enzyme-coding gene CYP1A1 increased upon picolinafen treatment. In addition, the expression of FOLR1 and ITGAV, which are involved in implantation, was markedly reduced by picolinafen in pTr cells.

Picolinafen activates the MAPK and PI3K/AKT signaling pathways in pTr and pLE cells

To investigate the effect of picolinafen cytotoxicity on intracellular signaling pathways, we evaluated signaling through the MAPK and PI3K/AKT pathways using western blotting. With picolinafen treatment, the phosphorylation levels of ERK1/2, JNK, and p38 were elevated in both cell lines. In pTr cells, the abundance of phosphorylated ERK1/2, JNK, and p38 increased by 1.34, 1.72, and 3.59 fold, respectively (Fig. 6A-C). In pLE cells, the abundance of phosphorylated JNK and p38 increased by 1.88 and 2.0 fold, respectively, in the presence of 4 μM picolinafen, whereas the level of phospho-ERK1/2 was unaffected by picolinafen in pLE cells (Fig. 6D-F). Furthermore, the expression levels of PI3K/AKT signaling proteins were also increased upon treatment with picolinafen in both cell lines. Specifically, the levels of phospho-AKT, p70S6K, and S6 increased by 1.78, 1.28, and 2.03 fold, respectively, at the optimal picolinafen concentration in pTr cells (Fig. 6G-I). In pLE cells, picolinafen increased the levels of p-AKT, p-p70S6K, and p-S6 by 1.23, 1.28, and 1.76 fold, respectively (Fig. 6J-L).

Interactions between the MAPK and PI3K/AKT signaling pathways upon picolinafen treatment in pTr and pLE cells.

Interactions between the MAPK and PI3K/AKT signaling pathways were analyzed using pharmacological inhibitors (Fig. 7A and B). Prior to picolinafen treatment, the cells were pre-incubated with wortmannin (PI3K inhibitor), U0126 (ERK1/2 inhibitor), SP600125 (JNK inhibitor), and SB203580 (p38 inhibitor) for 2 h. Administration of these inhibitors significantly reduced the phosphorylation levels of relevant pathway targets. Specifically, p- ERK1/2 levels were suppressed by U0126 and SB203580 treatment in pTr and pLE cells (Fig. 7C). Furthermore, JNK phosphorylation was inhibited by SP600125 in pTr cells, and in pLE cells, p-JNK levels were also reduced by wortmannin and U0126 (Fig. 7D). In pLE cells, wortmannin and SB203580 restored the levels of p-p38 and SP203580, whereas SP600125 increased the phosphorylation of p38 (Fig. 7E). Down-regulation of phospho-AKT was observed following treatment with wortmannin and SB203580 in pTr cells, whereas only wortmannin inhibited p-AKT in pLE cells. The phosphorylation of p70S6K was effectively inhibited by wortmannin, U0126, and SB203580 in both cell lines (Fig. 7G). S6, a downstream factor of p70S6K, was inhibited by wortmannin and U0126 in pTr cells, whereas this target was significantly down-regulated by all four inhibitors in pLE cells (Fig. 7H). Therefore, these findings suggest that picolinafen alters the MAPK and PI3K signaling pathways and affects crosstalk between the two pathways.

Picolinafen is widely used in barley, wheat, corn, and soybeans, where it is was applied to a large surface area. Moreover, its lipophilicity, with a low Kow constant, allows picolinafen to persist for long durations in the environment. Despite its extensive use, picolinafen has been poorly studied, and its toxicity to mammalian cells has not yet been reported. Here, we identified the cytotoxic effects of picolinafen using porcine trophectoderm and luminal epithelium cell lines isolated from pregnant gilts during the peri-implantation period. We evaluated cell viability by measuring mitochondrial succinate dehydrogenase activity after 48 h of picolinafen exposure. Cellular toxicity was confirmed by measuring cell cycle arrest and apoptosis. Picolinafen treatment resulted in a defective G1/S transition in pLE cells, which was evidenced by a decrease in cyclin D1 expression in pLE cells. The toxic effects of picolinafen were further identified in a 3-dimensional cell spheroid, which more accurately recapitulate the native environment of the cells (Langhans 2018). Cell aggregation is associated with cell adhesion, which is required for implantation. Therefore, the impaired formation of pTr and pLE cell spheroids by picolinafen indicated inhibitory effects on the implantation potential of pTr and pLE cells.

Our results showed the dissipation of MMP and subsequent decrease in mitochondrial calcium concentration upon treatment of pTr and pLE cells with picolinafen. Mitochondria play a crucial role in maintaining cellular calcium homeostasis, and excessive calcium uptake by mitochondria induces cell death (Pinton et al. 2008). However, depletion of mitochondrial calcium ions can also lead to apoptosis by promoting stress-induced mitochondrial hyperfusion (Romero-Garcia and Prado-Garcia 2019). In addition, the increased expression of BAX, BAK1 and CASP3 suggested that picolinafen induced mitochondria-mediated apoptosis in pTr and pLE cells. BAX and BAK1 are pro-apoptotic regulators that form pores in the outer mitochondrial membrane (Cosentino et al. 2022). For dimerization, activation of BAK1 precedes BAX activation during apoptosis induction (Iyer et al. 2020). The unchanged expression of caspase 3 in pLE cells requires further confirmation.

The mode of action of some herbicides involves the generation of ROS and subsequent cellular and tissue damage (Caverzan et al. 2019). Picloram, another pyridine carboxylic acid herbicide, downregulates the expression of antioxidant enzymes in mouse neuroblastoma cells (Reddy et al. 2011). The present study revealed that picolinafen elevated intracellular ROS levels in both cell lines. When ROS production increases dramatically, excess ROS induces oxidative stress and results in cellular damage to membrane proteins, receptors, and ion channels. Because of the mutual regulation of calcium and ROS, ROS and redox states can alter the activity of calcium channels and pumps, leading to the alteration of intracellular calcium homeostasis (Görlach et al. 2015). In this study, a significant reduction in cytosolic calcium levels was observed in pTr and pLE cells upon treatment with picolinafen. The importance of the calcium concentration during implantation has been identified in previous studies. Notably, in pigs, calcium influx in uterine endometrium has been found to be increased during the implantation (Choi et al. 2009). In mouse embryos, calcium ion depletion has been reported to cause proliferation and adhesion defects in trophectoderm cells, leading to embryonic lethality (Schütz et al. 2021). Therefore, the dysregulation of calcium homeostasis plays a role in the inhibitory effects of picolinafen on the implantation capacity of pTr and pLE cells.

Moreover, several studies have suggested that ROS can activate intracellular signaling pathways, including the mitogen-activated protein kinase (MAPK) and protein kinase B (AKT) pathways (Chang et al. 2021; Luo et al. 2019; Song and Liu 2021). MAPK signal transduction is a stress-response signaling pathway that is stimulated by oxidative stress. The accumulation of ROS has been reported to activate p38 and JNK pathways (Son et al. 2011). Paraquat, an oxidant-producing herbicide, has been reported to induce apoptosis by activating stress-induced JNK signaling (Peng et al. 2004). Our observations showed that phosphorylated AKT, p70S6K, and S6 levels were increased by picolinafen in pTr and pLE cells. This indicates that the activation of the PI3K/AKT pathway can also induce apoptosis. Given that p70S6K is regulated by ERK signaling under stress conditions, p70 and S6 induction is likely to act as a downstream factor of the MAPK pathway (Loyau et al. 2014). This is consistent with our observations that MAPK inhibitors suppress the activity of p70S6K and S6 (Fig. 7).

Implantation requires the migration and adhesion of embryonic trophectoderm cells for successful pregnancy (Ochoa-Bernal and Fazleabas 2020). During embryo implantation, trophectoderm migration is crucial for adherence to the uterine endometrium (Calle et al. 2021). The results of this study showed that picolinafen reduced the migration of pTr. Although low levels of ROS are known to promote cell migration, overproduction of ROS inhibits cell migration by disrupting cellular homeostasis (Hurd et al. 2012). Another potential mechanism is decreased motility due to calcium depletion. Calcium signaling regulates the polarization and direction of cell migration. Therefore, a decrease in intracellular calcium levels may impede cell migration. Additional experiments are required to elucidate the mechanism underlying the anti-migratory effects of picolinafen. Furthermore, picolinafen significantly reduced the expression of the folate receptor (FOLR1) in pTr cells. Folate receptors are highly expressed in the endometrium and pre-implantation embryo because folate metabolism is essential for de novo synthesis of nucleotides and proteins in early pregnancy (Wilkinson et al. 2021). Additionally, picolinafen decreased the expression of integrin alpha V (ITGAV), an essential factor that adheres to the uterine endometrium. It has been demonstrated that trophectoderm upregulates the expression of cell adhesion-related genes during peri-implantation period (Frank et al. 2017). CYP1A1, cytochrome P450, has been reported to be involved in the metabolism of xenobiotics. An increase in CYP1A1 expression indicates cytotoxicity, and consistent expression can damage early embryonic development (Gialitakis et al. 2017). Based on these observations, picolinafen may affect the migration and adhesion of pTr cells.

These findings suggest that picolinafen reduces cell viability and migration, leading to the impaired implantation capacity of pTr and pLE cells. Picolinafen increased sub-G1 phase and early/late apoptosis in pTr and pLE cells. In addition, picolinafen-induced mitochondrial disruption and ROS production lead to intracellular calcium depletion. Moreover, picolinafen reduced the migration of pTr and activated the MAPK and PI3K signaling pathways in pTr and pLE cells. Collectively, this study showed the potential of picolinafen to interfere with the implantation process in pTr and pLE cells . Furthermore, the present study is the first to report the intracellular mechanisms of action of picolinafen in mammalian cells. Therefore, the results of this study provide novel information regarding the non-targeted toxicity of picolinafen. Our study was limited to in vitro experiments; therefore, additional animal experiments are needed to reliably predict potential toxic effects in vivo.

ACKNOWLEDGEMENTS

This work was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2020R1A6A3A13075810) and the National Research Foundation of Korea (NRF) grant funded by the Korea government (MSIT) (2021R1A2C2005841 & 2021R1C1C1009807).

CONFLICT OF INTEREST

The authors have declared no conflict of interest.

(2000) Picolinafen, a new active ingredient for the weed control in post-emergence of wheat and barley. Atti Giornate fitopatologiche Perugia 16-20 aprile 2000, 2:405-410
An G, Park H, Song G, Lim W (2021) Developmental toxicity of dimethachlor during zebrafish embryogenesis mediated by apoptosis and oxidative stress. Journal of Animal Reproduction and Biotechnology 36(1):2-8 doi:10.12750/JARB.36.1.2
Arias RS, Dayan FE, Michel A, Howell JL, Scheffler BE (2006) Characterization of a higher plant herbicide-resistant phytoene desaturase and its use as a selectable marker. Plant Biotechnology Journal 4(2):263-273 doi:https://doi.org/10.1111/j.1467-7652.2006.00179.x
Bae H, Yang C, Lee JY, et al. (2020) Melatonin improves uterine-conceptus interaction via regulation of SIRT1 during early pregnancy. J Pineal Res 69(2):e12670 doi:10.1111/jpi.12670
Bashiri A, Halper KI, Orvieto R (2018) Recurrent Implantation Failure-update overview on etiology, diagnosis, treatment and future directions. Reproductive Biology and Endocrinology 16(1):121 doi:10.1186/s12958-018-0414-2
Brausemann A, Gemmecker S, Koschmieder J, Ghisla S, Beyer P, Einsle O (2017) Structure of Phytoene Desaturase Provides Insights into Herbicide Binding and Reaction Mechanisms Involved in Carotene Desaturation. Structure 25(8):1222-1232.e3 doi:https://doi.org/10.1016/j.str.2017.06.002
Calle A, Toribio V, Yáñez-Mó M, Ramírez MÁ (2021) Embryonic Trophectoderm Secretomics Reveals Chemotactic Migration and Intercellular Communication of Endometrial and Circulating MSCs in Embryonic Implantation. International journal of molecular sciences 22(11):5638
Caverzan A, Piasecki C, Chavarria G, Stewart CN, Vargas L (2019) Defenses Against ROS in Crops and Weeds: The Effects of Interference and Herbicides. International journal of molecular sciences 20(5):1086
Chang Y, He J, Ma B, et al. (2021) Prevention of acetaminophen-induced hepatocyte injury: JNK inhibition and GSTA1 involvement. Molecular & Cellular Toxicology 17(2):161-168 doi:10.1007/s13273-021-00119-8
Choi Y, Seo H, Kim M, Ka H (2009) Dynamic Expression of Calcium-Regulatory Molecules, TRPV6 and S100G, in the Uterine Endometrium During Pregnancy in Pigs1. Biology of Reproduction 81(6):1122-1130 doi:10.1095/biolreprod.109.076703
Cosentino K, Hertlein V, Jenner A, et al. (2022) The interplay between BAX and BAK tunes apoptotic pore growth to control mitochondrial-DNA-mediated inflammation. Molecular Cell 82(5):933-949.e9 doi:https://doi.org/10.1016/j.molcel.2022.01.008
Dang HT, Malone JM, Gill G, Preston C (2019) Cross-resistance to diflufenican and picolinafen and its inheritance in oriental mustard (Sisymbrium orientale L.). Pest Management Science 75(1):195-203 doi:https://doi.org/10.1002/ps.5087
Dey SK, Lim H, Das SK, et al. (2004) Molecular Cues to Implantation. Endocrine Reviews 25(3):341-373 doi:10.1210/er.2003-0020
Dimzon IKD, Morata AS, Müller J, et al. (2018) Trace organic chemical pollutants from the lake waters of San Pablo City, Philippines by targeted and non-targeted analysis. Sci Total Environ 639:588-595 doi:10.1016/j.scitotenv.2018.05.217
Frank JW, Seo H, Burghardt RC, Bayless KJ, Johnson GA (2017) ITGAV (alpha v integrins) bind SPP1 (osteopontin) to support trophoblast cell adhesion. Reproduction 153(5):695-706 doi:10.1530/rep-17-0043
Gaines TA, Duke SO, Morran S, et al. (2020) Mechanisms of evolved herbicide resistance. Journal of Biological Chemistry 295(30):10307-10330 doi:10.1074/jbc.REV120.013572
Gialitakis M, Tolaini M, Li Y, et al. (2017) Activation of the Aryl Hydrocarbon Receptor Interferes with Early Embryonic Development. Stem Cell Reports 9(5):1377-1386 doi:10.1016/j.stemcr.2017.09.025
Görlach A, Bertram K, Hudecova S, Krizanova O (2015) Calcium and ROS: A mutual interplay. Redox Biol 6:260-271 doi:10.1016/j.redox.2015.08.010
Greenlee AR, Ellis TM, Berg RL (2004) Low-dose agrochemicals and lawn-care pesticides induce developmental toxicity in murine preimplantation embryos. Environmental Health Perspectives 112(6):703-709 doi:doi:10.1289/ehp.6774
Gupta PK (2011) Chapter 39 - Herbicides and fungicides. In: Gupta RC (ed) Reproductive and Developmental Toxicology. Academic Press, San Diego, p 503-521
Hurd TR, DeGennaro M, Lehmann R (2012) Redox regulation of cell migration and adhesion. Trends Cell Biol 22(2):107-15 doi:10.1016/j.tcb.2011.11.002
Iyer S, Uren RT, Dengler MA, et al. (2020) Robust autoactivation for apoptosis by BAK but not BAX highlights BAK as an important therapeutic target. Cell Death & Disease 11(4):268 doi:10.1038/s41419-020-2463-7
Kim D, Kim H-D, Son Y, et al. (2021) Establishment of normal reference intervals in serum biochemical parameters of domestic sows in Korea. Journal of Animal Reproduction and Biotechnology 36(4):261-269 doi:10.12750/JARB.36.4.261
Langhans SA (2018) Three-Dimensional in Vitro Cell Culture Models in Drug Discovery and Drug Repositioning. Frontiers in pharmacology 9 doi:10.3389/fphar.2018.00006
Lee J-Y, Park S, Lim W, Song G (2021) Picolinafen exerts developmental toxicity via the suppression of oxidative stress and angiogenesis in zebrafish embryos. Pesticide Biochemistry and Physiology 171:104734 doi:https://doi.org/10.1016/j.pestbp.2020.104734
Lessey BA (2002) Adhesion molecules and implantation. Journal of Reproductive Immunology 55(1):101-112 doi:https://doi.org/10.1016/S0165-0378(01)00139-5
Lewis KA, Tzilivakis J, Warner DJ, Green A (2016) An international database for pesticide risk assessments and management. Human and Ecological Risk Assessment: An International Journal 22(4):1050-1064 doi:10.1080/10807039.2015.1133242
Loyau T, Métayer-Coustard S, Berri C, et al. (2014) Thermal Manipulation during Embryogenesis Has Long-Term Effects on Muscle and Liver Metabolism in Fast-Growing Chickens. PLOS ONE 9(9):e105339 doi:10.1371/journal.pone.0105339
Luo Z, Xu X, Sho T, et al. (2019) ROS-induced autophagy regulates porcine trophectoderm cell apoptosis, proliferation, and differentiation. American Journal of Physiology-Cell Physiology 316(2):C198-C209 doi:10.1152/ajpcell.00256.2018
Mattison DR, Thomford PJ (1989) The mechanisms of action of reproductive toxicants. Toxicologic pathology 17(2):364-376
Ochoa-Bernal MA, Fazleabas AT (2020) Physiologic Events of Embryo Implantation and Decidualization in Human and Non-Human Primates. International journal of molecular sciences 21(6) doi:10.3390/ijms21061973
Park H, Song G, Lim W (2021) Isoprocarb induces acute toxicity in developing zebrafish embryos through vascular malformation. Journal of Animal Reproduction and Biotechnology 36(1):17-24 doi:10.12750/JARB.36.1.17
Park J, An G, Lim W, Song G (2022a) Dinitramine induces implantation failure by cell cycle arrest and mitochondrial dysfunction in porcine trophectoderm and luminal epithelial cells. J Hazard Mater 435:128927 doi:10.1016/j.jhazmat.2022.128927
Park W, An G, Lim W, Song G (2022b) Exposure to iprodione induces ROS production and mitochondrial dysfunction in porcine trophectoderm and uterine luminal epithelial cells, leading to implantation defects during early pregnancy. Chemosphere 307(Pt 2):135894 doi:10.1016/j.chemosphere.2022.135894
Peng J, Mao XO, Stevenson FF, Hsu M, Andersen JK (2004) The herbicide paraquat induces dopaminergic nigral apoptosis through sustained activation of the JNK pathway. J Biol Chem 279(31):32626-32 doi:10.1074/jbc.M404596200
Pinton P, Giorgi C, Siviero R, Zecchini E, Rizzuto R (2008) Calcium and apoptosis: ER-mitochondria Ca2+ transfer in the control of apoptosis. Oncogene 27(50):6407-18 doi:10.1038/onc.2008.308
Reddy TP, Manczak M, Calkins MJ, et al. (2011) Toxicity of Neurons Treated with Herbicides and Neuroprotection by Mitochondria-Targeted Antioxidant SS31. Int J Environ Res Public Health 8(1):203-221
Romero-Garcia S, Prado-Garcia H (2019) Mitochondrial calcium: Transport and modulation of cellular processes in homeostasis and cancer (Review). International journal of oncology 54(4):1155-1167 doi:10.3892/ijo.2019.4696
Schütz A, Richter C, Weissgerber P, et al. (2021) Trophectoderm cell failure leads to peri-implantation lethality in Trpm7-deficient mouse embryos. Cell Reports 37(3):109851 doi:https://doi.org/10.1016/j.celrep.2021.109851
Son Y, Cheong Y-K, Kim N-H, Chung H-T, Kang DG, Pae H-O (2011) Mitogen-Activated Protein Kinases and Reactive Oxygen Species: How Can ROS Activate MAPK Pathways? Journal of Signal Transduction 2011:792639 doi:10.1155/2011/792639
Song J-G, Liu L (2021) Naringenin alleviates bone cancer pain in rats via down-regulating spinal P2X7R /PI3K/AKT signaling: involving suppression in spinal inflammation. Molecular & Cellular Toxicology 17(4):475-484 doi:10.1007/s13273-021-00156-3
Wilkinson AL, Menelaou K, Rakoczy J, Tan XS, Watson ED (2021) Disruption of folate metabolism causes poor alignment and spacing of mouse conceptuses for multiple generations. bioRxiv:2021.06.11.448112 doi:10.1101/2021.06.11.448112
Yang C, Lim W, Song G (2021) Reproductive toxicity due to herbicide exposure in freshwater organisms. Comp Biochem Physiol C Toxicol Pharmacol 248:109103 doi:10.1016/j.cbpc.2021.109103

Table 1. The list of reagents

Reagents	Cat No.	Sources
DMEM/F12 1:1	SH30023.02	Hyclone
Fetal bovine serum	SV30207.02	Hyclone
ZellShield	13-0050	Minerva Biolabs
Insulin from bovine pancreas	I6634	Sigma-Aldrich
p-ERK1/2 (Thr²⁰²/Tyr²⁰⁴)	9101	Cell Signaling Technology
p-JNK (Thr¹⁸³/Tyr¹⁸⁵)	4668	Cell Signaling Technology
p-p38 (Thr¹⁸⁰/Tyr¹⁸²)	4511	Cell Signaling Technology
p-AKT (Ser⁴⁷³)	4060	Cell Signaling Technology
p-p70S6K (Thr⁴²¹/Ser⁴²⁴)	9204	Cell Signaling Technology
p-S6 (Ser²³⁵/Ser²³⁶)	2211	Cell Signaling Technology
t-ERK1/2	4695	Cell Signaling Technology
t-JNK	9252	Cell Signaling Technology
t-p38	9212	Cell Signaling Technology
t-AKT	9272	Cell Signaling Technology
t-p70S6K	9202	Cell Signaling Technology
t-S6	2217	Cell Signaling Technology
Wortmannin	ST415	Enzo Life Sciences
U0126	E1282	Enzo Life Sciences
SP600125	E1305	Enzo Life Sciences
SB203580	EI286	Enzo Life Sciences

Table 2. Primer sequences for quantitative RT-PCR

Gene symbol	GenBank no.	Forward primer (5′→3′)	Reverse primer (5′→3′)
CCND1	XM_021082686.1	TCTACACCGACAACTCCATCC	GCATTTTGGAGAGGAAGTGC
BAX	XM_003127290.5	TTTGCTTCAGGGTTTCATCC	GACACTCGCTCAACTTCTTGG
BAK1	XM_021098603.1	GTTGGACTCAGGGATTCTGG	TGGGAGCAAGTAGGAACAGG
CASP3	NM_214131.1	TGGGACTGAAGATGACATGG	GATCCGTCCTTTGAATTTCG
CYP1A1	NM_214412.1	CTACATGCCCACTTTGAGCC	ACTTCACCTCTGCCTCTTCC
FOLR1	NM_214311.1	GCCACTCCTTTGAAGTCAGC	TCTCCGTCAAGTTGGTCAGG
ITGAV	XM_021074686.1	ATTCTTGTTGCCTCTGTGCG	AAGAAATCAACCGCGAACCC
GAPDH	XM_020946773.1	CAATGACCCCTTCATTGACC	CTCCTGGAAGATGGTGATGG

No competing interests reported.

Picolinafen exposure induces ROS accumulation and calcium depletion, leading to apoptosis in porcine embryonic trophectoderm and uterine luminal epithelial cells

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Declarations

References

Tables

Additional Declarations

Status:

Version 1