Cells, mice, virus, and reagents
293T, HT1080, HEP2, Vero and U3A cells were reserved by the laboratory. 293T IRF3 KO cells were kindly provided by Prof. Fangfang Zhou from Soochow University. All cells were cultured in DMEM (HyClone) supplemented with 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin at 37°C under 5% CO2.
Six-to eight-week C57BL/6 mice were purchased from the Laboratory Animal Center of Soochow University. Mice were bred and housed in the animal facility of the Soochow University under specific pathogen-free (SPF) conditions. All protocols and procedures for mice study have been approved by the Committees of the Scientific Investigation Board of Soochow University.
VSV, VSV-GFP or HSV-1 was obtained and reserved by the laboratory. Sendai virus (SeV), H1N1 was a gift from Prof. Hui Zheng (Soochow University, Suzhou, China). RSV was a gift from Prof. Jinping Zhang (Soochow University, Suzhou, China).
Recombinant human IFN-α was purchased from PBL InterferonSource (Waltham, MA). IFN-α was used at the concentration of 1000 IU/ml unless stated otherwise. Cycloheximide (CHX), Chloroquine (CQ) and MG132 were purchased from Sigma-Aldrich (St. Louis, MO).
Generation of human OTUs knockout library and screening
To create gene-targeted alleles encoding OTUs family in 293T cells, three CRISPR guide RNA (gRNA) sequences were chosen for each OTU based on their specificity scores (http://crispr.mit.edu/) (Table 1). The DNA oligos encoding small gRNAs were cloned into the vector lentiCRISPRv2 (Addgene, Catalog#98290) and prepared for lentiviral packaging, individually. Briefly, 5×106 293T cells seeded in 10 cm dish were transfected with 10 µg OTUs sgRNA plasmid or the empty vector along with 5µg packaging vectors psPAX2 and 3µg pVSVG. The medium was changed 6 h post transfection. Forty-eight hours later, supernatants were harvested to infect 293T cells followed by various analysis.
Table 1
List of all sequences for sgRNA
Name | Sequence |
OTUB1 Target sequence1 | 5’-ggcctatgatgaagccatca-3’ |
OTUB1 Target sequence2 | 5’-ggagctctcggtcctataca-3’ |
OTUB1 Target sequence3 | 5’-gcaggaccgaattcagcaag-3’ |
OTUB2 Target sequence1 | 5’- ctgaaaacaggatttaccgg − 3’ |
OTUB2 Target sequence2 | 5’- gatttaccggaggaaaatcg − 3’ |
OTUB2 Target sequence3 | 5’- ttcgggaccatcctgaaaac − 3’ |
OTUD1 Target sequence1 | 5’- accggctccgccgcactact − 3’ |
OTUD1 Target sequence2 | 5’- ctcagtcggaagttccgatc − 3’ |
OTUD1 Target sequence3 | 5’- ctcgtctctgggatccgacc − 3’ |
OTUD3 Target sequence1 | 5’- taaggccatgtcccgaaagc − 3’ |
OTUD3 Target sequence2 | 5’- ggccatgtcccgaaagcagg − 3’ |
OTUD3 Target sequence3 | 5’- gcaggcggcgaagagccggc − 3’ |
OTUD4 Target sequence1 | 5’- agagacaccccgttaatttg − 3’ |
OTUD4 Target sequence2 | 5’- cgcaaagcagcgtcccactc − 3’ |
OTUD4 Target sequence3 | 5’- tcccactccggcgttacaat − 3’ |
OTUD5 Target sequence1 | 5’- agtggactagccggtccccg − 3’ |
OTUD5 Target sequence2 | 5’- aagcagtcagttctcggcag − 3’ |
OTUD5 Target sequence3 | 5’- agttctcggcaggggccgac − 3’ |
OTUD6A Target sequence1 | 5’-acatcgtgcgcaccacggca − 3’ |
OTUD6A Target sequence2 | 5’- actcgcccaccttgatcatc − 3’ |
OTUD6A Target sequence3 | 5’- atgaaagcgatcccggccga − 3’ |
OTUD6B Target sequence1 | 5’- aggtgcctactagccggtgc − 3’ |
OTUD6B Target sequence2 | 5’- atccggtgccgccttgaagg − 3’ |
OTUD6B Target sequence3 | 5’- attgaccgaagagcttgatg − 3’ |
OTUD7A Target sequence1 | 5’-aggcaggacgacattgccca − 3’ |
OTUD7A Target sequence2 | 5’- cagtcagaaagcctctccag − 3’ |
OTUD7A Target sequence3 | 5’- catgtgttcaatgaagggcg − 3’ |
OTUD7B Target sequence1 | 5’- ccgcagctgttgctccgca − 3’ |
OTUD7B Target sequence2 | 5’- attcctcggcagtgaccccg − 3’ |
OTUD7B Target sequence3 | 5’- ctgttgctccgcacgggatc − 3’ |
VCPIP1 Target sequence1 | 5’- gagcttattcgaatagctcc − 3’ |
VCPIP1 Target sequence2 | 5’- ggagtagtaacaatgagaga − 3’ |
VCPIP1 Target sequence3 | 5’- tagtaacaatgagagacggc − 3’ |
YOD1 Target sequence1 | 5’- agtgtgtactatgtcgtcga − 3’ |
YOD1 Target sequence2 | 5’- ctgcaacggatgatacagcc − 3’ |
YOD1 Target sequence3 | 5’- gcagtcgtcttgaagaacca − 3’ |
CRISPR-Cas9 genomic editing for gene deletion was used as previously reported(29). The library contains 13 lentiviruses for human OTUs family knockout. 293T cells were infected with either control sgRNA or sgRNA lentivirus against single human OUT for 48 h. The cells were then infected with VSV-GFP (MOI = 1.0) for 12 h and analyzed by flowcytometry for viral infection.
Plasmids and transfection
Plasmids for RIG-FL, RIG-IN, IRF3/5D, MAVS, TRAF3, TBK1, IRF3 WT were saved by the laboratory. Luciferase reporter plasmids (IFN-β–Luc and ISRE-Luc) and other plasmids including HA-Ub, HA-Ub-K6, HA-Ub-K11, HA-Ub-K27, HA-Ub-K29, HA-Ub-K33, HA-Ub-K48, HA-Ub-K63, and Flag-IRF3 were gifts from Professor Hui Zheng (Soochow University, Suzhou, China).
The human OTUD6B cDNA was PCR amplified from 293T cells with the following primer pair sequence as shown in Table 2. The amplified fragment was cloned into pCMV-HA vector using EcoRI and XhoI restriction enzyme sites and named HA-OTUD6B. And we also cloned the human OTUD6B amplified fragment into pCMV-Myc vector using EcoRI and XhoI restriction enzyme sites and named myc-OTUD6B. We also used the Site-Directed Mutagenesis Kit (Takara Bio, Tokyo, Japan) to generate C57S mutated OTUD6B (HA-OTUD6B CS) with the following primers OTUD6B CS-F and OTUD6B CS-R, IRF3-WT is also mutated to IRF3-K313R, IRF3-K315R, IRF3-K360R, IRF3-K366R or IRF3-K409R with the following primers in Table 2. The mutated sites were underlined in the primer sequence. The mouse OTUD6B cDNA was PCR amplified from NIH3T3 cell with the following primer mOTUD6B-F and mOTUD6B-R. The amplified fragment was cloned into pCMV-HA vector using EcoRI and Not I restriction enzyme sites and named HA-mOTUD6B. Using IRF3-WT as a template, we constructed IRF3 ∆C and IRF3 ∆N using the primers in Table 2. The OTUD6B-knockdown shRNA was constructed by inserting the OTUD6B shRNA fragment into empty plasmid PLL3.7. The three OTUD6B shRNA target sequences were obtained from the Sigma Mission Library and were shown in Table 2. All plasmids were confirmed by DNA sequencing. The OTUD6B siRNA (siOTUD6B) and control scramble siRNA were purchased from RiboBio (siG000051633 and siN0000001).
Table 2
Primer list for plasmid constructions List of all primers for overexpression Plasmids Construction
Primer | Sequence |
HA-hOTUD6B -F(pCMV-HA) | 5’-gcccgaattcggatgatatctaaggaaaagaaagctgcattg-3’ |
HA-hOTUD6B -R(pCMV-HA) | 5’-ccgctcgagcttagctgcaattttcagtaactatgtttacc-3’ |
myc-hOTUD6B -F(pCMV-myc) | 5’-gcccgaattcggatgatatctaaggaaaagaaagctgcattg-3’ |
myc-hOTUD6B -R(pCMV-myc) | 5’-ccgctcgagcagctgcaattttcagtaactatgtttacc-3’ |
mOTUD6B-F(pCMV-HA) | 5’-gcccgaattcgg atggaggaggtcgtggctgaagagc-3’ |
mOTUD6B-R(pCMV-HA) | 5’- gcggcggccgcctagctgcaattttcagtagctgagttcaccaacc-3’ |
List of all primers for Point mutations Plasmids Construction |
All transfections were carried out using Longtrans (UcallM Biotechnology, Wuxi, China) for DNA plasmids or Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) for small interfering RNA (siRNA) according to the manufacturer’s instructions.
Viral infection
To assess the antiviral ability of OTUD6B, control siRNA or siOTUD6B were transfected into cells. After 48 h post transfection, cells were infected with VSV-GFP, RSV, SEV, H1N1, HSV-1 at MOI = 1.0 for 12 h. Cells were then collected, and viral levels were analyzed by flow cytometry, western blot and real-time PCR. To identify whether OTUD6B regulates IFN downstream related signaling, cells were transfected with HA-OTUD6B or pCMV-HA. Forty-eight hours post transfection, cells were treated with 30 IU/ml IFN-α for 15 h. The expression of ISGs level was analyzed by real-time PCR.
For in vivo mice infection, polyplexes were prepared at a nitrogen/DNA phosphate ratio = 7. The polymer and 50 µg of DNA were both diluted in 5% dextrose to a volume of 100 µL, respectively. DNA and polymer were then mixed, whirled for 30 s, and incubated for 30 min in a 200 µL volume after mixing. Each mouse was i.v. injected with 50 µg of polyetherimide (PEI)-packaged pCMV-HA plasmid or HA-OTUD6B overexpression plasmid. On day 1, day 2, day 3 post injection, the lung tissues were removed from sacrificed mice, and OTUD6B expression was detected by western blot. For other parallel groups, the mice were intranasally infected with 1×108 PFUs VSV-GFP on day 1 post injection. The mRNA levels of IFN-β or ISGs in mice lung tissues were analyzed by real-time PCR 3 days post infection. Meanwhile, VSV G protein level in infected mice lung tissues was detected by western blot. For survival rate analysis, the survival of each group containing eight infected mice was monitored until day 10 post infection.
Western blot
Cells were harvested using lysis buffer containing 150 mM NaCl, 20 mM Tris–HCl (pH 7.4), 1% NP-40, 0.5 mM EDTA, PMSF (50 mg/ml), and protease inhibitors (NCM, Suzhou, China). Equivalent protein aliquots were subjected to SDS-PAGE and transferred to PVDF membranes. Membranes were then blocked with 5% fat-free milk or 5% BSA for 2 h at room temperature and then probed with the primary antibody, followed by the corresponding HRP-conjugated goat anti-mouse or goat antirabbit secondary antibodies (SouthernBiotech, Birmingham, AL). The following Abs were used: antibodies against OTUD6B (1:2000; HPA024046; Sigma-Aldrich), IRF3 antibody generated from rabbit (1:1000; 11904S; CST, Danvers, MA), IRF3 antibody generated from mouse (1:1000; ab50772; Abcam), VSV-G (1:5000; sc-66180; Santa Cruz Biotechnology), HA (1:2000; 3724S; CST), ubiquitin (1:1000; sc-8017; Santa Cruz Biotechnology), Flag (1:2500; F7425; F1804; Sigma-Aldrich), Myc (1:2000; 2272S; CST), GAPDH (1:20,000; G9545; Sigma-Aldrich), The band intensities were quantified by ImageJ software (Media Cybernetics, Silver Spring, MD).
Immunoprecipitation analysis of OTUD6B and IRF3 interaction
293T cells were transfected with HA-OTUD6B plasmid for 36 h. The cells were then washed with pre-cooled 1x PBS and lysed in western and IP lysis buffer (Beyotime) containing 100 µM PMSF (Beyotime). Cell lysates were collected and incubated on a shaker with 25 µL Anti-HA Magnetic beads (Bimake) at 4°C overnight. The beads were eluted with 1x loading buffer after washing five times with lysis buffer, and boiled for 15 min. The proteins were analyzed by western blot analysis with anti-HA and anti-IRF3 antibody.
For detecting endogenous OTUD6B and IRF3 interaction, 293T cells were washed with pre-cooled 1x PBS and lysed in IP lysis buffer containing 100 µM PMSF. Cell lysates were incubated with anti-IRF3 antibody at 4˚C overnight, then immunoprecipitated with protein A agarose at room temperature for 3 h. The beads were eluted with 1x loading buffer after washing five times with lysis buffer, and boiled for 15 min. The proteins were analyzed by western blot analysis using anti-OTUD6B antibody.
Reporter gene assay
For detecting the effect of OTUD6B on IFN-β production, 1×105 293T cells were seeded in a 24-well plate each well and cells were individually transfected with siOTUD6B (50 nM), together with 100 ng of IFN-β promoter firefly luciferase reporter plasmid and 25 ng of TK-Renilla luciferase reporter plasmid. Forty-eight hours post transfection, the cells were infected with SeV for 12 h and then harvested. The luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega, Madison, WI; E1910).
Immunofluorescence assay
To determine the co-localization of OTUD6B and IRF3 in the context of virus infection, 293T cells were treated with VSV(MOI = 1.0) or PBS for 12 h. The cells were then washed thrice with 1x PBS, fixed with 4% paraformaldehyde, and permeabilized with 0.05% Triton X-100. The cells were then blocked with 3% bovine serum albumin (BSA, Sigma) and incubated with anti-IRF3 mouse antibody and anti-OTUD6B rabbit antibody at 4°C overnight. The next day, cells were washed with 1× PBS three times and incubated with DyLight 488-goat anti-mouse IgG (Jackson, 111-545-003) and DyLight 633-goat anti-rabbit IgG (Jackson, 111-605-144) for 30 min at room temperature, and the nuclei were stained with DAPI (Beyotime) for 15 min at room temperature. The pictures were acquired by confocal microscopy Nikon A1. Mandel's overlap used to assess the co-localization level were given by the Nikon A1 photo software.
CHX chase assay
The half-life of total IRF3 was determined by CHX chase assay. For analysis of total IRF3 level, 293T cells were transfected with HA-OTUD6B for 48 h. The cells were then treated with CHX (50 mg/mL) for the indicated time, and lysed for western blot. The gray intensity of protein band was measured by using ImageJ software version 1.6.0_20. The relative amount of IRF3 was calibrated by the GAPDH. The IRF3 degradation rate at A time point was calculated as (IRF3_0 h - IRF3_A h)/IRF3_0 h.
MG132 assay
A total of 1×106 293T cells seeded in a 60 mm dish were transfected with 1 µg HA-K33, together with 1.5 µg of Flag-IRF3 plasmid for 36 h. The cells were treated with MG132 (10 mM) or CQ (100 mM) for 6 and 12 h. Cell lysates were incubated with anti-Flag beads (Anti-Flag magnetic beads, Bimake) at 4˚C overnight, and the K33- or K11-linked ubiquitination of IRF3 was analyzed by western blot.
In vivo deubiquitination assay
293T cells were transfected with the indicated plasmids and treated with MG132 (5 mM) for 4 h before harvesting. Forty-eight h after transfection, cells were washed with PBS and lysed in RIPA buffer (20 mM Tris-base, pH7.4, 150 mM NaCl, 1% Triton, 0.5% Sodium-deoxycholate, and 1% SDS) supplemented with protease inhibitors and 10 mM N-Ethylmaleimide (NEM). The supernatant was incubated with anti-Flag beads overnight at 4°C. After extensive washing, bound proteins were eluted with 5×loading buffer and separated by SDS-PAGE, followed by western blot analysis.
RNA isolation and real-time PCR
Total RNA was extracted from cells using TRIzol (Takara) and cDNA synthesis was performed using random primers with 500 ng of total RNA. Real-time PCR was performed using a SYBR Green PCR Master Mix (Applied Biosystems, Waltham, MA) with specific primers (Table 3) and normalized with the human GAPDH gene. Gene expression was analyzed using the 2−△△CT method (30, 31).
Table 3
List of primers for real-time PCR analysis
Primer | Sequence |
OTUD6B Sh1-F(pLL3.7) | 5’-tgcaaagctactaacaggtgttttcaagagaaacacctgttagtagctttgcttttttc-3’ |
OTUD6B Sh1-R(pLL3.7) | 5’-tcgagaaaaaa gcaaagctactaacaggtgtt tctcttgaa aacacctgttagtagctttgca-3’ |
OTUD6B Sh2-F(pLL3.7) | 5’-tcgagaagaacggatagctgaattcaagagattcagctatccgttcttctcgttttttc-3’ |
OTUD6B Sh2-R(pLL3.7) | 5’-tcgagaaaaaacgagaagaacggatagctgaatctcttgaattcagctatccgttcttctcg a-3’ |
OTUD6B Sh3-F(pLL3.7) | 5’-tcgatgagactaatgcagtgaattcaagagattcactgcattagtctcatcgttttttc-3’ |
OTUD6B Sh3-R(pLL3.7) | 5’-tcgagaaaaaacgatgagactaatgcagtgaatctcttgaattcactgcattagtctcatcga-3’ |
Target gene | Gene ID | Sequence |
GAPDH-F | 2597 | 5’ - agggctgcttttaactctggt − 3’ |
GAPDH-R | | 5’- ccccacttgattttggaggga − 3’ |
hIFN-b-F | 3456 | 5’ - cattacctgaaggccaagga − 3’ |
hIFN-b-R | | 5’ - cagcatctgctggttgaaga − 3’ |
hIFIT1-F | 3434 | 5’ - cacaagccattttctttgct − 3’ |
hIFIT1-R | | 5’ - acttggctgcatatcgaaag − 3’ |
hISG54-F | 3433 | 5’ - cacctctggactggcaatagc − 3’ |
hISG54-R | | 5’ - gtcaggattcagccgaatgg − 3’ |
mIFN-b-F | 15977 | 5’-tccgagcagagatcttcaggaa-3’ |
mIFN-b-R | | 5’-tgcaaccaccactcattctgag-3’ |
mISG54-F | 15958 | 5’-agaaccaaaacgagagagtgaag-3’ |
mISG54-R | | 5’-tccagacggtagttcgcaatg-3’ |
mIFIT1-F | 15957 | 5’-atcgcgtagacaaagctcttc-3’ |
mIFIT1-R | | 5’-gtttcgggatgtcctcagttg-3’ |
mGAPDH-F | 14433 | 5’-tggccttccgtgttcctac-3’ |
mGAPDH-R | | 5’-gagttgctgttgaagtcgca-3’ |
OTUB1-F | 55611 | 5’ - ctgacggcaactgtttctatcg − 3’ |
OTUB1-R | | 5’- caggtccatgaacgtgttgtg − 3’ |
OTUB2-F | 78990 | 5’ -ttgaggagcacaagttcagaaac − 3’ |
OTUB2-R | | 5’- gcagaagtctttgatgtccatct − 3’ |
OTUD1-F | 220213 | 5’ - ggggagtttatcatcgctgct − 3’ |
OTUD1-R | | 5’- tgagccaactgagccaaatac − 3’ |
YOD1-F | 55432 | 5’ - atgtttggccccgctaaagg − 3’ |
YOD1-R | | 5’- cggtgatggcggcaatttg − 3’ |
OTUD3-F | 23252 | 5’ - taaagcagcgggaagattttga − 3’ |
OTUD3-R | | 5’- tgcgatgtgtaactccctcac − 3’ |
OTUD4-F | 54726 | 5’ - tagcaatccatgtgtccagaga − 3’ |
OTUD4-R | | 5’- aagggcactctaacttctttgac − 3’ |
OTUD5-F | 55593 | 5’ - ggttgtgcgaaagcattgcat − 3’ |
OTUD5-R | | 5’- acctccacaggacggttgt − 3’ |
OTUD6A-F | 139562 | 5’ - gaagttccaagacgacagtagc − 3’ |
OTUD6A-R | | 5’- caggtgctccgacatctca − 3’ |
OTUD6B-F | 51633 | 5’ - gaagtcagaccgctgagtatatg − 3’ |
OTUD6B-R | | 5’- gggaggagaatctgcctgtatta − 3’ |
OTUD7A-F | 161725 | 5’ - cacgagctgtaaacggcttct − 3’ |
OTUD7A-R | | 5’- gctttccgtaacaccaggtcc − 3’ |
OTUD7B-F | 56957 | 5’ - gacagagagcctactcgcc − 3’ |
OTUD7B-R | | 5’- cacagatgggcatttccagg − 3’ |
VCPIP1-F | 80124 | 5’ - agtgtcaggcgcgtctatttt-3’ |
VCPIP1-R | | 5’ -gagctaatatgggcgacaacaat-3’ |
VSV-F | | 5’ - ctcggttcaagatccaggt − 3’ |
VSV-R | | 5’- acggcgtacttccagatgg − 3’ |
HSV-1-F | | 5’ - cgcatcaagaccacctcctc − 3’ |
HSV-1-R | | 5’- agcttgcgggcctcgtt − 3’ |
H1N1-F | | 5’ - ttctaaccgaggtcgaaacg − 3’ |
H1N1-R | | 5’- acaaagcgtctacgctgcag − 3’; |
RSV-F | | 5’ - aagggatttttgcaggattgttt − 3’ |
RSV-R | | 5’- ctccccaccgtagcattacttg − 3’ |
SeV-F | | 5’ - gatgacgatgccgcagcagtag − 3’ |
SeV-R | | 5’- cctccgatgtcagttggttcactc − 3’ |
ELISA assay
ELISA assays were performed in 96-well ELISA plates using human IFN-β ELISA kits (RD system) according to the manufacturer’s instructions.
Flow cytometry analysis
293T cells infected with VSV-GFP (MOI = 1.0) were subjected to analysis by flow cytometry. For flow cytometry analysis, cells were collected with cold PBS and were acquired in a FACS Canto II (BD Biosciences, San Jose, CA) equipped with a 488-nm argon laser. FACS data were analyzed with FlowJo software (FlowJo, Ashland, OR).
Statistical analysis
Comparison between different groups was analyzed by two tailed Student t test. Data were shown as the mean ± SD. The p value < 0.05 was considered statistically significant. Kaplan–Meier survival curves were generated and analyzed for mice survival study performed in GraphPad Prism 9.0 (GraphPad Software, San Diego, USA).