2.1. Clinical tissue samples
Clinical osteosarcoma and adjacent normal bone tissues were collected from osteosarcoma patients who underwent surgery from 2016 to 2019 in the Affiliated Tumor Hospital of Zhengzhou University (Hunan, China). This work was approved by the Ethical Committee of Zhengzhou University and all of the patients consented to participate in this study. Samples were immediately snap-frozen in liquid nitrogen for further study.
2.2. Cell lines and cell culture
Human osteosarcoma cell lines MG-63 (ATCC® CRL-1427™), Saos-2 (ATCC® HTB-85™), U-2 OS (ATCC® HTB-96™), and human osteoblast cell line HOS (ATCC® CRL-1543™) was obtained from ATCC (Washington, USA). Human primary osteoblast cell line HOB was obtained from PromoCell (Heidelberg, Germany). Cell lines were cultured in Osteoblast Growth Medium C-27001 (Heidelberg, Germany) in a humidified atmosphere of 5% CO2 at 37°C.
2.3. MTT assay
The MTT assay was first reported by Mossmann in 1983 [38]. It is commonly used for both cancer cell and non-cancer cell viability determination [39, 40]. Briefly, cells were grown in 96 well plates and at the endpoint of the culture time, the culture medium was removed and 0.8 mg/ml of MTT working solution (dissolved in serum-free medium) was added to the wells. After 4 hours, DMSO was added to the wells, and absorbance was recorded at 560 nm using the microplate spectrophotometer system (Spectra max190-Molecular Devices).
2.4. RNA extraction and QPCR
The expression of STK4-AS1 was determined by QPCR assay which was described previously [41]. Total RNA from tissue or cell samples was extracted by using Trizol reagent (Invitrogen, Calsbad, CA, USA). Then the total RNA was reversely transcribed into cDNA using a reverse transcription kit (Thermo, USA). Quantitative real time-PCR was done with PowerUp™ SYBR™ Green Master Mix (Thermo, USA) using the ViiA 7 Real-Time PCR System (Applied Biosystems). The protocol for PCR: 95°C for 3 min, 40 cycles of 95°C for 30 s, 58°C for 15 s, and 72°C for 30 s. Gene expression was quantified using the 2-△△CT method. The primers used for RT-PCR were designed by Eurofine Genomic primer design online tools and synthesized by Sigma-Aldrich, Inc. (St. Louis, MO, USA). The sequences are as follows: GAPDH forward: 5’-AATGGGCAGCCGTTAGGAAA-3’ and reverse: 5’-TGAAGGGGTCATTGATGGCA-3’. STK4-AS1 forward: 5’- CGGAGCGCACAAAATACTCG-3’ and reverse: 5’-CCACAAATACCTCCAGGCGT-3’.
2.5. Cell transfection
The STK4-AS1 knockdown and overexpression cells and p53 rescue cells were conducted by transfection of siRNA or expression vector. The cell lines were transfected using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The expression levels of STK4-AS1 were validated by qPCR. The expression of p53 was validated by immunofluorescence imaging and western blotting. The cell transfection method was described previously [42].
The experimental details are as follows: (1) STK4-AS1 knockdown: STK4-AS1 small interfering (si)RNA and negative control siRNA were purchased from Sigma-Aldrich (St. Louis, MO, USA). The sequences were as follows: STK4-AS1 siRNA, 5′- ACCTCGGCCAGAGAGGTGAAGTATCTTCAAGAGAGATACTTCACCTCTCTGGCCTT-3′. A scramble siRNA (siN05815122147) was used as the NC siRNA. The transfection concentration of siRNA was 60 nM. (2) STK4-AS1 overexpression: The entire sequence of human STK4-AS1 was amplified from hFOB cell lines using PCR and cloned into the pcDNA3.1 vector. The negative control empty vector, which was purchased from Sigma-Aldrich (St. Louis, MO, USA). The transfection concentration of the plasmid was 2 µg/ml. (3) P53 rescue: p38 expressing vectors, TR200pa-ppGF-p53-mCMV-EF1α-Puro (plasmid), and negative vectors were purchased from System Biosciences (Palo Alto, CA, USA). The transfection concentration of the plasmid was 2 µg/ml.
The control of cell transfection was set as follows: Ctrl1: cells without treatment; Ctrl2: cells with NC siRNA transfection; Ctrl3: cells with empty pcDNA3.1 vector transfection; Ctrl4: cells with NC siRNA and p53 negative vector transfection.
2.6. Cell cycle analysis
The cell cycle was analyzed using flow cytometry with propidium iodide (PI) staining, which was described previously [43]. Briefly, cells were washed with PBS and resuspended at a concentration of 1 × 106/mL. Cells were fixed with 100% ethanol for three hours at 4 °C. Then suspended cells were washed with PBS two times and incubated with propidium iodide staining solution (0.1% Triton X-100, 0.2 mg/mL DNAse-free RNAse A, 0.02 mg/mL in cold PBS) at 37 °C for 15 min. BD FACSCalibur was used to acquire cell cycle data. FlowJo Version 10 was used to analyze the data.
2.7. Western blotting
The western blotting method was described previously [44]. Briefly, proteins were extracted from cells using RIPA buffer with protease inhibitor (Sigma-Aldrich, USA). Total protein concentrations were determined using a BCA protein assay kit to control the loading amount (25 μg). SDS gel electrophoresis was performed to separate proteins. Afterward, the proteins were transferred to 0.2-μm polyvinylidene difluoride membranes which were subsequently blocked with 5% skim milk in Tris-buffered saline with 0.5% Tween- 20 (TBST). Membranes were then reacted with primary (1:1000 dilution of 5% skim milk in TBST) and secondary antibodies (1:3000 dilution of 5% skim milk in TBST) subsequently. The band intensities were photographed using a super-sensitive gel imaging system after reacted with ECL reagents (Bio-Rad, Hercules, CA, USA).
The primary antibodies used in the experiment are as follow: Anti-cyclin A antibody (sc-271682), Anti-Cyclin B antibody (ab72), Anti-p53 antibody (ab26), Anti-p21 antibody (ab109520), Cyclin D1 Antibody (#2922), and Anti-Cyclin E1 antibody (ab33911). The secondary antibodies are all purchased from Sigma-Aldrich (St. Louis, MO, USA).
2.8. Immunofluorescence imaging
Immunofluorescence imaging was used to measure the expression of p53. The method was described previously [45]. Cell cultures were fixed in 3.7% formaldehyde and permeabilized with 0.25% Triton X-100. Nuclei were stained with 40, 6diamidino-2-phenylindole (DAPI). Cells were immunolabeled using an anti-p53 antibody (ab32389) and a Goat Anti-Rabbit IgG H&L (HRP) (ab6721) secondary antibody. Fluorescence imaging was performed using an inverted fluorescence microscope (Leica, Germany) and Imaris 4.0 software.
2.9. Statistics
T-test or one-way ANOVA and Dunnett’s post hoc tests were used to compare the significant difference between the control and experimental group (p < 0.01). GraphPad Prism (version 6) was used to plot the figures and calculate statistical significance.