PTEN expression was down-regulated in population occupational mercury exposure and promote cell apoptosis via PI3K/AKT pathway

doi:10.21203/rs.3.rs-2236142/v1

Download PDF

Research Article

PTEN expression was down-regulated in population occupational mercury exposure and promote cell apoptosis via PI3K/AKT pathway

https://doi.org/10.21203/rs.3.rs-2236142/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Mercury has different levels of toxicity to various organ systems of the human body. Therefore, it is very important to research the molecular differences and functional mechanisms of mercury exposure for the early prevention and treatment of occupational mercury poisoning.

Method:The subjects of the population study were on-the-job workers in a thermometer manufacturing plant in Jiangsu Province in 2016. According to the basic information collected, 40 people in the high concentration mercury exposure group and 40 people in the low concentration mercury exposure group (control group) were matched, and the blood of each person was collected. Through bioinformatics analysis of gene expression microarray results, the genes related to mercury exposure were initially screened out. The qRT-PCR was used to verify the initial screening of differential expression genes (DEGs) to identify the differential genes of mercury exposure. Mercury exposure differential genes were verified in 293T model cells, and the molecular functions and mechanisms of mercury exposure differential genes were analyzed by qRT-PCR, Western blot, siRNA transfection and ELISA.

Results: Compared with the control group, the expression level of PTEN in the high-concentration mercury exposure group was 21.86% of that in the control group. The result of correlation analysis showed that the relative expression levels of PTEN and RNF2 genes were negatively correlated with the urine mercury value. The expression of PTEN was down-regulated, and the expression of PI3K, AKT and IL-6protein was increased in the mercury-infected 293T cell model.

Conclusions:The results showed that mercury exposure could down-regulate the PTEN gene, activate the PI3K/AKT regulatory pathway, increase the expression of inflammatory factors, and thus cause renal inflammation.

PTEN

Occupational mercury exposure

PI3K/AKT pathway

293T cell

Mercury is a flowing liquid metal at normal temperature and pressure conditions. As for the physical properties of low viscosity, high density, easy to conduct electricity and easy to mix with other metals, mercury is widely used in chemical industry, metallurgy industry, electrical equipment manufacturing industry, pharmaceutical industry, transportation industry and military field^[1]. Mercury can enter the body through respiratory system, skin and digestive system. In the process of production and use of mercury, workers are prone to inhale air containing mercury vapor. And due to the fat solubility of mercury, more than 70% of the mercury vapor inhaled can be absorbed^[2]. The toxicity of mercury to human body includes cytotoxicity, neurotoxicity, teratogenicity, hepatotoxicity, nephrotoxicity and immunotoxicity. Studies have shown that mercury exposure can cause symptoms such as paresthesia, visual field narrowing, ataxia and dysarthria. High level of inorganic mercury exposure can lead to cell apoptosis, abortion or fetal death, as well as cerebral palsy, vision or hearing loss and other serious consequences^[3].

The key mechanisms of mercury toxicity are as follows, change of gene expression and signal transduction, oxidative stress, immune inflammation and disruption of calcium homeostasis. Mercury ions are easy to bind to various nucleophilic functional groups, especially thiol groups, such as glutathione (GSH) and albumin^[4]. There is also a complex and tight binding between mercury ions and protein thiols^[5]. In addition, mercury exposure can promote the production of ROS in cells: the hypothalamic nervous cell line and the ROS production of brain neurons poisoned by methylmercury are increased^[6]. In animal experiments, the production of ROS in immune cells (T and B lymphoma cells, macrophages)^[7] or in microglia cells of mice and rats exposed to mercury was increased^[8], and showed concentration and time dependence; Mercury can destroy calcium homeostasis: it has been shown that mercury compounds can inhibit several types of voltage gated calcium channels, and can lead to the increase of Ca²⁺ internal flow, the increase of Ca²⁺ in cells may lead to cell death^[9].

In this experiment, we analyzed the results of gene expression chip by bioinformatics, and preliminarily screened out the genes related to mercury exposure. The differential expression genes were confirmed by qRT-PCR (quantitative reverse transcription polymerase reaction) technology. The gene of mercury exposure was validated in 293T model cells, and the molecular functions and mechanisms of the gene were analyzed by qRT-PCR, Western blot and siRNA transfection, which provided the basis for the early prevention and treatment of occupational mercury poisoning.

2.1. Subjects and screening criteria

The research subjects were 291 workers in a manufacturing plant in Jiangsu Province in 2016. All subjects participating in this study participated voluntarily and signed the informed consent. This study was approved by the Ethics Committee of Jiangsu CDC (Center for Disease Control and Prevention).

According to WS/T 265–2006 "Biological Exposure Limits of Occupational Mercury Exposure"^[10], the subjects were divided into two groups, high concentration mercury exposure group and control group. The gene expression chip preliminary screening test included 10 participants in each group, and the expanded validation test included 30 participants in each group. Inclusion criteria of high concentration mercury exposure group were as follow, (1) Han nationality; (2) Engaged in long-term mercury work, urine mercury increased (urine mercury ≥ 200µg/g creatinine); (3) The working age of mercury exposure ≥ 3 years; (4) No history of primary nervous system disease or kidney disease; (5) No long-term use of neurotoxic and nephrotoxic drugs. Inclusion criteria of control group were as follows, (1) Han nationality; (2) Urinary mercury > 35µg/g creatinine and urine mercury < 200µg/g creatinine; (3) Working experience ≥ 3 years; (4) No history of primary nervous system or kidney disease; (5) No long-term use of neurotoxic and nephrotoxic drugs.

Matching principles are, (1) Gender; (2) Age difference ≤ 5 years; (3) The working age of mercury exposure ≤ 5 years; (4) Tobacco consumption and alcohol intake.

2.2. Questionnaire survey

A one-to-one questionnaire was conducted for workers who participated in the occupational health examination. The investigators were trained in a uniform standard before the survey. Subjects were informed of the purpose of the study before the investigation, and the personal information of the subjects and the collected biological samples were only used for the study.

2.3. Biological sample collection and laboratory examination

Biological samples were collected early in the morning after consent was obtained from the subjects. Subjects were asked to fasting for 8 hours, and 4mL of workers' blood was collected with a labeled collection vessel containing separation gel. After the serum was separated, it was centrifuged (3300r, 3min). About 1.5mL of the upper serum was sucked into a 2 mL EP tube, numbered in turn and stored in a refrigerator at -80℃.

Instruct workers to wash their hands and take the mid-morning urine into a 50 mL sterile centrifuge tube. To WS/T 25-1996 "cold atomic absorption spectrometric determination of mercury in urine (II) acid stannous chloride reduction method"^[11]as the standard determination of mercury in urine; WS/T 97-1996 "Spectrophotometric determination of creatinine in urine"^[12]was used as the standard to determine the content of urine creatinine.

2.4. Determination of mercury vapor concentration in workplace air

According to "Sampling Specification for Monitoring Hazardous Substances in the Air of Workplace" (GBZ 159–2004)^[13], 7 points were determined in this field sampling, and 3 samples were collected from each point. A total of 21 samples were collected, and sample blanks were set. The mercury concentration in the air was determined according to the atomic fluorescence spectrometry stipulated in "Determination of Toxic substances in the air of the Workplace Part 18: Mercury and its Compounds" (GBZ/T 160.14–2004)^[14].

2.5. Microarray screening and bioinformatics analysis of gene expression profiles

This study was completed by Bohao biological company (Shanghai), and the gene expression chip was used for preliminary screening. In this research, 10 serum total RNA samples from workers exposed to high concentration of mercury and 10 serum total RNA samples from control workers (1:1 matching) were respectively mixed into RNA pools and transported to Bohao company for detection at low temperature. The screening criteria of gene expression microarray results were as follows, FPKM value of gene expression in high concentration mercury exposure group/FPKM value of gene expression in control group (FC) ≥ 2 or FPKM value of gene expression in high concentration mercury exposure group/FPKM value of gene expression in control group (FC) ≤ 0.5.

2.6. qRT-PCR analysis

According to the manufacturer's instructions, miReasy serum/plasma Kit (no.217184, Qiagen, Germany) was used to extract RNA from serum. The qRT-PCR experiment was carried out with the kit (dye method) customized by Shanghai Gemma company, and GAPDH was used as the internal reference. Subsequently, qPCR analysis was performed in a Real-time fluorescence quantitative PCR instrument (quantstudio 7 flex) (ABI, USA) using SYBR Green PCR Master Mix (Shanghai, China). The following conditions are, 95 ℃, 3 min (1 cycle), the reaction temperature was 62 ℃ for 40 s (40 cycles), and the reaction system was 5µL. Collect the last step fluorescence signal. Gene specific primers were designed by Gemma gene company. The primer sequence is shown in Table 1.

Table 1

Primer list of candidate differentially expressed mRNAs
Gene	sequence(5’→3’)	product size(bp)
PTEN	F: GCACTGTTGTTTCACAAGATGATG R: GCAGACCACAAACTGAGGATTG	81
SOX8	F: GAACGCATTCATGGTGTGGG R: TAGTCGGGGTGGTCCTTCTT	189
SOX6	F: AGGGAGTCTTGCCGATGTG R: CAGGCTCTCAGGTGTACCTTTA	181
KDM1A	F: GTGCAGTACCTCAGCCCAAAG R: TCTCCCGCAAAGAAGAGTCGT	190
RNF2	F: TGCATCATCACAGCCCTTAGAAG R: TTGTGCTTGTTGATCCTGGCT	182

2.7. Cell culture, exposure and transfection

2.7.1. Cell culture

Human embryonic kidney cells HEK-293t (293T cells) were purchased from PROSAI Life Technology Co., LTD. (Wuhan) and cultured according to the manufacturer's instructions. DMEM complete medium was prepared with DMED high glucose medium (GIBCO, USA), fetal bovine serum (GIBCO, USA), penicillin and streptomycin (Hyclone, USA) at the ratio of 100:10:1. The size of the cell culture dish is 100mm (Corning, USA). The temperature in the incubator is 37°C and the carbon dioxide content is 5%.

2.7.2. CCK-8 (Cell Counting Kit-8) experiment

Cells were passaged to 96-well plates (Corning, USA), and 100µL of complete culture medium and about 4000 cells were added to each well. Blank control Wells with 100µL of cell culture medium but no cells were set up and placed in a constant temperature incubator containing 5%CO2 at 37 ° C. After cell adherent growth, the culture medium was absorbed and discarded, and 90µL of complete culture medium and 10µL of mercury-stained venom (1000µM, 500µM, 400µM, 300µM, 200µM, 100µM, 50µM, 0µM) were added to each well, and three double Wells were used for each concentration, so that the final concentration of exposure was: 100µM, 50µM, 40µM, 30µM, 20µM, 10µM, 5µM, and 0µM were incubated in an incubator containing 5% carbon dioxide at 37 ° C. After 24h, 10µL CCK-8 solution was added to each well and placed in an incubator containing 5%CO2 at 37 ° C. After 0.5, 1, 2 and 4 hours of incubation, the absorbance was measured by microplate reader to determine the concentration of exposure.

2.7.3. Cell exposure

The cells were inoculated into 6-well plates (Corning, USA) for 24 hours. Add 1800µL DMEM complete medium and 200µL in different concentrations (250µM, 100µM, 0µM). The final concentration was 25µM, 10µM, 0µM. RNA and protein were extracted after 24 hours and 48 hours respectively. The concentration was determined by literature and CCK-8 experiment.

2.7.4. Cell transfection

The day before the experiment, 293T cells were prepared for transfection in 6-well plates, and the cell density was 70–80% for transfection. Before transfection, the siRNA dried product (1.00 OD260/ tube) was centrifuged and 125µL DEPC water was added, and each well of the 6-well plate was changed into 1600µL OPTI-MEM serum-free medium. The EP tubes were numbered, and 200µL of OPTI-MEM and 10µL of siRNA were added to one tube, then mixed and stood for 5min. In the other tube, 200µL OPTI-MEM and 5µL lip2000 were added, and the mixture was mixed and allowed to stand for 5min. The medium mixed with lip2000 was dropped into the previous medium, and the transfection complex was formed after 20min. 400µ transfection complex was added to the well and mixed evenly. After 5h, it was replaced with DMEM complete medium, and after 6h, the transfection was examined by fluorescence inverted microscope. RNA was extracted after 24h and protein was extracted after 48h.

2.8. Western blot analysis

The protein was extracted from 293T cells. 10% SDS-PAGE (Biyuntian, China) was used for separate the protein samples and transfer them to PVDF membrane. Then PVDF membrane (millipore, USA) was put into the blocking solution (Solarbio, USA) at room temperature for 1 h. The primary antibody was prepared with blocking solution and incubated PVDF membrane overnight at 4 ℃. The secondary antibody was diluted, then incubated PVDF membrane for 1 hour. A and B fluid of Clarity Max Western ECL Substrate (British Bio-Rad) were mixed onto the membrane and placed in the Bio-rad gel system for imaging.

2.9. Enzyme linked immunosorbent assay (ELISA)

The cell culture medium was collected in sterile EP tubes, centrifuged at 2500r/min for 20min, and the supernatant was collected in a new sterile EP tube. Standard solutions of 480ng/L, 240 ng/L, 120 ng/L, 60 ng/L, 30 ng/L and 0ng/L were prepared by diluting 150µl of standard dilution of standard dry powder. Suck 1ml of biotin antigen diluent into concentrated biotin antigen, swirl and mix until completely dissolved, then inhale all the liquid into the diluent bottle and vortex and mix to prepare the biotin antigen working solution. The concentrated solution of avidin-HRP was centrifuged at low speed, and all the concentrated solution was inhaled into the diluent of avidin-HRP and mixed with vortex to prepare the working solution of avidin-HRP. 20mL concentrated washing solution with double distilled water constant volume to 500ml, to obtain the required washing solution. In each standard well, 50µL standard solution was added, and then 50µL biotin antigen working solution was added. 50µL of cell culture medium (in triplicate) was added to the sample Wells, followed by 50µL of biotin antigen working solution, gently shaking, sealing the sealing plate membrane, and incubation at 37°C for 30min. Remove the sealing membrane, discard the liquid, pat dry, wash the plate with the automatic plate washer, repeat the plate washing 5 times, 30s each time, pat dry. 50µL of avidin-HRP working solution was added to each well, and the sealing plate membrane was sealed and incubated at 37 ° C for 30min. Remove the sealing membrane, discard the liquid, pat dry, wash the plate with the automatic plate washer, repeat the plate washing 5 times, 30s each time, pat dry. Add 50µL of solution A and 50µL of solution B to each well, set A blank control group (only add solution A and B), shake gently, and incubate at 37℃ in the dark for 10min. The reaction was terminated by adding 50µL of termination solution to each well, and the absorbance was detected with a microplate reader at a wavelength of 450nm. ELISAcalc was used to calculate the results.

2.10. Statistical analysis

EpiData 3.1 software was used to input demographic data, and two persons inputted and verified the data. SPSS 22.0 software was used to sort out and analyze the data. Genes meeting the screening criteria of gene expression microarray results were introduced into Metascape website (http://metascape.org/gp/index.html#/main/step1) to carry out Go and KEGG enrichment analysis. DEGs with the highest enrichment fraction were selected as candidate genes in this experiment. qRT-PCR results of candidate genes were analyzed by relative quantitative method. The relative expression of candidate genes was expressed as -△CT, -△CT = (CT (target gene) - CT (GAPDH)) ×(− 1). The expression of candidate genes was expressed as\({ 2}^{-△\text{C}\text{t}}\). SPSS 22.0 software was used to analyze the expression levels of candidate genes in high concentration mercury exposure group and control group, and the relative expression levels were plotted by Graphpad Prism 6.0 software; Spearman correlation analysis was performed between urinary mercury value (log10 conversion) and relative expression of candidate genes using Graphpad prism 6.0 software.

3.1 Demographic characteristics of the subjects in the initial screening stage

Table 2(a) showed that there was no significant difference in gender, age, length of service, drinking and smoking between the two groups at the initial screening stage (P > 0.05), but there was significant difference in urine mercury value between the two groups (P < 0.001), and the median value of urine mercury in the high concentration mercury exposure group (1024.7μg/g Cr) was 18.40 times than the median value of urinary mercury in the control group (55. 7μg/g Cr).

Table 2(a) Demographic characteristics of the subjects in the initial screening stage

Variable	High concentration mercury exposure group（n=10）	control group （n=10）	P
Gender（female %）	80	80	-
Age（years）	41.90±5.90	41.90±6.54	0.871
Working-age（years）	19.10±8.19	18.40±8.83	0.954
Drinking （yes/no）	0/10	0/10	-
Smoking （yes/no）	0/10	0/10	-
urine mercury （μg/g Cr）	1024.7 （477.03-2060.15）	55.7 （47.98-73.48）	<0.001

Note: The age and working years in the table are expressed as mean ± SE, and the urine mercury value is expressed ad the median (upper and lower quartile). The difference was statistically significant (P < 0.05).

3.2 The results and analysis of gene expression profile chip

The results of gene expression chip showed that there were 269 differential genes in the high concentration mercury exposure group compared with the control group, of which 203 genes were up regulated group and 66 genes were down regulated in the high concentration mercury exposure. Figure 1 shows the above results, among which the genes with up regulated differential expression are red and the genes with differential expression down regulated are blue.

According to the screening criteria (Gene expression FPKM value in Hg exposure group/control group (FC) ≥2 or in Hg exposure group/control group (FC)≤0.5), the selected DEGs were processed bioinformatics enrichment analysis in GO and KEGG. Figure 2a lists the 30 possible biological functions with the highest enrichment scores in the GO enrichment analysis. Figure 2b lists the 30 possible regulatory pathways with the highest enrichment scores in KEGG enrichment analysis. Figure 2c shows the relationship between the enriched items in the form of a network diagram.

Based on the above analysis results, PTEN and RNF2 genes of PTEN pathway and PIP3/AKT pathway were selected; SOX6 gene of WNT pathway and PTEN pathway; PTEN pathway and p53 mediated KDM1A gene of intrinsic apoptosis signaling pathway; SOX8 gene related to cell development and differentiation regulation is a candidate gene for further population expansion and validation.

3.3 Analysis of validation results of population expansion

The five candidate genes were expanded verified in the population. The demographic data of the expanded validation stage are shown in table 2(b). There were no significant differences in gender, age, length of service, smoking and drinking between the two groups. The urine mercury value of the high concentration mercury exposure group was 7.29 times of that of the control group, and the difference was statistically significant (P < 0.001).

Figure 3(a) shows the qRT-PCR results of candidate genes in the expanded validation experiment. Compared with the control group, the expression of PTEN in the high concentration mercury exposure group was down-regulated (P=0.004), and the difference was statistically significant. The expression of PTEN in high concentration mercury exposure group was 21.86% of that in control group, the difference was statistically significant (P < 0.05).

Correlation analysis showed that there was a negative correlation between the relative expression of PTEN (r=-0.36, P=0.005), RNF2 (r=-0.37, P=0.005) genes and urine mercury value (lg10 conversion), showed in figure 3(b).

Urine mercury (expressed after log10 conversion)

3.4 Mercury exposure induced apoptosis in 293T cells in vitro

The survival rate of 293T cells was observed at the concentration of 0μM、5μM、10μM、20μM、30μM、40μM、50μM、100μM HgCl₂ in figure 4(a). The following experiments were conducted with the concentration of about 80% of cell survival rate, and the concentration of this drug was determined to be 0μM、10μM、25μM.

When 293T cells were exposed to HgCl2 for 48h, cellular proteins were extracted, and the expression of target proteins PI3K and AKT was detected by Western Blot experiment. The ratio of gray level of each protein to that of GAPDH protein was plotted as column figure 4(b). The results of qRT-PCR showed that the expression of PTEN gene in 293T cells with mercury (25μM, 10μM) was decreased compared with the reagent control group (P < 0.05).

The results of Western Blot showed that the expression of PTEN protein in 293T cells with mercury (25μM, 0μM) decreased (P < 0.001), which was respectively 40.31% and 52.09% of the control group; The expression of PI3K protein was 1.73 and 1.49 times higher than that of the control group; The expression of AKT protein was 2.02 times and 1.99 times higher than that in the control group (P < 0.001).

PTEN was knocked down by the fluorescent modified siRNA transfection technology. Figure 4(c) showed the transfection situation after 6 hours of siRNA transfection. Under the inverted fluorescence microscope, most cells have fluorescent expression, indicating that the establishment of PTEN low expression cell model was successful. Western blot was performed with GAPDH protein as internal reference. The ratio of gray value of each protein to that of GAPDH protein was analyzed by t test. The results showed that the expression level of PTEN protein in the cell model was decreased (P < 0.001), and the expression levels of PI3K and AKT protein in in the cell model were increased, which were 1.36 and 1.55 times of those in the control group (P < 0.001) (Fig. 4(d)).

3.5 The expression of IL-6

ELISA was used to detect the secretion of IL-6 in the culture medium of the exposed cells and PTEN low expression cells. Figure 5(a) shows that the level of IL-6 in the culture medium of mercury exposed group of 25μM、10μM was 3.69 times and 2.87 times higher than that of the control group, and the difference was statistically significant. Figure 5(b) shows that the expression of IL-6 in the culture medium of PTEN low expression cells was 3.66 times higher than that in the control group (P < 0.001).

This study found that the expression of PTEN in the high concentration mercury exposure group was lower than that in the control group. The expression of PTEN in the high concentration mercury exposure group was 21.86% of that in the control group, and the difference was statistically significant (P = 0.004). Correlation analysis showed that the relative expression of PTEN (r = − 0.36, P = 0.005) and RNF2 (r = − 0.37, P = 0.005) was negatively correlated with the value of urinary mercury. The expression of PTEN gene may be related to mercury exposure. High concentration mercury exposure may down regulate PTEN gene expression.

PTEN was initially discovered as a tumor suppressor gene. PTEN can induce apoptosis, inhibiting cell cycle, inhibiting tumor cell invasion, and inhibiting tumor angiogenesis through exerting its lipid phosphatase and protein phosphatase activities. In addition to tumor inhibition, PTEN also plays a role in the biological characteristics of other diseases. PTEN is one of negative regulator of AKT signaling. Increasing expression of PTEN can reduce AKT phosphorylation^[15]. PI3K/AKT signaling pathway plays an important role in the regulation of cell apoptosis. Abnormal expression or activity of PTEN is also associated with obesity, insulin resistance, diabetes, hepatitis B virus/hepatitis C virus infection and alcoholism^[16–21].

Therefore, on the basis of this study, we constructed cell models of mercury exposure and PTEN low expression to explore the functional mechanism of PTEN. The results showed that the expression of PTEN gene and protein decreased, which was consistent with the results of population study. Compared with the control group, the protein expression of AKT, PI3K and IL-6 in 293T cells exposed to mercury were significantly higher (P < 0.001). The expression of AKT, PI3K and IL-6 increased after PTEN knockout in 293T cells by siRNA transfection. Mercury exposure can reduce the expression of PTEN. So we speculate that mercury may cause inflammatory injury through PTEN/PI3K/AKT pathway.

In recent years, people began to study the relationship between PTEN and inflammatory response, and found that PTEN plays an important role in maintaining autoimmunity, regulating immune cell function and growth^[22]. PTEN can regulate the function and development of eosinophils, neutrophils, macrophages, T lymphocytes, B lymphocytes and other immune cells^[22]. The absence of PTEN in NK cells can enhance the cytolytic function of NK cells^[23]. In the mouse model of PTEN knockout, the number of B cells in peritoneum and splenic marginal area increased^[24], which may lead to autoimmune diseases. Kwak found that PTEN was associated with airway inflammation and airway hyperresponsiveness induced by allergens in asthmatic mice. After induction by allergens, PTEN expression in airway epithelium decreased and PI3K activity increased significantly. Intratracheal injection of PI3K inhibitor or adenovirus carrying PTEN cDNA into asthmatic mice could effectively reduce the expression of IL-5, IL-4 and eosinophil cationic protein, and decrease bronchitis and airway hyperresponsiveness (AHR)^[25]. There was a study which found PTEN expression was inhibited in the mouse model, the inflammatory response and NF⁃α were enhanced, the expression of IL ⁃ 6, pro⁃IL⁃1 β increased, and renal fibrosis accelerated in the kidney of IR mice ^[26]. This is similar to the results of this study, suggesting that PTEN is related to the expression of inflammatory factors.

This experiment combines the gene expression microarray technology with the discovery of the differential genes related to mercury exposure, and explore the relationship between PTEN gene and mercury exposure, which has certain innovation. However, there are still some deficiencies. Due to the continuous promotion of China's Minamata Convention on mercury, the sample size collected by the research group is small. As a highly volatile toxic substance, mercury vapor is likely to leak through the respiratory tract and cause harm to human body. At present, there is no realizable mercury respiratory tract exposure equipment, so it is difficult to carry out animal experiments. The study population is occupational population exposed to mercury, so further research is needed if the results of this experiment are extrapolated to the general population.

The results of gene expression microarray and population expansion validation showed that the expression of PTEN in high concentration mercury exposure group was 21.86% of the control group. Correlation analysis showed that the relative expression of PTEN and RNF2 genes was negatively correlated with urinary mercury value.

The expression of PTEN was down regulated and the expression of PI3K, AKT and IL-6 was up-regulated in mercury exposed 293T cell model and PTEN low expression cell model; The expression of PTEN was down-regulated and the expression of PI3K, AKT and IL-6 was up-regulated in PTEN low expression cell model. The results suggest that mercury exposure can down regulate PTEN gene, activate PI3K/AKT regulatory pathway, increase the expression of inflammatory factors, and cause renal inflammatory response. This finding enriches the mechanism of renal injury induced by mercury exposure.

DEGs differential expression genes

ELISA enzyme linked immunosorbent assay

GSH glutathione

ROS Reactive oxygen species

Declarations

Competing interests

The authors have no relevant financial or non-financial interests to disclose.

Declarations

Ethics approval

The study was approved by the Ethical Committee of the Jiangsu Provincial Center for Disease Prevention and Control

Consent to participate

Informed consent was obtained from all individual participants included in the study.

Consent to publish

All presentations have consent for publication

Declarations

Note

The age and working years in the table are expressed as mean ± SE, and the urine mercury value is expressed ad the median(upper and lower quartile).The difference was statistically significant (P < 0.05).

Funding

This work was supported by Jiangsu Province's Outstanding Medical Academic Leader program (CXTDA2017029)

Authors' contribution

All authors contributed to the study conception and design.

Acknowledgements

Thanks to all authors for their contributions to this article.

T. W. Clarkson, J. B. Vyas and N. Ballatori（2007）Mechanisms of mercury disposition in the body.Am J Ind Med 50(10): 757-64. https://doi.org/10.1002/ajim.20476
J. F. Risher（2003）Elemental mercury and inorganic mercury compounds: human health aspects.Concise International Chemical Assessment Document 50(3): 678–681.
L. Yang, Y. Zhang, F. Wang, Z. Luo, S. Guo and U. Strähle（2020）Toxicity of mercury: Molecular evidence.Chemosphere 245(125586. https://doi.org/10.1016/j.chemosphere.2019.125586
C. S. Oliveira, A. L. A. Segatto, P. A. Nogara, B. C. Piccoli, L. S. Loreto É, M. Aschner and J. B. T. Rocha（2020）Transcriptomic and Proteomic Tools in the Study of Hg Toxicity: What Is Missing?Front Genet 11(425. https://doi.org/10.3389/fgene.2020.00425
R. K. Zalups（2000）Molecular interactions with mercury in the kidney.Pharmacol Rev 52(1): 113-43.
S. Robitaille, R. J. Mailloux and H. M. Chan（2016）Methylmercury alters glutathione homeostasis by inhibiting glutaredoxin 1 and enhancing glutathione biosynthesis in cultured human astrocytoma cells.Toxicol Lett 256(1-10. https://doi.org/10.1016/j.toxlet.2016.05.013
S. H. Kim and R. P. Sharma（2004）Mercury-induced apoptosis and necrosis in murine macrophages: role of calcium-induced reactive oxygen species and p38 mitogen-activated protein kinase signaling.Toxicol Appl Pharmacol 196(1): 47-57. https://doi.org/10.1016/j.taap.2003.11.020
D. J. Sutton and P. B. Tchounwou（2007）Mercury induces the externalization of phosphatidyl-serine in human renal proximal tubule (HK-2) cells.Int J Environ Res Public Health 4(2): 138-44. https://doi.org/10.3390/ijerph2007040008
M. Wolden, B. Hill and S. Voorhees（2019）Predicting Success for Student Physical Therapists on the National Physical Therapy Examination (NPTE): Systematic Review and Meta-Analysis.Phys Ther https://doi.org/10.1093/ptj/pzz145
M. o. H. o. t. P. s. R. o. China. WS/T 265-2006 Biological limits for occupational exposure to mercury,People's Medical Pubishing House, Beijing, 2007.
M. o. H. o. t. P. s. R. of. Cold atomic absorption spectroscopy determination method of mercury in urine (2) Acidic stannous chloride reduction method,WS/T 26 1996, National Occupational Health Standards of the Ministry of Health, Beijing, 1996.
M. o. H. o. t. P. s. R. of. Spectrophotometry of creatinine in the urine, WS/T 97–1996, National Occupational Health Standards of the Ministry of Health, Beijing, 1996.
M. o. H. o. t. P. s. R. of. Sampling specifications for monitoring of harmful substances in the workplace,GBZ 159-2004, National Occupational Health Standards of the Ministry of Health, Beijing, 2006.
M. o. H. o. t. P. s. R. of. Workplace air - Determination of toxic substances - Part 18: Mercury and its compounds,GBZ/T 160.14-2004, National Occupational Health Standards of the Ministry of Health, Beijing, 2004.
Q. L. Wang, Y. Y. Tao, H. D. Xie, C. H. Liu and P. Liu（2020）Fuzheng Huayu recipe, a traditional Chinese compound herbal medicine, attenuates renal interstitial fibrosis via targeting the miR-21/PTEN/AKT axis.J Integr Med 18(6): 505-513. https://doi.org/10.1016/j.joim.2020.08.006
L. S. Hao, X. L. Zhang, J. Y. An, J. Karlin, X. P. Tian, Z. N. Dun, S. R. Xie and S. Chen（2009）PTEN expression is down-regulated in liver tissues of rats with hepatic fibrosis induced by biliary stenosis.Apmis 117(9): 681-91. https://doi.org/10.1111/j.1600-0463.2009.02515.x
Y. Horie, A. Suzuki, E. Kataoka, T. Sasaki, K. Hamada, J. Sasaki, K. Mizuno, G. Hasegawa, H. Kishimoto, M. Iizuka, M. Naito, K. Enomoto, S. Watanabe, T. W. Mak and T. Nakano（2004）Hepatocyte-specific Pten deficiency results in steatohepatitis and hepatocellular carcinomas.J Clin Invest 113(12): 1774-83. https://doi.org/10.1172/jci20513
L. Mahimainathan, F. Das, B. Venkatesan and G. G. Choudhury（2006）Mesangial cell hypertrophy by high glucose is mediated by downregulation of the tumor suppressor PTEN.Diabetes 55(7): 2115-25. https://doi.org/10.2337/db05-1326
M. Peyrou, L. Bourgoin and M. Foti（2010）PTEN in liver diseases and cancer.World J Gastroenterol 16(37): 4627-33. https://doi.org/10.3748/wjg.v16.i37.4627
B. Stiles, Y. Wang, A. Stahl, S. Bassilian, W. P. Lee, Y. J. Kim, R. Sherwin, S. Devaskar, R. Lesche, M. A. Magnuson and H. Wu（2004）Liver-specific deletion of negative regulator Pten results in fatty liver and insulin hypersensitivity [corrected].Proc Natl Acad Sci U S A 101(7): 2082-7. https://doi.org/10.1073/pnas.0308617100
A. Suzuki, J. L. de la Pompa, V. Stambolic, A. J. Elia, T. Sasaki, I. del Barco Barrantes, A. Ho, A. Wakeham, A. Itie, W. Khoo, M. Fukumoto and T. W. Mak（1998）High cancer susceptibility and embryonic lethality associated with mutation of the PTEN tumor suppressor gene in mice.Curr Biol 8(21): 1169-78. https://doi.org/10.1016/s0960-9822(07)00488-5
H. L. Lu, Y. Ding, H. Goyal and H. G. Xu（2019）Association Between Rotavirus Vaccination and Risk of Intussusception Among Neonates and Infants: A Systematic Review and Meta-analysis.JAMA Netw Open 2(10): e1912458. https://doi.org/10.1001/jamanetworkopen.2019.12458
E. L. Briercheck, R. Trotta, L. Chen, A. S. Hartlage, J. P. Cole, T. D. Cole, C. Mao, P. P. Banerjee, H. T. Hsu, E. M. Mace, D. Ciarlariello, B. L. Mundy-Bosse, I. Garcia-Cao, S. D. Scoville, L. Yu, R. Pilarski, W. E. Carson, 3rd, G. Leone, P. P. Pandolfi, J. Yu, J. S. Orange and M. A. Caligiuri（2015）PTEN is a negative regulator of NK cell cytolytic function.J Immunol 194(4): 1832-40. https://doi.org/10.4049/jimmunol.1401224
M. Murakami, T. Tsubata, M. Okamoto, A. Shimizu, S. Kumagai, H. Imura and T. Honjo（1992）Antigen-induced apoptotic death of Ly-1 B cells responsible for autoimmune disease in transgenic mice.Nature 357(6373): 77-80. https://doi.org/10.1038/357077a0
Y. G. Kwak, C. H. Song, H. K. Yi, P. H. Hwang, J. S. Kim, K. S. Lee and Y. C. Lee（2003）Involvement of PTEN in airway hyperresponsiveness and inflammation in bronchial asthma.J Clin Invest 111(7): 1083-92. https://doi.org/10.1172/jci16440
J. Zhou, J. Zhong, S. Lin, Z. Huang, H. Chen, S. Tang, C. Yang and Y. Fan（2017）Inhibition of PTEN Activity Aggravates Post Renal Fibrosis in Mice with Ischemia Reperfusion-Induced Acute Kidney Injury.Cell Physiol Biochem 43(5): 1841-1854. https://doi.org/10.1159/000484070

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

PTEN expression was down-regulated in population occupational mercury exposure and promote cell apoptosis via PI3K/AKT pathway

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Subjects and screening criteria

2.2. Questionnaire survey

2.3. Biological sample collection and laboratory examination

2.4. Determination of mercury vapor concentration in workplace air

2.5. Microarray screening and bioinformatics analysis of gene expression profiles

2.6. qRT-PCR analysis

2.7. Cell culture, exposure and transfection

2.7.1. Cell culture

2.7.2. CCK-8 (Cell Counting Kit-8) experiment

2.7.3. Cell exposure

2.7.4. Cell transfection

2.8. Western blot analysis

2.9. Enzyme linked immunosorbent assay (ELISA)

2.10. Statistical analysis

3. Results

3.1 Demographic characteristics of the subjects in the initial screening stage

3.2 The results and analysis of gene expression profile chip

3.3 Analysis of validation results of population expansion

3.4 Mercury exposure induced apoptosis in 293T cells in vitro

3.5 The expression of IL-6

4. Discussion

5. Conclusions

Abbreviations

Declarations

Declarations

Declarations

Declarations

Funding

Authors' contribution

Acknowledgements

References

Additional Declarations

Status:

Version 1