Clinical samples
OS tissue and adjacent non-cancer tissue samples were collected from patients (n = 30) who underwent surgical resection at the First Affiliated Hospital of Guangxi Medical University. No patient received chemo- or radiotherapy before surgery.
Ethical approval
Informed consent was obtained from all patients. This study was approved by the Ethics Committee of the First Affiliated Hospital of Guangxi Medical University.
Date collection
OS gene expression data were retrieved from the following databases: Gene Expression Omnibus (GEO), ArrayExpress, and Sequence Read Archive (SRA). The search terms used were: (bone OR bones) OR (osteosarcoma OR osteosarcomas). The data inclusion criteria were: (1) human samples; (2) the study included an OS group and a non-cancer group; (3) the study included KIAA1429 expression data. We obtained KIAA1429 expression data for OS samples and corresponding clinical data from the Therapeutically Applicable Research to Generate Effective Treatments (TARGET) database. In addition, microarray, RNA sequencing, and published studies including KIAA1429 expression and prognostic clinical data were used to assess the prognostic value of KIAA1429 in OS.
Cell culture and lentivirus infection
Human OS cell lines MG-63, Saos2, and SW1353, and osteoblast cell line hFOB1.19 were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China). Cells were cultured in Roswell Park Memorial Institute-1640 medium containing 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Solarbio) in humidified air (containing 5% CO2) at 37°C. Two lentivirus-mediated si-KIAA1429 siRNA constructs (si-KIAA1429-1, CAGUGAUGUUCAAAUGCUAGA; si-KIAA1429-2, GGAAGAACCAAGACUACUAAA) and a negative control siRNA construct (si-NC) were synthesized by Shanghai Genechem Company Ltd. SW1353 cells were infected with lentiviral particles, and the infected cells were selected with 3 μg/ml puromycin.
RT-qPCR
Total RNA was extracted using TRIzol (Invitrogen, USA). Synthesis of cDNA was performed using a One-Step RT-PCR Kit (Thermo Fisher, USA). Real-time PCR assay was performed using an ABI Vii7 system (Applied Biosystems, USA). GAPDH mRNA expression was used as a reference gene. The primers synthesized were: KIAA1429-hF GTTGTGCCACCACCAAGAGG and KIAA1429-hR AACCCACCACGGGAAGAAAT; GAPDH-hF TGACAACTTTGGTATCGTGGAAGG and GAPDH-hR AGGCAGGGATGATGTTCTGGAGAG. Relative expression data were calculated using the 2−ΔΔCt method.
Western blot protein analysis
Western blotting was performed as described [21] with antibodies against KIAA1429 and GAPDH (Santa Cruz Biotechnology, USA); the latter was used as an endogenous control to normalize expression values of KIAA1429.
M6A RNA methylation quantification
EpiQuik m6A RNA Methylation Quantification Kit (Colorimetric) was used to assess m6A methylation levels, as previously described [22].
Cell proliferation assay
Cell counting kit-8 assay (CCK-8, Beyotime, Shanghai, China) was used to measure the cell proliferation. Briefly, SW1353 cells (5×103 cells/well) were seeded into 96-well plates, incubated overnight, and treated with control, si-NC, si-KIAA1429-1, or si-KIAA1429-2 for 0, 24, 48, 72, and 92 h. Then, cells were incubated with CCK-8 reagent (10 μL) for 2 h at 37°C and the absorbance was measured at 450 nm.
Apoptosis assay
An Annexin V-FITC Apoptosis Detection Kit (Becton Dickinson San Jose, CA) was used. After treatment, 5×105cells were pelleted by centrifugation, resuspended in binding buffer (200 μl), and incubated with 5 μl fluorescein isothiocyanate-Annexin V and 1 μl propidium iodide (PI) solution for 30 min at room temperature. Cells were detected using a Calibur Flow Cytometer (BD); apoptotic cells stained positive for Annexin V and negative for PI.
Identification of KIAA1429-related genes
KIAA1429-related genes were identified from co-expressed genes (CEGs) and differentially expressed genes (DEGs) in OS. To define genes as CEGs, we estimated the relationships between expression of genes and KIAA1429 expression in the microarray and RNA sequencing datasets; we considered genes with |Pearson’s r| ≥ 0.3 and P < 0.05 as KIAA1429 CEGs. DEGs were defined using the Limma-Voom package, based on microarray and RNA sequencing datasets; P < 0.05 and |log2FC| > 1 were established as screening criteria. Genes fitting within the criteria in both screens from the CEGs and the DEGs were considered to be KIAA1429-related genes.
Bioinformatics analysis
The Database for Annotation, Visualization, and Integrated Discovery (DAVID) database was used to perform enrichment analysis for Gene Ontology (GO) functions and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathways enriched in the KIAA1429-related genes. The Search Tool for the Retrieval of Interacting Genes (STRING) database and Cytoscape software were used to construct the protein–protein interaction (PPI) network of KIAA1429-related genes. Hub related genes were screened based on the degree of connectivity among KIAA1429-related genes.
Validation of hub related genes
Firstly, the expression of hub related genes in OS was evaluated by analyzing microarray and mRNA sequencing data. Secondly, the diagnostic potential of hub related genes was evaluated by a summarized receiver operating characteristic (SROC) curve. Finally, the prognostic value of hub related genes was analyzed based on the microarray, RNA sequencing, and published data.
Statistical analysis
Independent t-tests were employed to assess the expression differences of KIAA1429 between two independent groups using SPSS22.0. Receiver operating characteristic (ROC) curves were applied to determine the sensitivity and specificity of KIAA1429 in each study. Stata12.0 was applied to merge standardized mean difference (SMD), SROC, hazard radio (HR) and its 95% confidence interval (95% CI). Cochran’s Q test and I2 index were employed to evaluate the heterogeneity between the included studies. If P < 0.05 or I2 > 50%, there was significant heterogeneity between the included studies, and a random-effects model was applied; otherwise, a fixed-effects model was used. Sensitivity analysis was employed to assess the robustness of each study included in the meta-analysis. Begg’s test and Egger’s test were used to evaluate whether included studies exist publication bias. A p-value of P < 0.05 was considered to be statistically significant. A flow chart outlining this study is shown in Fig. 1.