HMGB1 Neuroimmune Signaling and REST-G9a Gene Repression Contribute to Ethanol-induced Reversible Suppression of the Cholinergic Neuron Phenotype

doi:10.21203/rs.3.rs-2267098/v1

Download PDF

Article

HMGB1 Neuroimmune Signaling and REST-G9a Gene Repression Contribute to Ethanol-induced Reversible Suppression of the Cholinergic Neuron Phenotype

https://doi.org/10.21203/rs.3.rs-2267098/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 04 Jul, 2023

Read the published version in Molecular Psychiatry →

You are reading this latest preprint version

Adolescent binge drinking increases Toll-like receptor 4 (TLR4), receptor for advanced glycation end products (RAGE), the endogenous TLR4/RAGE agonist high-mobility group box 1 (HMGB1), and proinflammatory neuroimmune signaling in the adult basal forebrain in association with persistent reductions of basal forebrain cholinergic neurons (BFCNs). In vivo preclinical adolescent intermittent ethanol (AIE) studies find anti-inflammatory interventions post-AIE reverse the HMGB1-TLR4/RAGE neuroimmune signaling and loss of BFCNs in adulthood, suggesting proinflammatory signaling causes epigenetic repression of the cholinergic phenotype. Reversible loss of BFCN phenotype in vivo is linked to increased repressive histone 3 lysine 9 dimethylation (H3K9me2) occupancy at cholinergic gene promoters, and HMGB1-TLR4/RAGE proinflammatory signaling is linked to epigenetic repression of the cholinergic phenotype. Using an ex vivo basal forebrain slice culture (FSC) model, we report EtOH recapitulates the in vivo AIE-induced loss of ChAT + IR BFCNs, somal shrinkage of the remaining ChAT + neurons, and reduction of BFCN phenotype genes. Ex vivo targeted inhibition of EtOH-induced proinflammatory HMGB1 blocked ChAT + IR loss while disulfide HMBG1-TLR4 and fully reduced HMGB1-RAGE signaling decreased ChAT + IR BFCNs. EtOH increased expression of the transcriptional repressor RE1-silencing transcription factor (REST) and the H3K9 methyltransferase G9a that was accompanied by increased repressive H3K9me2 and REST occupancy at promoter regions of the BFCN phenotype genes Chat and Trka as well as the lineage transcription factor Lhx8. REST expression is similarly increased in the post-mortem human basal forebrain of individuals with alcohol use disorder, which is negatively correlated with ChAT expression. Administration of REST siRNA and the G9a inhibitor UNC0642 blocked and reversed the EtOH-induced loss of ChAT + IR BFCNs, directly linking REST-G9a transcriptional repression to suppression of the cholinergic neuron phenotype. These data suggest that EtOH induces a novel neuroplastic process involving neuroimmune signaling and transcriptional epigenetic gene repression resulting in the reversible suppression of the cholinergic neuron phenotype.

Biological sciences/Neuroscience

Biological sciences/Molecular biology

Biological sciences/Cell biology

Basal forebrain cholinergic neurons (BFCNs) modulate attention and cognition, and integrate neural networks^1–3 through vast projections to key brain regions, including the cortex and hippocampus⁴. Adolescent binge drinking is associated with increased risk for development of alcohol use disorder (AUD)⁵ and neurodegenerative diseases such as Alzheimer’s disease (AD)^{6, 7}. Loss of BFCNs occurs in both AUD and AD^{8, 9}, and is accompanied by induction of proinflammatory neuroimmune signaling molecules, including Toll-like receptor 4 (TLR4), receptor for advanced glycation end-products (RAGE), and the endogenous TLR4/RAGE ligand high-mobility group box 1 (HMGB1)^10–12. Adolescent intermittent ethanol (AIE) exposure, which models human adolescent binge drinking, causes persistent loss of choline acetyltransferase immunoreactive (ChAT + IR) BFCNs as well as forebrain induction of HMGB1-TLR4/RAGE neuroimmune signaling that persists into adulthood despite cessation of continued ethanol exposure^13–16. As HMGB1 binds to and activates TLR4, RAGE, and other receptors culminating in nuclear translocation of NF-κBp65 contributing to complex proinflammatory signaling¹⁷, HMGB1 is poised to play a critical role as an immunoregulator underlying neuroimmune signaling and loss of BFCNs. However, alcohol exposure also induces peripheral proinflammatory signaling molecules (e.g., HMGB1, TNFα) that can drive neuroinflammation^{18, 19}, confounding interpretation of direct HMGB1 neuroimmune involvement in the loss of BFCNs.

Emerging studies suggest the loss of ChAT + BFCNs is related to proinflammatory neuroimmune signaling-induced shifts in chromatin remodeling and gene transcriptional regulation through epigenetic mechanisms that can repress or enhance gene transcription^{13, 20–23}. Loss of ChAT + IR and other cholinergic neuron markers is generally considered analogous to cell death; however, studies of AIE- and fimbria-fornix lesion-induced loss of ChAT + IR BFCNs find restorative treatments can recover BFCN populations^{14, 15, 24}, suggesting loss of the differentiated cholinergic neuron phenotype is reversible. Indeed, the in vivo AIE-induced loss of ChAT + IR BFCNs is accompanied by increased occupancy of the transcriptional repressive marker histone 3 lysine 9 dimethylation (H3K9me2) at Chat and Trka gene promoters that is reversed when ChAT + BFCNs are restored^{14, 15}. In the current study, we used an ex vivo basal forebrain slice culture (FSC) model to test the hypothesis that EtOH-induced HMGB1-mediated neuroimmune signaling causes epigenetic repression of the BFCN phenotype. We report that EtOH exposure induces a novel neuroplastic process involving HMGB1-TLR4/RAGE neuroimmune signaling and REST-G9a epigenetic gene repression which results in reversible suppression of the BFCN phenotype that has broad implication for understanding how proinflammatory signaling impacts degeneration and brain diseases.

In vivo AIE model

For in vivo AIE studies, Wistar rats were bred at the University of North Carolina at Chapel Hill (UNC). Subjects were housed in a temperature- (20°C) and humidity-controlled vivarium on a 12 hour/12 hour light/dark cycle (light onset at 7:00 AM), and provided ad libitum access to food and water. This study was conducted in an AAALAC-accredited facility in strict accordance with NIH regulations for the care and use of animals in research. All experimental procedures reported in this study were approved by the Institutional Animal Care and Use Committee at UNC.

On postnatal day (P)21, rats were weaned and randomly assigned to either: (i) AIE or (ii) water control (CON) conditions. From P25 to P54, AIE subjects received a single daily intragastric (i.g.) administration of ethanol (EtOH; 5.0 g/kg, 20% EtOH, w/v) in the morning on a 2 day on/2 day off schedule, and CON subjects received comparable volumes of water on an identical schedule as previously described by our laboratory^{14, 15}. Tail blood was collected 1 h after treatment on P38 (AIE: 169 mg/dL [± 20]) and P54 (AIE: 180 mg/dL [± 22]) to assess blood ethanol concentration (BEC) using a GM7 Analyzer (Analox; London, UK). All subjects evidenced dramatic body weight increases across age (main effect of Age: p = 0.000001, repeated measures ANOVA) that were unaffected by AIE treatment (main effect of Treatment: p = 0.41, repeated measures ANOVA). Subjects were sacrificed on P80 and brain tissue collected for immunohistochemistry (IHC; n = 7–10 subjects/group) and real-time PCR (RTPCR; n = 6–10 subjects/group).

For IHC experiments, animals were anesthetized with sodium pentobarbital (100 mg/kg, i.p.) and transcardially perfused with 0.1 M PBS followed by 4.0% paraformaldehyde. Brains were excised and post-fixed in 4.0% paraformaldehyde for 24 h at 4ºC followed by a 4 d fixation in 30% sucrose solution. Coronal sections were cut (40 µm) on a sliding microtome (MICROM HM450; ThermoScientific, Austin, TX, USA). For RTPCR experiments, animals were anesthetized with a lethal dose of sodium pentobarbital (100 mg/kg, i.p.) and transcardially perfused with 0.1 M PBS, brains excised, and basal forebrain tissue dissected and stored at -80ºC.

Ex vivo organotypic FSC model

Ex vivo FSC studies were conducted using P8 rat neonates from Charles River Laboratory (Wilmington, MA, USA) as previously described¹³. FSCs were treated with EtOH (100 mM) in media for 4 d (day ex vivo 12–16), unless otherwise indicated, in a dedicated humidified 5.0% CO₂ incubator at 36.5ºC containing 1.0 L water saturated with equal concentrations of EtOH to balance EtOH evaporation. For the HMGB1 experiments, FSCs were treated with either disulfide HMGB1 (dsHMGB1; HMGBiotech, Milano, Italy, Cat. #HM-121; 0.1–100 ng/mL) or fully reduced HMGB1 (rHMGB1; HMGBiotech, Cat. #HM-115; 0.1–10 ng/mL). In some experiments, FSCs were treated with glycyrrhizin (HMGB1 inhibitor [Sigma-Aldrich, St. Louis, MO, Cat. #G2137; 100 µM])²⁵, LPS-RS (TLR4 antagonist [InvivoGen, San Diego, CA, USA, Cat. #tlrl-prslps; 100 ng/mL])²⁵, FPS-ZM1 (RAGE antagonist [Tocris, Bristol, UK, Cat. #945714-67-0; 10-1000 nM]), or UNC0642 (G9a inhibitor [Santa Cruz, Dallas, TX, USA, Cat. #sc397059; 1.0 µM])¹³ in combination with EtOH or HMGB1 as described in the Results section. For knockdown of REST, a Silencer Select REST siRNA cocktail and Silencer Select scrambled negative control siRNA (Ambion, Grand Island, NY, USA, Cat. #136124 [100 nM], #136125 [100 nM], #136126 [100 nM]; negative control siRNA, Cat. #4390843) was used based on the protocol for transfection as previously described¹³. For prevention studies, FSCs were transfected for 6 h prior to the addition of EtOH for 4 d. For the restoration studies, FSCs were treated with EtOH for 4 d, media changed and well inserts containing slices rinsed with fresh media, and transfected for 4 d. At the end of experimentation, slices were collected from tissue inserts for analysis.

For IHC studies, membrane tissue inserts were collected from each well (n = 3–6 wells/group), fixed in a solution of 4.0% paraformaldehyde and 5.0% sucrose in 0.1 M PBS (pH 7.4) for 24 h, and stored in 0.1 M PBS. For RNA (n = 6 wells/group) and DNA (n = 10 wells/group) extraction, slices were rinsed in cold 0.1 M PBS, removed from membrane tissue inserts, and stored at -80ºC.

Post-mortem Human Basal Forebrain Tissue

Post-mortem human basal forebrain paraffin-embedded tissue samples from moderate drinking CON and AUD individuals (n = 10 subjects/group) were obtained from the New South Wales Brain Tissue Resource Centre (NSW BTRC [Ethnics Committee Approval Number: X11-0107]) at the University of Sydney (supported by the National Health and Medical Research Council of Australia-Schizophrenia Research Institute and the National Institute of Alcohol Abuse and Alcoholism [NIH (NIAAA) R24AA012725]). Subject information was collected from personal and next-of-kin interviews as well as medical records and is presented in Table 1. Only individuals with AUD uncomplicated by liver cirrhosis and/or nutritional deficiencies were included in the present study, and AUD diagnoses confirmed using the Diagnostic Instrument for Brain Studies that complies with the Diagnostic and Statistical Manual of Mental Disorders²⁶.

Table 1

Demographics of post-mortem human male moderate drinking control (CON) and alcohol use disorder (AUD) individuals.
Classification	Age of Death	Brain Weight (g)	PMI (h)	Brain pH	RIN	Clinical Cause of Death	Age of Drinking Onset	Lifetime Alcohol Consumption (kg)	Years Drinking	BMI (kg/m²)
CON	53	1590	16	6.8	7.9	Cardiac	25	102	28	26
CON	48	1330	24	6.7	6.9	Cardiac	25	17	23	24
CON	44	1220	50	6.6	7.1	Cardiac	25	28	19	28
CON	60	1420	28	6.8	8	Cardiac	25	unknown	35	29
CON	46	1320	29	6.1	4.4	Cardiac	25	115	21	unknown
CON	24	1490	43	6.3	6.2	Cardiac	20	15	4	38
CON	50	1426	30	6.4	7.5	Cardiac	25	unknown	unknown	28
CON	62	1430	46	7	8.8	Cardiac	25	5	7	33
CON	50	1596	40	6.9	8.6	Cardiac	25	18	25	29
CON	40	1441	27	6.8	7.4	Cardiac	25	47	16	35
AUD	25	1400	43.5	6.7	6.9	Toxicity	16	552	9	19
AUD	50	1520	17	6.3	7	Cardiac	18	2453	32	24
AUD	44	1360	15	6.5	7.9	Cardiac	20	639	10	24
AUD	42	1400	41	6.5	8	Toxicity	18	1472	24	24
AUD	45	1580	18.5	6.6	7.9	Respiratory	15	1800	29	29
AUD	61	1588	59	6.6	6.1	Cardiac	16	8052	43	25
AUD	49	1600	44	6.4	6.4	Cardiac	16	1012	33	26
AUD	49	1420	16	6.2	6.2	Cardiac	14	613	35	33
AUD	61	1340	23.5	6.9	8.3	Cardiac	17	5621	44	25
AUD	50	1470	34.5	6.9	7.3	Respiratory	16	5212	34	28
Age of drinking onset is significantly different (t(18)=-10.7, p = 0.0001) between CON (24.5 ± 0.5) and AUD individuals (16.6 ± 0.5). Lifetime alcohol consumption (CON: 43 kg ± 15, AUD: 2743 kg ± 829; t(9.0) = 3.3, p = 0.010, Welch's t test) and body mass index (BMI; CON: 30 kg/m² ± 1, AUD: 26 kg/m2 ± 1; t(17)=-2.3, p = 0.035) are significantly different between groups. No differences were observed regarding age of death (p = 0.983), brain weight (p = 0.401), post-mortem interval (PMI; p = 0.728), brain pH (p = 0.502), RNA integrity number (RIN; p = 0.869), or years drinking (p = 0.077).

Immunohistochemistry

Free-floating basal forebrain in vivo and ex vivo immunohistochemistry experiments were conducted as previously described^{13–15, 27}. Sections were incubated in a primary antibody solution containing blocking solution with either goat anti-ChAT (Millipore, Temecula, CA, USA, Cat. #AB144P) or rabbit anti-REST (Abcam, Cambridge, MA, USA, Cat. #ab202962). Negative control for non-specific binding was conducted on in vivo sections employing the above-mentioned procedures, omitting the primary antibody.

Immunohistochemical assessment of paraffin-embedded post-mortem human basal forebrain sections were conducted as previously described^{12, 27, 28}. Slides were incubated in a primary antibody solution containing Dako antibody diluent (Dako North America, Carpinteria, CA, Cat. #S0809) and rabbit anti-REST (Bioss Antibodies, Woburn, MA, Cat. #bs-2590R).

Microscopic Quantification And Image Analysis

Across experiments, BioQuant Nova Advanced Image Analysis software (R&M Biometric, Nashville, TN, USA) was used for image capture and quantification of IHC. Representative images were captured using an Olympus BX50 microscope and Sony DXC-390 video camera linked to a computer. For each measure, the microscope, camera, and software were background-corrected and normalized to preset light levels to ensure fidelity of data acquisition. A modified unbiased stereological quantification method was used, which was performed by experimenters blind to treatment, to quantify ChAT + IR and REST + IR cells in the basal forebrain. We previously reported that comparison of traditional unbiased stereological methodology with our modified unbiased stereological approach yielded nearly identical values for heterogeneously distributed cell populations²⁹. The outlined regions of interest were determined and data expressed as cells/mm². ChAT + IR somal size was assessed using BioQuant Nova Advanced Image Analysis software (R&M Biometric).

Fluorescent immunohistochemistry and microscopy

Paraffin-embedded human basal forebrain sections were deparaffinized, washed in PBS, and antigen retrieval performed by incubation in Citra solution (BioGenex) for 1 h at 70°C. Following incubation in blocking solution (MP Biomedicals), slides were incubated for 48 h at 4°C in a primary antibody solution consisting of Dako antibody diluent (Dako North America) with rabbit anti-REST (Bioss Antibodies) and goat anti-ChAT (Millipore). Slides were washed in PBS and incubated for 1 h at room temperature with Alexa Fluor 488 (Invitrogen, Cat. #A32814) and Alexa Fluor 594 (Invitrogen, Cat. #A21207) secondary antibodies. Secondary-only negative controls were performed without primary antibody incubation. Immunofluorescent images were obtained using a Nikon DS-Ri2 scope (Nikon Inc., Melville, NY) and colocalization quantified using NIS Elements AR46 analysis software (Nikon Inc.).

ELISA

At the conclusion of FSC studies, media was collected and used for detection of released HMGB1. HMGB1 ELISA was performed according to the manufacturer’s protocol (IBL International, Hamburg, Germany, Cat. #ST51011).

RNA extraction and RTPCR

Across experiments, total mRNA was extracted and reverse transcribed from in vivo basal forebrain and ex vivo FSC samples as previously described^{16, 30, 31}. RTPCR reactions were run on a BioRad CFX system (BioRad, Hercules, CA, USA) and primer sequences are presented in Table 2. Differences in primer extension of genes of interest between groups are expressed as cycle time (Ct) values normalized to a housekeeping gene (i.e., β actin or 18S), and relative differences between groups calculated using the ΔΔCt method and expressed as the percent difference relative to CONs.

Table 2

List of primer sequences for RTPCR analysis.
Primer	Forward	Reverse
Ache	GACTGCCTTTATCTTAATGTG	CGGCTGATGAGAGATTCATTG
Acly	CAGCAGGACAGCGTCTTTTTC	GGGATCTTGGACTTGGGACT
Ccl2	CTGGGCCTGTTGTTCACAGTTGC	CTACAGAAGTGCTTGAGGTGGTTG
Cd11b	CTGGTACATCGAGACTTCTC	TTGGTCTCTGTCTGAGCCTT
Chat	GCCCAACCAAGCCAAGCAAT	AAATGTCTTTGCGGGTGCCG
Chrm2	CCATCAATCCGGCCTGCTAT	TCGCTGTTCTTCCCCAAGAC
Chrna6	GTCGATGCCTCTGGCTACAA	CACCACAATGGACAGCGTGA
Chrna7	TTCTCCTCTATAACAGTGCTGATG	GACCACCCTCCATAGGACCA
Chrnb2	GACCACATGCGAAGTGAGGA	AAGATCCACAGGAACAGGCG
Cht	CATCACAGAACCTCACTCACAC	GCAAGAGGCTGAAACATTTGGG
G9a	CTCCGGTCCCTTGTCTCC	CTATGAGAGGTGTCCCCCAA
Gfap	AATGACTATCGCCGCCAACT	CGAGTGCCTCCTGGTAACTC
Hmgb1	ATGGGCAAAGGAGATCCTA	ATTCATCATCATCATCTTCT
Iba1	GGCAATGGAGATATCGATA	AGAATCATTCTCAAGATGGC
Il1β	GAAACAGCAATGGTCGGGAC	AAGACACGGGTTCCATGGTG
Il6	CTGGTCTTCTGGAGTTCCGTT	GGTCTTGGTCCTTAGCCACTC
Lhx8	GCCTTGGTAGAGGAGAAGGTC	TGGCTGGCTTTGGATGATTGA
Neun	CCCACCACTCTCTTGTCCGT	GGGCCGATGGTATGATGGTAG
Ngfr	GCTGCTGATTCTAGGGATGTC	CAGTCTCCTCGTCCTGGTAGT
Rage	CAGTAGGAAGTGGGGCAGAC	ATGGCACAGGTCAGGGTCAC
Rest	ACTACACGGCACACCTGAAG	GAGGTTTAGGCCCGTTGTGA
Tnfα	ATGTGGAACTGGCAGAGGAG	ACGAGCAGGAATGAGAAGAAG
Tlr4	CCAGAGCCGTTGGTGTATCT	TCAAGGCTTTTCCATCCAAC
Trka	CCATATCAAGCGCCAGGACA	GCAGTTTTGCATCAGGTCCG
Vacht	AGGCCACATCGTTCACTCTC	GGCGGTTCATCAAGCAACAC
β actin	CTACAATGAGCTGCGTGTGGC	CAGGTCCAGACGCAGGATGGC
18s	CGGGGAATCAGGGTTCGATT	TCGGGAGTGGGTAATTTGCG

Chromatin Immunoprecipitation (Chip)

ChIP was performed as previously described by our laboratory^13–15. Sheared chromatin was incubated overnight at 4°C with validated ChIP-grade antibodies against H3K9me2 (Abcam, Cat. #ab1220) or REST (Millipore, Cat. #17–641). The resulting DNA was quantified using qPCR with SSOAdvanced Universal SYBR Green Supermix (Life Technologies, Cat. #4367659) and primers for promoter and promoter CpG islands at Chat, Trka, and Lhx8 genes (Table 3). The ΔΔCt method was used to determine fold occupancy relative to CONs and was normalized to the Input DNA fraction.

Table 3

List of primer sequences for ChIP analysis.
Primer	Forward	Reverse	Target
Chat Promoter	ACTTGATTGCTGCCTCTCTC	GGGATGGTGGAAGATACAGAAG	Promoter
Chat CpG Promoter	TGCATCTGGAGCTCAAATCGT	GGGGATAGTGGTGACGTTGT	Promoter CpG island
Trka Promoter	CCTCACCGTGCACTTTACCT	AGGGTCTGGAGAGCGTACAT	Promoter
Trka CpG Promoter	TCAAGCAAGGCTCCGAACAG	CACAGGGTGGCGCTAGAAG	Promoter CpG island
Lhx8 Promoter	ATCGGAGGCGGTGTATGTTC	TGGGCCTGGTTCGGATTAAG	Promoter

Statistical analysis

Statistical analysis was performed using GraphPad Prism 8 (San Diego, CA). Two-tailed Student’s t tests were used to assess BECs, RTPCR, IHC, and ChIP data. Levene’s test for equality of variance was performed for each analysis. When reported in the Results, Welch’s t tests were used to assess data with unequal variances. All time course and dose response data was assessed using a one-way ANOVA with follow-up Dunnett’s multiple comparison tests or Sidak correction for multiple comparisons. Body weight data was assessed using repeated measures ANOVA. Pharmacological studies were analyzed using 2 × 2 ANOVAs with Tukey’s HSD post-hoc analyses when appropriate. If significant interactions were not observed, follow-up t tests were performed to determine pharmacological blockade. Two-tailed Pearson’s r was used for correlative analyses. All values are reported as mean ± SEM.

In vivo AIE and ex vivo EtOH decrease expression of cholinergic phenotype markers in the basal forebrain

In vivo AIE treatment induces lasting HMGB1-TLR4/RAGE neuroimmune signaling in the adult basal forebrain linked to persistent, but reversible, epigenetic repression of the adult BFCN phenotype^{8, 14–16}. In the present series of experiments, we replicate and extend these discoveries using an ex vivo organotypic FSC model to investigate the molecular mechanisms of EtOH-induced epigenetic repression of the BFCN phenotype. We first evaluated the effect of EtOH on ChAT + IR loss and somal shrinkage of the residual ChAT + neurons in our ex vivo FSC model by comparison to our in vivo AIE model. Administration of AIE caused a 20% (± 3%) reduction of adult (P80) ChAT + IR BFCNs (Fig. 1A), consistent with previously published studies^{8, 15, 16}. Further, we report a 17% (± 2%) reduction in somal size of the remaining ChAT + BFCNs in the adult basal forebrain following AIE (Fig. 1B). In the FSC model, EtOH caused a 32% (± 6%) reduction of ChAT + IR BFCNs (Fig. 1D) that was accompanied by a 22% (± 2%) reduction in somal size of the remaining ChAT + neurons (Fig. 1E). While somal shrinkage and loss of ChAT + BFCNs could be interpreted as indicative of cell death and autophagy, no changes in expression of the neuronal gene Neun were found across models (Table 4), consistent with prior studies reporting no changes in NeuN + IR neurons in the basal forebrain following AIE treatment^{14, 15}. The FSC model was used to assess EtOH concentration (10, 30, and 100 mM for 96 h) and time course (24, 48, and 96 h) effects on ChAT + IR BFCNs. Application of EtOH at a concentration of 100 mM, but not 10 mM or 30 mM, significantly decreased ChAT + IR BFCNs (Supplementary Fig. 1A). Time course analysis revealed that EtOH at a concentration of 100 mM significantly decreased ChAT + IR BFCNs at 24 h, 48 h, and 96 h relative to CONs assessed at 96 h (Supplementary Fig. 1B). While it is difficult to relate ex vivo slice culture to the in vivo AIE model, our findings indicate that the FSC model recapitulates the in vivo AIE-induced ChAT + somal shrinkage and reduction of ChAT + IR BFCNs.

Table 4

Effect of in vivo AIE and ex vivo EtOH on expression of cholinergic receptor, cellular, and neuroimmune genes in the basal forebrain.
		In vivo AIE Model		Ex vivo FSC Model
		CON	AIE	CON	EtOH
Cholinergic Receptor Genes	Chrnb2	100 ± 4	94 ± 5	100 ± 7	55 ± 6 **
	Chrna6	100 ± 17	113 ± 41	100 ± 76	455 ± 195
	Chrna7	100 ± 10	65 ± 6 *	100 ± 8	39 ± 4 **
	Chrm2	100 ± 11	87 ± 5	100 ± 8	64 ± 11 *
Cellular Genes	Cd11b	100 ± 12	108 ± 6	100 ± 9	82 ± 18
	Iba1	100 ± 9	118 ± 7	100 ± 8	83 ± 16
	Gfap	100 ± 24	86 ± 5	100 ± 11	73 ± 13
	Neun	100 ± 19	110 ± 6	100 ± 25	86 ± 26
Neuroimmune Genes	Tnfα	100 ± 10	89 ± 9	100 ± 6	90 ± 21
	Il1β	100 ± 12	142 ± 15 *	100 ± 10	435 ± 93 *
	Il6	100 ± 17	77 ± 14	100 ± 12	257 ± 19 **
	Ccl2	100 ± 21	203 ± 32 *	100 ± 11	231 ± 51 *

Cholinergic neurons are defined by expression of the ACh-synthesizing enzyme ChAT as well as numerous molecules involved in the synthesis and packaging of ACh into synaptic vesicles for release and key cholinergic trophic factors for NGF (Fig. 1G). Assessment of cholinergic phenotype genes in the AIE model reveal decreased expression of multiple cholinergic transcriptome genes, including Ache (30% [± 9%]), Chat (39% [± 8%]), Ngfr (50% [± 4%]), Trka (45% [± 5%]), and Vacht (36% [± 6%]) as well as the cholinergic lineage transcription factor Lhx8 (38% [± 8%]) (Fig. 1C). This was accompanied by reduced mRNA expression of the cholinergic receptor gene Chrna7 (Table 4). In our FSC model, ex vivo application of EtOH decreased expression of Ache (43% [± 3%]), Acyl (15% [± 4%]), Chat (55% [± 5%]), Cht (35% [± 10%]), and Ngfr (45% [± 6%]) as well as the cholinergic lineage transcription factor Lhx8 (44% [± 6%]) (Fig. 1F). The observed reduction and somal shrinkage of ChAT + IR BFCNs in the ex vivo model was accompanied by reduced mRNA expression of the cholinergic receptor gene Chrna7 as well as Chrnb2 and Chrm2 (Table 4). Together, these data reveal comparable in vivo and ex vivo EtOH-induced reductions of ChAT + IR BFCNs, somal shrinkage of the remaining ChAT + neurons, and decreased expression of cholinergic phenotype and lineage genes in the basal forebrain.

EtOH-induced HMGB1 and neuroimmune signaling in the basal forebrain contributes to the loss of cholinergic phenotype

Previous studies report AIE causes lasting increases of HMGB1, TLR4, RAGE, and other neuroimmune signaling molecules in brain, including the basal forebrain, in association with neuropathology^{10, 14–16, 31, 32}. Analysis of Hmgb1 mRNA in the adult basal forebrain revealed an AIE-induced approximate 1.7-fold increase (Fig. 2A), consistent with previous studies¹⁴. Induction of Hmgb1 mRNA in the adult basal forebrain was accompanied by increased expression of the proinflammatory cytokine Il1β and the chemokine Ccl2 (Table 4). In the FSC model, EtOH increased Hmgb1 mRNA 1.4-fold (Fig. 2B) and increased HMGB1 media levels approximately 4.1-fold (Fig. 2C). The increase of HMGB1 media levels in the FSC model was accompanied by increased mRNA expression of the proinflammatory cytokines Il1β and Il6 as well as the chemokine Ccl2 (Table 4). We did not observe changes in microglial genes Iba1 or Cdllb, the astrocyte gene Gfap, or the neuronal gene Neun in ether model (Table 4). These findings are consistent with EtOH-induced release of HMGB1 and proinflammatory gene induction contributing to the loss of ChAT + IR BFCNs, but not neuronal death. We next determined whether HMGB1 contributes to the EtOH-induced loss of ChAT + IR BFCNs by applying the direct HMGB1 inhibitor glycyrrhizin³³ to FSC media during EtOH treatment. Consistent with our earlier findings, EtOH caused a 41% (± 6%) reduction of ChAT + IR BFCNs, an effect that was blocked in EtOH-treated FSCs by glycyrrhizin (Fig. 2D). These data support EtOH-induced HMGB1 neuroimmune signaling, perhaps in ChAT + IR neurons, in the loss of ChAT + IR BFCNs.

HMGB1 signals through TLR4 and RAGE, leading to induction of proinflammatory signaling through NF-κB^34–38. Our AIE studies find colocalization of TLR4+, RAGE+, and NF-κBp65 + IR with ChAT + IR BFCNs¹⁴, consistent with in vivo EtOH exposure increasing HMGB1-TLR4/RAGE signaling within ChAT + neurons. Using our FSC model, we investigated direct HMGB1 activation of TLR4 and RAGE in the loss of ChAT + IR BFCNs. The redox state of HMGB1 dictates receptor binding, as dsHMGB1 binds to TLR4³⁹ and rHMGB1 binds to RAGE⁴⁰. To investigate TLR4 involvement, we applied dsHMGB1 and found dose-dependent reductions of ChAT + IR BFCNs at concentrations of 1.0 ng/mL (35% [± 2%]), 10 ng/mL (33% [± 1]), and 100 ng/mL (37% [± 7%]) (Fig. 2E). Our observation that higher concentrations of dsHMGB1 did not lead to further reductions of ChAT + IR neurons is consistent with previous in vivo AIE studies reporting that the loss of BFCNs is limited to approximately 25–30% of the population, with somal shrinkage of the remaining ChAT + IR neurons. We next determined whether the TLR4 antagonist LPS-RS (100 ng/mL; 24 h)¹³ blocked the dsHMGB1-induced loss of ChAT + IR BFCNs. Consistent with our findings above, dsHMGB1 (100 ng/mL) caused a 30% (± 3%) reduction of ChAT + IR BFCNs, which was blocked by LPS-RS treatment (Fig. 2F). To determine RAGE involvement, we next applied rHMGB1 to the FSC model and report a dose-dependent reduction of ChAT + IR BFCNs at concentrations of 0.1 ng/mL (18% [± 6%]) and 1.0 ng/mL (28% [± 5%]) (Fig. 2G). To confirm rHMGB1-RAGE signaling, we determined whether the RAGE antagonist FPS-ZM1 blocked the rHMGB1-induced loss of ChAT + IR BFCNs. rHMGB1 (1.0 ng/mL; 24 h) caused a 28% (± 4%) reduction of ChAT + IR BFCNs, an effect that was blocked by FPS-ZM1 treatment (1000 nM; Fig. 2H). We next determined if application of both dsHMGB1 and rHMGB1 would synergistically decrease ChAT + IR BFCNs in the FSC model. Independently, dsHMGB1 and rHMGB1 decreased ChAT + IR BFCNs consistent with the above studies; surprisingly, combined dsHMGB1 and rHMGB1 caused a greater reduction of ChAT + IR BFCNs (i.e., ~ 40% reduction) than either HMGB1 redox form alone (Fig. 2I). These findings suggest that multiple forms of HMGB1, signaling through TLR4 and/or RAGE, are able to reduce ChAT + IR BFCNs. Together with our in vivo data, these findings support the hypothesis that EtOH-induced release of HMGB1 binds to TLR4 and RAGE receptors leading to nuclear translocation of NF-κBp65 culminating in loss of the cholinergic phenotype through activation of repressive epigenetic signaling mechanisms^41–43 (Fig. 2J).

Etoh-induced Rest/g9a In The Basal Forebrain Contributes To Epigenetic Repression Of Bfcn Phenotype Genes

In vivo AIE increases occupancy of the epigenetic repressive marker H3K9me2 at cholinergic phenotype genes (i.e., Chat and Trka) that parallels loss of ChAT + IR BFCNs, which are both reversed by post-AIE adult exercise and galantamine treatment^{14, 15}. The histone methyltransferase G9a, which is recruited by the repressive transcription factor REST, reversibly suppresses gene transcription through dimethylation of H3K9^{44, 45}. In vivo, we report AIE caused an approximate 1.8-fold increase of REST + IR in the basal forebrain (Fig. 3A), which was negatively correlated with ChAT + IR expression (Fig. 3B). Further, AIE increased G9a mRNA gene expression by approximately 1.7-fold in the basal forebrain (Fig. 3C). Similarly, REST + IR is increased approximately 2.0-fold in the post-mortem human basal forebrain of individuals with AUD (Fig. 3D). Expression of REST + IR negatively correlated with ChAT protein expression⁸ (Fig. 3E), consistent with our observation of REST colocalization with ChAT + IR BFCNs (Fig. 3F).

We next investigated epigenetic gene repressive marker occupancy at cholinergic gene promoters and promoter CpG islands located near promoter transcription start sites in the FSC model to provide insight into EtOH-induced gene repression (Fig. 4C). We report that EtOH increased H3K9me2 occupancy approximately 2.3-fold at the Chat promoter and approximately 1.5-fold at the Chat promoter CpG island. Similarly, EtOH increased H3K9me2 occupancy approximately 2.1-fold at the promoter region of the cholinergic lineage gene Lhx8. Finally, EtOH treatment increased H3K9me2 occupancy approximately 1.8-fold at the Trka promoter and approximately 2.1-fold at the Trka promoter CpG island (Fig. 4A). Thus, EtOH increases H3K9me2 occupancy at Chat, Lhx8, and Trka gene promoters, consistent with epigenetic repression of key enzymatic, lineage, and NGF trophic receptors of the BFCN phenotype.

The Chat and Lhx8 gene promoters contain the consensus 21-base-pair DNA RE1 binding sequence that binds the transcriptional repressor REST, and REST is known to regulate expression of Chat and other cholinergic genes⁴⁶. We report that EtOH treatment increased REST occupancy at the Chat promoter approximately 2.7-fold. Although Trka does not contain the RE1 binding site, we did observe an approximate 2.5-fold increase of REST occupancy at the cholinergic lineage gene Lhx8 promoter (Fig. 4B). Thus, EtOH increases REST occupancy at Chat and Lhx8 promoter regions, consistent with repression of BFCN phenotype genes.

Similar to the in vivo rat and post-mortem human experiments, application of EtOH in the FSC model caused an approximate 2.9-fold increase of Rest mRNA (Fig. 5A). We next determined if knockdown of REST in the FSC model using a REST siRNA cocktail that was previously reported to decrease Rest expression¹³, prevented the EtOH-induced loss of ChAT + IR BFCNs (Fig. 5B). Although we did not observe a significant interaction, EtOH alone caused a 30% (± 4%) reduction of ChAT + IR BFCNs, consistent with earlier experiments, an effect that was prevented by co-administration of the REST siRNA cocktail (Fig. 5C). As these data reveal that the EtOH-induced reduction of ChAT + IR BFCNs involves REST, we next assessed if this loss is reversible in the FSC model. FSCs were treated with EtOH for 96 h as before to allow for loss of ChAT + IR; then, after EtOH treatment, REST siRNA was applied to culture media for 96 h following removal of EtOH (Fig. 5B). We found that EtOH caused a 43% (± 6%) loss of ChAT + IR BFCNs that persisted after EtOH removal for 96 h, and REST siRNA restored the loss of ChAT + IR BFCNs (Fig. 5D). We next assessed whether blockade of the methyltransferase G9a prevents the EtOH-induced loss of ChAT + IR BFCNs (Fig. 5E). Although we did not observe a significant interaction, application of EtOH alone caused a 36% (± 4%) reduction of ChAT + IR BFCNs, an effect that was prevented by co-administration of the G9a inhibitor UNC0642 (1.0 µM; Fig. 5F). We next determined if post-EtOH application of UNC0642 would restore the loss of ChAT + IR BFCNs. We found that EtOH caused a 32% (± 5%) reduction of ChAT + IR BFCN that persisted for 96 h following removal of EtOH, and blockade of G9a with UNC0642 restored the EtOH-induced loss of ChAT + IR BFCNs (Fig. 5G). Thus, these data support EtOH induction of REST and the methyltransferase G9a as contributing to reversible epigenetic repression of the BFCN phenotype. Taken together, these data support EtOH induction of REST and the methyltransferase G9a as contributing to increases in H3K9me2 and REST occupancy at cholinergic gene promoters that repress the cholinergic neuron phenotype.

The current study extends prior in vivo studies linking proinflammatory neuroimmune and epigenetic repressive mechanisms to the persistent, but reversible, AIE-induced loss of ChAT + IR BFCNs^14–16. In the post-mortem human brain of individuals with AUD, expression of HMGB1, TLR4, and RAGE are increased whereas markers of cholinergic neurons are reduced^{8, 10, 12, 47}. In the preclinical AIE model, exercise, indomethacin, and galantamine treatment post-AIE reverse proinflammatory neuroimmune induction and restore the loss of ChAT + IR BFCNs^{14, 15, 48}. While these in vivo studies link proinflammatory HMGB1 neuroimmune signaling to the persistent, but reversible, AIE-induced loss of BFCNs, mechanistic studies are needed to directly link these changes. In the current study, our laboratory utilized an organotypic FSC model to investigate the mechanisms underlying EtOH-induced reversible epigenetic repression of the BFCN phenotype. We report that EtOH treatment of FSCs decreased populations of ChAT + IR BFCNs and caused somal shrinkage of the remaining ChAT + neurons that was accompanied by reduced expression of multiple cholinergic phenotype genes, similar to the in vivo AIE model. Both models express the known cholinergic trophic factor receptors Trka and Ngfr¹³ as well as key cholinergic phenotype genes (Ache, Chat) and the cholinergic lineage transcription factor Lhx8. Further, Chrna7 mRNA is similarly reduced, whereas increases in HMGB1, Il1b and Ccl2 are observed across both models. These studies suggest that our FSC model mimics in vivo AIE, allowing direct studies on HMGB1 signaling. Previous studies in hippocampal slice culture reported active cellular release of HMGB1 stimulated by EtOH as well as glutamate, HDAC inhibitors, neuronal activation, and TLR4 agonists^{25, 49, 50}. We report here that EtOH treatment of FSCs induces Hmgb1 mRNA that is accompanied by increased media levels of HMGB1 protein. Although we could not determine the redox form of HMGB1 released by EtOH, direct treatment with dsHMGB1 (TLR4 agonist) and rHMGB1 (RAGE agonist) reduced ChAT + IR BFCNs, while antagonists to TLR4 (i.e., LPS-RS) and RAGE (i.e., FPS-ZM1), respectively, blocked the HMGB1-induced reductions of ChAT + IR BFCNs. This suggests that HMGB1 signaling through multiple receptors can reduce ChAT + IR, consistent with EtOH releasing HMGB1 that activates TLR4 and RAGE receptors, thereby leading to the loss of ChAT + BFCNs. This hypothesis is further supported by our finding that glycyrrhizin, an HMGB1 antagonist, blocked the EtOH-induced reduction of ChAT + IR BFCNs. HMGB1-TLR4/RAGE signaling is known to activate the nuclear transcription factor NF-κB, and studies report AIE and TLR4 stimulation increases phosphorylated NF-κBp65 in ChAT + IR BFCNs^{13, 14}, consistent with HMGB1 signaling directly on ChAT + neurons. Taken together, these findings suggest HMGB1-TLR4/RAGE signaling on ChAT + BFCNs leads to reduced expression of cholinergic phenotype markers as well as neuronal somal shrinkage.

HMGB1 and proinflammatory neuroimmune signaling are associated with neurodegeneration, and studies reporting loss of neuron-specific markers, such as ChAT, are interpreted as indicative of cell death. However, our in vivo studies in adults following AIE did not find evidence of neuronal death or loss of neuronal NeuN protein or mRNA expression. Further, anti-inflammatory treatments post-AIE restore ChAT + IR BFCN loss that is accompanied by reversal of repressive H3K9me2 occupancy on cholinergic gene promoters^{14, 15}. We replicated these in vivo findings in our ex vivo FSC model as EtOH treatment increases REST expression as well as occupancy of the repressive marker H3K9me2 at Chat, Trka, and Lhx8 gene promoters and REST at the Chat and Lhx8 gene promoters, consistent with our in vivo studies suggesting epigenetic silencing mechanisms. In the FSC model, REST siRNA during EtOH exposure blocks loss of ChAT + IR, whereas REST siRNA after EtOH exposure restores ChAT + BFCNs. Similarly, we report here that the G9a inhibitor UNC0642 both prevents and reverses EtOH-induced reductions of ChAT + IR BFCNs. These findings strongly support reversible REST recruitment of G9a increasing H3K9me2 repression of the cholinergic transcriptome, perhaps to reduce excitability to maintain neuron survival by reducing terminal differentiation of the cholinergic transcriptome and reducing somal size. Multiple replicates of the in vivo AIE model find a ChAT + IR BFCN loss of ~ 30% and somal size reductions of 15–25%, suggesting limits to ChAT + loss through unknown mechanisms. This is supported by our FSC dose responses to dsHMGB1-TLR4 and rHMGB1-RAGE that reduce ChAT + neurons to a maximum of about 30%, with the combination being only slightly greater than either alone. Lipopolysaccharide (LPS) is a TLR4 agonist known to increase brain proinflammatory signaling both in vivo and ex vivo that reduces ChAT + IR BFCNs and the cholinergic transcriptomes approximately 20–30%, comparable to the ChAT + loss observed in the in vivo AIE model and ex vivo EtOH FSC model^{13, 14, 16}. However, the proinflammatory response is far greater with LPS than EtOH, consistent with a protective limit to proinflammatory reductions of ChAT + IR BFCNs¹³. The surprising resistance to further loss of ChAT + IR BFCNs supports a protective mechanism consistent with REST repression being a protective response to EtOH-induced increases in HMGB1-TLR4/RAGE neuroimmune signaling.

REST is a well-known transcriptional repressor that binds to RE1, suppressing expression of neuronal genes and regulating neuronal differentiation, including later stages of differentiation of excitatory and inhibitor synapses that establish stable neurocircuitry⁵¹. Acetylcholine is excitatory, and we find reversible REST repression of the cholinergic phenotype. The Chat and Lhx8 genes contain the consensus REST repressor 21-base-pair DNA binding sequence RE1^{46, 52}. Lhx8 regulates multiple cholinergic genes⁵³, including the high-affinity NGF receptor TrkA⁵⁴ that is known to promote cholinergic differentiation as well as the survival and maintenance of BFCNs^{55, 56}. An Lhx8-TrkA-NGF positive feedback loop is hypothesized to maintain BFCNs in their highly differentiated state⁵⁴. REST repression of Lhx8 is consistent with the AIE- and EtOH-induced suppression of the cholinergic transcriptome and reduced neuronal excitability and perhaps diminished cerebral excitability. Reduced nuclear REST has been reported in several dementia disorders and is consistent with mouse conditional knockout studies reporting that REST deletion leads to age-related neurodegeneration⁵⁷. REST is hypothesized to reduce excitability, protecting neurons since high levels of REST expression are found in the brain of humans cognitively intact at 90–100 years of age^{58, 59}. Our findings of neuroimmune signaling inducing REST and loss of ChAT + IR BFCN phenotype may represent a neuroprotective mechanism to avoid neuronal death.

In summary, EtOH treatment of FSC recapitulates the in vivo AIE-induced loss of ChAT + IR BFCNs, ChAT + neuron somal shrinkage, and reduction of cholinergic transcriptome. Ex vivo inhibition of EtOH-induced HMGB1 as well as dsHMBG1-TLR4 and rHMGB1-RAGE signaling in the FSC model blocked the loss of ChAT + IR BFCNs. EtOH induced the transcriptional repressor REST and the H3K9 methyltransferase G9a, and increased repressive H3K9me2 and REST occupancy at Chat, Trka, and Lhx8 promoter regions, consistent with epigenetic repression of the cholinergic phenotype. REST siRNA and the G9a inhibitor UNC0642 both prevented and restored the EtOH-induced loss of ChAT + IR BFCNs. Together, these data reveal that EtOH exposure induces a novel neuroplastic process involving neuroimmune signaling and transcriptional epigenetic gene repression, resulting in the reversible loss of the cholinergic neuron phenotype.

Acknowledgements

This study was supported by the National Institute on Alcohol Abuse and Alcoholism (NIAAA) Grant # K01AA025713 (to RPV); the NIAAA Neurobiology of Adolescent Drinking In Adulthood (NADIA) Grant # U01AA020024 and U01AA020023 (to FTC); the National Institute on Aging Grant # RO1AG072894 (to RPV). We thank Jennie Vaughn for assistance editing the manuscript.

Conflict of Interest

The authors declare there are no competing financial interests in relation to the work described.

Supplementary information is available at MP’s website.

Vandecasteele M, Varga V, Berenyi A, Papp E, Bartho P, Venance L et al. Optogenetic activation of septal cholinergic neurons suppresses sharp wave ripples and enhances theta oscillations in the hippocampus. Proc Natl Acad Sci U S A 2014; 111(37): 13535–13540.
Li X, Yu B, Sun Q, Zhang Y, Ren M, Zhang X et al. Generation of a whole-brain atlas for the cholinergic system and mesoscopic projectome analysis of basal forebrain cholinergic neurons. Proc Natl Acad Sci U S A 2018; 115(2): 415–420.
Blake MG, Boccia MM. Basal Forebrain Cholinergic System and Memory. Curr Top Behav Neurosci 2018; 37: 253–273.
Mesulam MM, Mufson EJ, Wainer BH, Levey AI. Central cholinergic pathways in the rat: an overview based on an alternative nomenclature (Ch1-Ch6). Neuroscience 1983; 10(4): 1185–1201.
Grant BF, Dawson DA. Age at onset of alcohol use and its association with DSM-IV alcohol abuse and dependence: results from the National Longitudinal Alcohol Epidemiologic Survey. J Subst Abuse 1997; 9: 103–110.
Viner RM, Taylor B. Adult outcomes of binge drinking in adolescence: findings from a UK national birth cohort. J Epidemiol Community Health 2007; 61(10): 902–907.
Kamal H, Tan GK, Ibrahim SF, Shaikh MF, Mohamed IN, Mohamed RP et al. Alcohol use disorder, neurodegeneration, Alzheimer's and Parkinson's disease: Interplay between oxidative stress, neuroimmune response and excitotoxicity. Frontiers in Cellular Neuroscience 2020; 14(282).
Vetreno RP, Broadwater M, Liu W, Spear LP, Crews FT. Adolescent, but not adult, binge ethanol exposure leads to persistent global reductions of choline acetyltransferase expressing neurons in brain. PLoS One 2014; 9(11): e113421.
Lehericy S, Hirsch EC, Cervera-Pierot P, Hersh LB, Bakchine S, Piette F et al. Heterogeneity and selectivity of the degeneration of cholinergic neurons in the basal forebrain of patients with Alzheimer's disease. J Comp Neurol 1993; 330(1): 15–31.
Vetreno RP, Qin L, Crews FT. Increased receptor for advanced glycation end product expression in the human alcoholic prefrontal cortex is linked to adolescent drinking. Neurobiol Dis 2013; 59: 52–62.
Paudel YN, Angelopoulou E, Piperi C, Othman I, Aamir K, Shaikh MF. Impact of HMGB1, RAGE, and TLR4 in Alzheimer's Disease (AD): From Risk Factors to Therapeutic Targeting. Cells 2020; 9(2).
Vetreno RP, Qin L, Coleman LG, Jr., Crews FT. Increased Toll-like Receptor-MyD88-NFkappaB-Proinflammatory neuroimmune signaling in the orbitofrontal cortex of human alcohol use disorder. Alcohol Clin Exp Res 2021.
Crews FT, Vetreno RP. Cholinergic REST-G9a Gene Repression Through HMGB1-TLR4 Neuroimmune Signaling Regulates Basal Forebrain Cholinergic Neuron Phenotype. Frontiers in Molecular Neuroscience 2022.
Crews FT, Fisher R, Deason C, Vetreno RP. Loss of Basal Forebrain Cholinergic Neurons Following Adolescent Binge Ethanol Exposure: Recovery With the Cholinesterase Inhibitor Galantamine. Front Behav Neurosci 2021; 15: 652494.
Vetreno RP, Bohnsack JP, Kusumo H, Liu W, Pandey SC, Crews FT. Neuroimmune and epigenetic involvement in adolescent binge ethanol-induced loss of basal forebrain cholinergic neurons: Restoration with voluntary exercise. Addict Biol 2020; 25(2): e12731.
Vetreno RP, Crews FT. Adolescent binge ethanol-induced loss of basal forebrain cholinergic neurons and neuroimmune activation are prevented by exercise and indomethacin. PLoS One 2018; 13(10): e0204500.
Mayfield J, Ferguson L, Harris RA. Neuroimmune signaling: a key component of alcohol abuse. Current opinion in neurobiology 2013.
Massey VL, Qin L, Cabezas J, Caballeria J, Sancho-Bru P, Bataller R et al. TLR7-let-7 Signaling Contributes to Ethanol-Induced Hepatic Inflammatory Response in Mice and in Alcoholic Hepatitis. Alcohol Clin Exp Res 2018; 42(11): 2107–2122.
Qin L, He J, Hanes RN, Pluzarev O, Hong JS, Crews FT. Increased systemic and brain cytokine production and neuroinflammation by endotoxin following ethanol treatment. Journal of neuroinflammation 2008; 5: 10.
Chastain LG, Sarkar DK. Alcohol effects on the epigenome in the germline: Role in the inheritance of alcohol-related pathology. Alcohol 2017; 60: 53–66.
Nestler EJ, Luscher C. The Molecular Basis of Drug Addiction: Linking Epigenetic to Synaptic and Circuit Mechanisms. Neuron 2019; 102(1): 48–59.
Montesinos J, Pascual M, Rodriguez-Arias M, Minarro J, Guerri C. Involvement of TLR4 in the long-term epigenetic changes, rewarding and anxiety effects induced by intermittent ethanol treatment in adolescence. Brain Behav Immun 2016; 53: 159–171.
Wolstenholme JT, Mahmood T, Harris GM, Abbas S, Miles MF. Intermittent Ethanol during Adolescence Leads to Lasting Behavioral Changes in Adulthood and Alters Gene Expression and Histone Methylation in the PFC. Front Mol Neurosci 2017; 10: 307.
Hagg T, Fass-Holmes B, Vahlsing HL, Manthorpe M, Conner JM, Varon S. Nerve growth factor (NGF) reverses axotomy-induced decreases in choline acetyltransferase, NGF receptor and size of medial septum cholinergic neurons. Brain Res 1989; 505(1): 29–38.
Zou JY, Crews FT. Release of neuronal HMGB1 by ethanol through decreased HDAC activity activates brain neuroimmune signaling. PLoS One 2014; 9(2): e87915.
Dedova I, Harding A, Sheedy D, Garrick T, Sundqvist N, Hunt C et al. The importance of brain banks for molecular neuropathological research: The New South wales tissue resource centre experience. International journal of molecular sciences 2009; 10(1): 366–384.
Barnett A, David E, Rohlman AR, Nikolova VD, Moy SS, Vetreno RP et al. Adolescent binge alcohol promotes early Alzheimer’s disease pathology in adulthood through proinflammatory neuroimmune activation. Frontiers in Pharmacology 2022; 173379.
Liu W, Vetreno RP, Crews FT. Hippocampal TNF-death receptors, caspase cell death cascades, and IL-8 in alcohol use disorder. Mol Psychiatry 2021; 26(6): 2254–2262.
Crews FT, Nixon K, Wilkie ME. Exercise reverses ethanol inhibition of neural stem cell proliferation. Alcohol 2004; 33(1): 63–71.
Liu W, Vetreno RP, Crews FT. Hippocampal TNF-death receptors, caspase cell death cascades, and IL-8 in alcohol use disorder. Molecular Psychiatry 2020.
Vetreno RP, Lawrimore CJ, Rowsey PJ, Crews FT. Persistent Adult Neuroimmune Activation and Loss of Hippocampal Neurogenesis Following Adolescent Ethanol Exposure: Blockade by Exercise and the Anti-inflammatory Drug Indomethacin. Front Neurosci 2018; 12: 200.
Vetreno RP, Crews FT. Adolescent binge drinking increases expression of the danger signal receptor agonist HMGB1 and Toll-like receptors in the adult prefrontal cortex. Neuroscience 2012; 226: 475–488.
Oh H, Choi A, Seo N, Lim JS, You JS, Chung YE. Protective effect of glycyrrhizin, a direct HMGB1 inhibitor, on post-contrast acute kidney injury. Sci Rep 2021; 11(1): 15625.
Tobon-Velasco JC, Cuevas E, Torres-Ramos MA. Receptor for AGEs (RAGE) as mediator of NF-kB pathway activation in neuroinflammation and oxidative stress. CNS Neurol Disord Drug Targets 2014; 13(9): 1615–1626.
Chavakis T, Bierhaus A, Nawroth PP. RAGE (receptor for advanced glycation end products): a central player in the inflammatory response. Microbes Infect 2004; 6(13): 1219–1225.
Liu T, Zhang L, Joo D, Sun SC. NF-kappaB signaling in inflammation. Signal Transduct Target Ther 2017; 2.
Park JS, Svetkauskaite D, He Q, Kim JY, Strassheim D, Ishizaka A et al. Involvement of toll-like receptors 2 and 4 in cellular activation by high mobility group box 1 protein. The Journal of biological chemistry 2004; 279(9): 7370–7377.
Aucott H, Lundberg J, Salo H, Klevenvall L, Damberg P, Ottosson L et al. Neuroinflammation in Response to Intracerebral Injections of Different HMGB1 Redox Isoforms. J Innate Immun 2018; 10(3): 215–227.
Yang H, Wang H, Ju Z, Ragab AA, Lundback P, Long W et al. MD-2 is required for disulfide HMGB1-dependent TLR4 signaling. J Exp Med 2015; 212(1): 5–14.
Tang D, Loze MT, Zeh HJ, Kang R. The redox protein HMGB1 regulates cell death and survival in cancer treatment. Autophagy 2010; 6(8): 1181–1183.
El Gazzar M, Liu T, Yoza BK, McCall CE. Dynamic and selective nucleosome repositioning during endotoxin tolerance. J Biol Chem 2010; 285(2): 1259–1271.
El Gazzar M, Yoza BK, Chen X, Garcia BA, Young NL, McCall CE. Chromatin-specific remodeling by HMGB1 and linker histone H1 silences proinflammatory genes during endotoxin tolerance. Mol Cell Biol 2009; 29(7): 1959–1971.
Chang Y, Levy D, Horton JR, Peng J, Zhang X, Gozani O et al. Structural basis of SETD6-mediated regulation of the NF-kB network via methyl-lysine signaling. Nucleic Acids Res 2011; 39(15): 6380–6389.
Ballas N, Grunseich C, Lu DD, Speh JC, Mandel G. REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis. Cell 2005; 121(4): 645–657.
Roopra A, Qazi R, Schoenike B, Daley TJ, Morrison JF. Localized domains of G9a-mediated histone methylation are required for silencing of neuronal genes. Mol Cell 2004; 14(6): 727–738.
Shimojo M, Hersh LB. Regulation of the cholinergic gene locus by the repressor element-1 silencing transcription factor/neuron restrictive silencer factor (REST/NRSF). Life Sci 2004; 74(18): 2213–2225.
Crews FT, Qin L, Sheedy D, Vetreno RP, Zou J. High mobility group box 1/Toll-like receptor danger signaling increases brain neuroimmune activation in alcohol dependence. Biol Psychiatry 2013; 73(7): 602–612.
Macht V, Vetreno RP, Elchert N, Fisher RP, Crews FT. Indomethacin restores adolescent ethanol persistent innate immune gene induction, loss of hippocampal cholinergic innervation and neurogenesis, and reversal learning deficits in adult male and female rats. ACER 2022.
Zou J, Crews FT. Glutamate/NMDA excitotoxicity and HMGB1-TLR4 neuroimmune toxicity converge as components of neurodegeneration. AIMS Nolecular Science 2015; 2(3): 77–100.
Walker LE, Frigerio F, Ravizza T, Ricci E, Tse K, Jenkins RE et al. Molecular isoforms of high-mobility group box 1 are mechanistic biomarkers for epilepsy. J Clin Invest 2017; 127(6): 2118–2132.
Hwang JY, Zukin RS. REST, a master transcriptional regulator in neurodegenerative disease. Curr Opin Neurobiol 2018; 48: 193–200.
Abrajano JJ, Qureshi IA, Gokhan S, Zheng D, Bergman A, Mehler MF. REST and CoREST modulate neuronal subtype specification, maturation and maintenance. PLoS One 2009; 4(12): e7936.
Cho HH, Cargnin F, Kim Y, Lee B, Kwon RJ, Nam H et al. Isl1 directly controls a cholinergic neuronal identity in the developing forebrain and spinal cord by forming cell type-specific complexes. PLoS Genet 2014; 10(4): e1004280.
Tomioka T, Shimazaki T, Yamauchi T, Oki T, Ohgoh M, Okano H. LIM homeobox 8 (Lhx8) is a key regulator of the cholinergic neuronal function via a tropomyosin receptor kinase A (TrkA)-mediated positive feedback loop. J Biol Chem 2014; 289(2): 1000–1010.
Lucidi-Phillipi CA, Clary DO, Reichardt LF, Gage FH. TrkA activation is sufficient to rescue axotomized cholinergic neurons. Neuron 1996; 16(3): 653–663.
Fagan AM, Garber M, Barbacid M, Silos-Santiago I, Holtzman DM. A role for TrkA during maturation of striatal and basal forebrain cholinergic neurons in vivo. J Neurosci 1997; 17(20): 7644–7654.
Lu T, Aron L, Zullo J, Pan Y, Kim H, Chen Y et al. REST and stress resistance in ageing and Alzheimer's disease. Nature 2014; 507(7493): 448–454.
Aron L, Zullo J, Yankner BA. The adaptive aging brain. Curr Opin Neurobiol 2022; 72: 91–100.
Zullo JM, Drake D, Aron L, O'Hern P, Dhamne SC, Davidsohn N et al. Regulation of lifespan by neural excitation and REST. Nature 2019; 574(7778): 359–364.
Burns VE, Kerppola TK. Virus Infection Induces Keap1 Binding to Cytokine Genes, Which Recruits NF-kappaB p50 and G9a-GLP and Represses Cytokine Transcription. J Immunol 2021; 207(5): 1437–1447.
Abhimanyu, Ontiveros CO, Guerra-Resendez RS, Nishiguchi T, Ladki M, Hilton IB et al. Reversing Post-Infectious Epigenetic-Mediated Immune Suppression. Front Immunol 2021; 12: 688132.

The authors have declared there is NO conflict of interest to disclose

SupplementaryFigure1.docx

Download PDF

Journal Publication

published 04 Jul, 2023

Read the published version in Molecular Psychiatry →

Editorial decision: revise
25 Jan, 2023
Review #2 received at journal
23 Jan, 2023
Review #1 received at journal
14 Jan, 2023
Reviewer #2 agreed at journal
09 Jan, 2023
Reviewer #1 agreed at journal
29 Dec, 2022
Reviewers invited by journal
29 Dec, 2022
Submission checks completed at journal
14 Nov, 2022
First submitted to journal
12 Nov, 2022
Editor assigned by journal
12 Nov, 2022

You are reading this latest preprint version

HMGB1 Neuroimmune Signaling and REST-G9a Gene Repression Contribute to Ethanol-induced Reversible Suppression of the Cholinergic Neuron Phenotype

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Post-mortem Human Basal Forebrain Tissue

Immunohistochemistry

Microscopic Quantification And Image Analysis

Fluorescent immunohistochemistry and microscopy

ELISA

RNA extraction and RTPCR

Chromatin Immunoprecipitation (Chip)

Statistical analysis

Results

Etoh-induced Rest/g9a In The Basal Forebrain Contributes To Epigenetic Repression Of Bfcn Phenotype Genes

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1