Ethics Statement. All animal procedures reported herein were conducted under IACUC protocols approved by WRAIR/NMRC (#19-IDD-24) and BIOQUAL (#20-019P) in compliance with the Animal Welfare Act and in accordance with the principles set forth in the “Guide for the Care and Use of Laboratory Animals,” Institute of Laboratory Animals Resources, National Research Council, National Academy Press, 2011. The studies were carried out in compliance with the ARRIVE guidelines60.
Humanized DRAGA Mice. DRAGA mice express the HLA-A2.1 and HLA-DR0401 transgenes on a Rag1KO.IL2RγcKO.NOD (NRG) background, and they have been described previously28-31 De-identified umbilical cord bloods positive for HLA-A2.1.HLA-DR0401 were commercially procured through the New York Blood Center (Long Island City, NY, USA, https://nybloodcenter.org/products-and-services/blood-products/research-products/). Mice were irradiated (350 rads) and injected intravenously with CD3+ T-cell-depleted cord blood cells (EasySep Human CD3 Positive Selection Kit, Stem Cell Technologies, Vancouver, BC, Canada) containing approximately 105 human CD34+ hematopoietic stem cells (HSC) determined by FACS using a mouse anti-human CD34 antibody (BD Biosciences, San Jose, CA, USA) as described49,52,54. The procedures for assessing human T and B cell reconstitution in peripheral blood by FACS have been described49,52,54. As documented in our previous studies, >90% of HIS-reconstituted DRAGA mice generated using these procedures reconstitute a human immune system by 3 to 4 months post-CD34+ HSC infusion. The human reconstitution status of DRAGA mice at the time of our SARS-CoV-2 infection experiments was determined based on FACS measurement of T cells and B cells in peripheral blood (Table S1). The DRAGA mice were transferred to BIOQUAL Inc for SARS-CoV-2 challenge experiments in their BSL-3 facility.
RT-PCR detection of hACE2 mRNA in HIS-DRAGA mouse lungs. RNA was extracted using a Qiagen RNA extraction kit (Qiagen, Hilden, Germany) from lungs of HIS-DRAGA and control (non-HSC-infused DRAGA) mice. Human lung mRNA (Sigma-Aldrich, St. Louis, MO, USA) served as a positive control. PCR primers specific for hACE2 were: forward, CAGGAAATGTTCAGAAAGCA and reverse, TCTTAGCAGAAAAGGTTGTG. The murine ACE2 specific primers were: forward: AGCAGATGGCCGGAAAGTTG, and reverse: TCTTAGCAGGAAAGGTTGCC. RT-PCR was performed using a One-step RT-PCR kit (Qiagen) for 45 cycles using 1 µg RNA template and 1.6 µM of each primer, following the manufacturer’s instructions. The PCR amplicons were run on a 3% agarose gel. PCR bands were purified from the agarose gels and nucleotide sequenced (Eurofins, Coralville, Iowa, USA).
RT-qPCR measurement of viral RNA copies in SARS-CoV-2 infected HIS-DRAGA mouse lungs. RNA from lungs of mice #M2-M4 and #F11-F13 was extracted using RNA-STAT 60 extraction reagent (Tel-Test, Inc., Friendswood, TX, USA) + chloroform, precipitated and resuspended in RNAse-free water. Control RNA was isolated from SARS-CoV-2 viral stocks following the same procedure and quantified by OD260. These control stocks were serially diluted and OD260 values measured to generate a standard curve. RT-qPCR of the lung RNA was carried out using the following primers : 2019-nCoV_N1-F :5’-GAC CCC AAA ATC AGC GAA AT-3’; 2019-nCoV_N1-R: 5’-TCT GGT TAC TGC CAG TTG AAT CTG-3’; and probe 2019-nCoV_N1-P: 5’-FAM-ACC CCG CAT TAC GTT TGG TGG ACC-BHQ1-3’ (Integrated DNA Technologies, Coralville, IA, USA) which were designed to bind to and amplify a conserved region of SARS-CoV-2 Nucleocapsid (N) RNA. Amplification was performed with an Applied Biosystems 7500 Sequence detector using the following program: 48oC for 30 minutes, 95oC for 10 minutes followed by 40 cycles of 95oC for 15 seconds, and 1 minute at 55oC. Reactions were carried out using a TaqMan RT-PCR kit (Meridian Bioscience, Memphis, TN, USA) in 50 µL volume containing 5 µL of template, 2 µM of each primer and 2µM of each probe. The number of viral RNA copies per mL was calculated by extrapolation from the standard curve, and values were then converted to the number of viral RNA copies per gram of lung tissue.
Extraction and quantification of hACE2 protein in HIS-DRAGA and non-HIS-reconstituted DRAGA mouse lungs and in a human lung control. Lungs from 10 non-infected HIS-DRAGA and 10 non-infected, non-HIS reconstituted DRAGA mice were homogenized in the presence of MPER mammalian protein extraction reagent (Fisher Scientific, Waltham, MA, USA) containing complete protease inhibitor cocktail tablets (Roche Diagnostics GmbH, Mannheim, Germany) using tubes loaded with ceramic beads (MP Biologicals, Irvine, CA, USA) in a Fast-prep homogenizer (MP Biologicals). Pooled lung homogenates from each group of mice were sonicated on ice in a Fisher Ultrasonicator for 10 cycles of 10 seconds each, the cellular debris was removed by centrifugation at 5,000 rpm, and the protein in the clear supernatant was quantified using a BCA reagent (Thermo Fisher Scientific, Waltham, MA, USA). 9 mg of total lung protein extract from each group of mice and 2 mg of human lung total protein lysate (Zyagen, San Diego, CA, USA) were then individually incubated with gentle shaking (300 strokes per min) in an Eppendorf thermomixer for 1 h at 370C with 10 µg of the S1(RBD)-mFcγ2a protein (ACRO Biosystems, Newark, DE, USA) followed by incubation with gentle shaking for 1 h at 370C with 50 µl of rat anti-mouse IgG2a-magnetic microbeads (Miltenyi Biotech, Berdisch Gladback, Germany). The total lysate from each sample was next passed over MACS magnetic columns (Miltenyi Biotec), and the hACE2/S1(RBD)-mFcγ2a/rat anti-mouse IgG2a-magnetic beads were eluted according to the manufacturer’s instructions and concentrated to 52 µl each. The amounts of hACE2 protein in these immunoprecipitates were then quantified using the highly sensitive human ACE2 ELISA kit PicoKineTM (Boster Biological Technology, Pleasanton, CA) per the manufacturer’s protocol. The provided recombinant hACE2 protein was serially diluted in the provided sample buffer. The human lung sample was diluted 1:100 and the DRAGA and HIS-DRAGA samples were diluted 1:50 each in the provided sample buffer. OD450nm values were then read for duplicate samples (100 µl each) using a BioTEK microplate reader (BioTek Instruments, Inc., Winooski, VT, USA). A hACE2 standard curve was constructed by applying a four-parameter logistic fit formula using the BioTEK Gen 5 software (BioTek Instruments, Inc.). The sample OD450nm mean values were then converted to hACE2 concentrations using this curve, per the manufacturer’s instructions.
Western blot analysis of hACE2 protein in HIS-DRAGA lung lysates.
Western blots were next run using aliquots from the same concentrated immunoprecipitates used for the ELISA assays above: immunoprecipitates obtained from (1) 2 mg human lung extract; (2) 9 mg HIS-DRAGA mice lungs lysate; (3) 9 mg DRAGA mice lungs lysate. One µl of each immunoprecipitate added to wells of a 4-12% Bis-Tris gradient pre-cast gel from Invitrogen (Thermo Fisher Scientific, Waltham, MA, USA) and the samples were electrophoresed under denaturing conditions and then electro-transferred onto a PVDF membrane. The membrane was blocked overnight at 40C with shaking using 5% non-fat milk plus 3% BSA in PBS, incubated with a mouse monoclonal anti-human ACE2 (Abcam, Cambridge, MA, USA, 1:750) for 2h at room temperature, and washed with PBS + 0.01% Tween 20. The membrane was then incubated with goat anti-mouse IgG-HRP (Santa Cruz Biotechnology, Dallas, TX, USA, 1:3000) and SuperSignalTM West Pico PLUS chemiluminescent substrate according to the manufacturer’s instructions (Thermo Fisher Scientific). The chemiluminescent bands were then imaged using a Fluorchem E Imaging System (ProteinSimple, San Jose, CA, USA).
Infection of mice with SARS CoV-2 virus. HIS-DRAGA mice were infected intranasally (i.n.) with SARS CoV-2 strain USA-WA1/2020 (BEI Resources NR‐52281, batch #70033175), which was provided to Bioqual, Inc. by the Centers for Diseases Control and Prevention (CDC). This virus strain was originally isolated from an oropharyngeal swab of a patient with a respiratory illness who had returned to Washington State, USA, from travel to China and developed COVID-19 in January 2020. Infection of HIS-DRAGA mice, harvesting of serum and organs, and all experiments requiring BSL-3 conditions were conducted in a BSL-3 laboratory at Bioqual, Inc. (Rockville, MD, USA) in compliance with local, state, and federal regulations, under IACUC protocol #20-019P. The SARS-COV-2 stock was expanded at Bioqual in Vero E6 cells, and the challenging virus was collected at day 5 of culture when the infection reached 90% cytopathic effect. The full viral genome sequence showed 100% identity with the parent virus sequence listed in GenBank (MN985325.1). A plaque forming assay carried out with confluent layers of Vero E6 cells was used to determine the concentration of live virions, reported as plaque-forming units (pfu). HIS-DRAGA mice were infected i.n. with three different doses (2.8x103, or 2.8x104, or 1x103 pfu) of the same SARS-COV-2 virus strain (NR‐52281, batch #70033175) as summarized in Table S1.
Measurement of antibody serum titers to SARS-CoV-2 viral proteins. Titers of human IgM and IgG serum antibodies (1/20 serum dilution) to the recombinant S1(RBD) viral protein from mice infected i.n. with SARS-CoV-2 virions (103 pfu/mouse) were measured prior to infection and at 24 dpi using ELISA kits according to the manufacturer’s instructions (Bethyl Laboratories). In addition, titers of human IgM and IgG serum antibodies in aliquots of these same serum samples against a recombinant His-tagged S trimeric protein and against a recombinant His-tagged N protein (both from ACRO Biosystems) were determined using an in-house ELISA. Briefly, His-S trimeric protein or His-N protein, respectively, were coated on high-binding ELISA plates (Corning Costar, Fisher Scientific, Waltham, MA, USA) at 0.2 µg/well/100µL in carbonate buffer, pH 9.0. The plates were then incubated overnight at 4OC, then blocked with PBS + 1% BSA for 2h at room temperature, washed with PBS + 0.05% Tween 20, and incubated at room temperature for 1h with the serum samples diluted in PBS + 1% BSA + 0.05% Tween 20. Bound human IgM and IgG antibodies against the His-S trimer protein were then revealed by adding anti-human IgM or IgG antibody-HRP conjugates (Bethyl Laboratories) to the His-S-trimer-coated plates. Due to limited serum volumes, total IgG + IgM antibodies against the His-N protein were revealed by adding anti-human kappa plus lambda antibody-HRP conjugates (Bethyl Laboratories) to the His-N protein coated plates. The ELISA plates were then incubated with soluble HRP substrate for 15 minutes, and reactions were stopped by adding H2SO4 (0.18M, 100 µL/well). Plates were read in an ELISA reader at 450nm and 570 nm. OD450nm values were corrected by subtracting the OD570nm values (ranging from 0.045–0.067) of serum samples from the same mice prior to infection. Standard deviations (+/-SD) for each serum sample in duplicate wells were determined at 99% interval of confidence by SigmaPlot v.14 software. The positive control (anti-S1(RBD)) antibody from the kit was used as a positive control for both S1(RBD) and S1-trimer binding ELISA assays. The antibody titer against the N protein in serum from a non-infected mouse served as a negative control for the N-binding ELISA assays.
Histopathology of lungs from infected HIS-DRAGA mice. Lungs harvested from infected mice at the experimental end-points (14 dpi or 25 dpi) were fixed in 10% formalin, embedded in a paraffin block, and 5 µm sections were stained with Hematoxylin/Eosin (H&E) or Masson’s Trichrome by Histoserv, Inc. (Germantown, MD, USA). Microscopic images were captured using an Olympus BX43 microscope (Shinjuku-ku, Tokyo, Japan).
Immunofluorescence microscopy. Tissue sections (5µm) from paraffin-embedded cassettes or frozen OCT cassettes from infected and non-infected HIS-DRAGA mice, and from non-infected, non-HIS reconstituted DRAGA mice were prepared by Histoserv, Inc. Thawed OCT-frozen tissue slides were rehydrated with PBS, and paraffin-embedded sections were de-paraffinized with xylene and rehydrated with graded concentrations of ethanol. Slides were then fixed, permeabilized with fixation/permeabilization buffer (Invitrogen, Waltham, MA, USA), blocked with 3% BSA in PBS for 30 min at 370C, and stained with fluorochrome-conjugated antibodies in PBS containing 0.01% Evans Blue at 370C for 50 min. To visualize hACE2, slides were probed with the S1(RBD)-mFcγ2a protein (10 µg/ml), washed with PBS, and then incubated with a goat anti-mouse IgG-FITC conjugate (Southern Biotech, Birmingham, AL, USA). Other antibodies to detect antigens of interest were: anti-human CD3-FITC, anti-human CD4-PE, anti-human CD8-PE, anti-human CD45-FITC, anti-human granzyme-B-PE, anti-human CD103-FITC (all from BD Biosciences, San Jose, CA, USA), anti-human CD326-PE (Miltenyi Biotech), anti-human Perforin-PE (Biolegend, San Diego, CA, USA), anti-human CD103-FITC (BD PharMingen, Irvine, CA, USA), anti-mouse CD61-PE (Invitrogen), and anti-hACE2 antibody (clone# MM0073—11A3, Abcam), anti-human TMPRSS2 monoclonal IgG1 mouse antibody (#clone P5H9-A3, Sigma Aldrich), mouse IgG1/κ-Alexa Fluor 594 anti-human CD31 Antibody (clone WM59, Biolegend), goat F(ab')2 anti-mouse IgG1-PE conjugate (Southern Biotech), and goat F(ab')2 IgG anti-mouse IgG2a (Southern Biotech). After staining, the slides were washed 3X with PBS, air-dried, and mounted with 10 µl of Vectashield containing DAPI (Vector Laboratories, Burlingame, CA, USA), and images were acquired with a Zeiss Axioscan Confocal microscope or an Olympus BX43 microscope.
References
- Zhou, P. et al. A pneumonia outbreak associated with a new coronavirus of probable bat origin. Nature579, 270-273 (2020).
- Jiang, F. et al. Review of the Clinical Characteristics of Coronavirus Disease 2019 (COVID-19). J Gen Intern Med35, 1545-1549 (2020).
- Ye, Z., Zhang, Y., Wang, Y., Huang, Z. & Song, B. Chest CT manifestations of new coronavirus disease 2019 (COVID-19): a pictorial review. Eur Radiol30, 4381-4389 (2020).
- Wu, F. et al. A new coronavirus associated with human respiratory disease in China. Nature579, 265-269 (2020).
- Coperchini, F., Chiovato, L., Croce, L., Magri, F. & Rotondi, M. The cytokine storm in COVID-19: An overview of the involvement of the chemokine/chemokine-receptor system. Cytokine Growth Factor Rev53, 25-32 (2020).
- Ackermann, M. et al. Pulmonary Vascular Endothelialitis, Thrombosis, and Angiogenesis in Covid-19. N Engl J Med383, 120-128 (2020).
- Magro, C. et al. Complement associated microvascular injury and thrombosis in the pathogenesis of severe COVID-19 infection: A report of five cases. Transl Res220, 1-13 (2020).
- Varga, Z. et al. Endothelial cell infection and endotheliitis in COVID-19. Lancet395, 1417-1418 (2020).
- Bikdeli, B. et al. COVID-19 and Thrombotic or Thromboembolic Disease: Implications for Prevention, Antithrombotic Therapy, and Follow-Up: JACC State-of-the-Art Review. J Am Coll Cardiol75, 2950-2973 (2020).
- Levi, M. & Hunt, B.J. Thrombosis and coagulopathy in COVID-19: An illustrated review. Res Pract Thromb Haemost4, 744-751 (2020).
- Menter, T. et al. Postmortem examination of COVID-19 patients reveals diffuse alveolar damage with severe capillary congestion and variegated findings in lungs and other organs suggesting vascular dysfunction. Histopathology77, 198-209 (2020).
- Connors, J.M. & Levy, J.H. COVID-19 and its implications for thrombosis and anticoagulation. Blood135, 2033-2040 (2020).
- Hoffmann, M. et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell181, 271-280 e278 (2020).
- Yan, R. et al. Structural basis for the recognition of SARS-CoV-2 by full-length human ACE2. Science367, 1444-1448 (2020).
- Shang, J. et al. Structural basis of receptor recognition by SARS-CoV-2. Nature581, 221-224 (2020).
- Hamming, I. et al. Tissue distribution of ACE2 protein, the functional receptor for SARS coronavirus. A first step in understanding SARS pathogenesis. J Pathol203, 631-637 (2004).
- Bertram, S. et al. Influenza and SARS-coronavirus activating proteases TMPRSS2 and HAT are expressed at multiple sites in human respiratory and gastrointestinal tracts. PLoS One7, e35876 (2012).
- McCray, P.B., Jr. et al. Lethal infection of K18-hACE2 mice infected with severe acute respiratory syndrome coronavirus. J Virol81, 813-821 (2007).
- Tseng, C.T. et al. Severe acute respiratory syndrome coronavirus infection of mice transgenic for the human Angiotensin-converting enzyme 2 virus receptor. J Virol81, 1162-1173 (2007).
- Netland, J., Meyerholz, D.K., Moore, S., Cassell, M. & Perlman, S. Severe acute respiratory syndrome coronavirus infection causes neuronal death in the absence of encephalitis in mice transgenic for human ACE2. J Virol82, 7264-7275 (2008).
- Lutz, C., Maher, L., Lee, C. & Kang, W. COVID-19 preclinical models: human angiotensin-converting enzyme 2 transgenic mice. Hum Genomics14, 20 (2020).
- Akkina, R. New generation humanized mice for virus research: comparative aspects and future prospects. Virology435, 14-28 (2013).
- Ernst, W. Humanized mice in infectious diseases. Comp Immunol Microbiol Infect Dis49, 29-38 (2016).
- Danner, R. et al. Expression of HLA class II molecules in humanized NOD.Rag1KO.IL2RgcKO mice is critical for development and function of human T and B cells. PLoS One6, e19826 (2011).
- Majji, S. et al. Differential effect of HLA class-I versus class-II transgenes on human T and B cell reconstitution and function in NRG mice. Sci Rep6, 28093 (2016).
- Wijayalath, W. et al. Humanized HLA-DR4.RagKO.IL2RgammacKO.NOD (DRAG) mice sustain the complex vertebrate life cycle of Plasmodium falciparum malaria. Malar J13, 386 (2014).
- Kim, J. et al. Tracking Human Immunodeficiency Virus-1 Infection in the Humanized DRAG Mouse Model. Front Immunol8, 1405 (2017).
- Majji, S., Wijayalath, W., Shashikumar, S., Brumeanu, T.D. & Casares, S. Humanized DRAGA mice immunized with Plasmodium falciparum sporozoites and chloroquine elicit protective pre-erythrocytic immunity. Malar J17, 114 (2018).
- Jiang, L. et al. Dissemination of Orientia tsutsugamushi, a Causative Agent of Scrub Typhus, and Immunological Responses in the Humanized DRAGA Mouse. Front Immunol9, 816 (2018).
- Mendoza, M. et al. Generation and testing anti-influenza human monoclonal antibodies in a new humanized mouse model (DRAGA: HLA-A2. HLA-DR4. Rag1 KO. IL-2Rgammac KO. NOD). Hum Vaccin Immunother14, 345-360 (2018).
- Mendoza, M. et al. The humanized DRAGA mouse (HLA-A2. HLA-DR4. RAG1 KO. IL-2R g c KO. NOD) establishes inducible and transmissible models for influenza type A infections. Hum Vaccin Immunother, 1-16 (2020).
- Zhou, B. et al. The pathological autopsy of coronavirus disease 2019 (COVID-2019) in China: a review. Pathog Dis78 (2020).
- Bradley, B.T. et al. Histopathology and ultrastructural findings of fatal COVID-19 infections in Washington State: a case series. Lancet (2020).
- Sauter, J.L. et al. Insights into pathogenesis of fatal COVID-19 pneumonia from histopathology with immunohistochemical and viral RNA studies. Histopathology (2020).
- Piet, B. et al. CD8(+) T cells with an intraepithelial phenotype upregulate cytotoxic function upon influenza infection in human lung. J Clin Invest121, 2254-2263 (2011).
- Purwar, R. et al. Resident memory T cells (T(RM)) are abundant in human lung: diversity, function, and antigen specificity. PLoS One6, e16245 (2011).
- Zou, X. et al. Single-cell RNA-seq data analysis on the receptor ACE2 expression reveals the potential risk of different human organs vulnerable to 2019-nCoV infection. Front Med14, 185-192 (2020).
- Xu, Z. et al. Pathological findings of COVID-19 associated with acute respiratory distress syndrome. Lancet Respir Med8, 420-422 (2020).
- Chai, X. et al. Specific ACE2 expression in cholangiocytes may cause liver damage after 2019-nCoV infection. BioRxiv https://doi.org/10.1101/2020.02.03.931766 (2020).
- Xiao, F. et al. Evidence for Gastrointestinal Infection of SARS-CoV-2. Gastroenterology158, 1831-1833 e1833 (2020).
- Chu, K.H. et al. Acute renal impairment in coronavirus-associated severe acute respiratory syndrome. Kidney Int67, 698-705 (2005).
- Helms, J. et al. Neurologic Features in Severe SARS-CoV-2 Infection. N Engl J Med382, 2268-2270 (2020).
- Chen, L., Li, X., Chen, M., Feng, Y. & Xiong, C. The ACE2 expression in human heart indicates new potential mechanism of heart injury among patients infected with SARS-CoV-2. Cardiovasc Res116, 1097-1100 (2020).
- Liu, K. et al. SARS-CoV-2 effects in the genitourinary system and prospects of sex hormone therapy. Asian J Urol (2020).
- Le Bert, N. et al. SARS-CoV-2-specific T cell immunity in cases of COVID-19 and SARS, and uninfected controls. Nature (2020).
- de Bree, G.J. et al. Selective accumulation of differentiated CD8+ T cells specific for respiratory viruses in the human lung. J Exp Med202, 1433-1442 (2005).
- Pichyangkul, S. et al. Tissue Distribution of Memory T and B Cells in Rhesus Monkeys following Influenza A Infection. J Immunol195, 4378-4386 (2015).
- Slutter, B., Pewe, L.L., Kaech, S.M. & Harty, J.T. Lung airway-surveilling CXCR3(hi) memory CD8(+) T cells are critical for protection against influenza A virus. Immunity39, 939-948 (2013).
- Turner, D.L. et al. Lung niches for the generation and maintenance of tissue-resident memory T cells. Mucosal Immunol7, 501-510 (2014).
- Wu, T. et al. Lung-resident memory CD8 T cells (TRM) are indispensable for optimal cross-protection against pulmonary virus infection. J Leukoc Biol95, 215-224 (2014).
- Park, S.L. et al. Local proliferation maintains a stable pool of tissue-resident memory T cells after antiviral recall responses. Nat Immunol19, 183-191 (2018).
- Hassan, A.O. et al. A SARS-CoV-2 Infection Model in Mice Demonstrates Protection by Neutralizing Antibodies. Cell182, 744-753 e744 (2020).
- Cohen, J. Antibodies may curb pandemic before vaccines. Science369, 752-753 (2020).
- Zost, S.J. et al. Potently neutralizing and protective human antibodies against SARS-CoV-2. Nature (2020).
- Sekine, T. et al. Robust T Cell Immunity in Convalescent Individuals with Asymptomatic or Mild COVID-19. Cell183, 158-168 e114 (2020).
- Mentzer, S.J. & Konerding, M.A. Intussusceptive angiogenesis: expansion and remodeling of microvascular networks. Angiogenesis17, 499-509 (2014).
- Ojo, A.S., Balogun, S.A., Williams, O.T. & Ojo, O.S. Pulmonary Fibrosis in COVID-19 Survivors: Predictive Factors and Risk Reduction Strategies. Pulm Med2020, 6175964 (2020).
- Phillips, R.J. et al. Circulating fibrocytes traffic to the lungs in response to CXCL12 and mediate fibrosis. J Clin Invest114, 438-446 (2004).
- Venkataraman, T., Coleman, C.M. & Frieman, M.B. Overactive Epidermal Growth Factor Receptor Signaling Leads to Increased Fibrosis after Severe Acute Respiratory Syndrome Coronavirus Infection. J Virol91 (2017).
- Percie du Sert, N. et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. Br J Pharmacol177, 3617-3624 (2020).