Animal model establishment and grouping
In this study, SPF C57BL/6J mice (20-23g, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., China) were fed in SPF environmental conditions of half day light and half day dark, temperature was 22 ± 2°C and humidity was 60%±10%. C57BL/6J mice were randomly divided into sham and model groups. Global cerebral ischemia stroke model was prepared by four-vessel occlusion (Chaube et al., 2015): bilateral common carotid arteries were separated by a midneck incision after rats anesthesia, and the first transverse pterygous foramen was exposed in the posterior occipital position. The passing vertebral arteries under the first transverse pterygous foramen were thermo-coagulated for 2-4s for permanent occlusion. 24 h later, both common carotid arteries were clipped for 20 min under the awake state of the mice, and then permanent perfusion was performed. The criteria for the success of the animal model was as follows: the mice were in coma within 30-60s of ischemia, bilateral pupil dilation, and the righting reflex disappeared. In sham group, only blood vessel isolation and exposure were performed, without vertebral artery electrocoagulation and common carotid artery clipping.
Brain tissues were collected at 1, 3 and 7 days after modeling and a portion of the brain tissues was placed in 4% paraformaldehyde (PFA) and the rest was frozen in liquid nitrogen and stored at -80°C in preparation for subsequent experiments. The experimental mice followed the regulations of the Experimental Animal Ethics Committee of the Ministry of Science and Technology and the Laboratory Management Regulations of the Animal Center of the Institute of Radiation Medicine, Chinese Academy of Medical Sciences.
Isolation and culture of primary neurons
The mice were sterilized by 75% alcohol and then the brain tissues were slowly removed on a clean hood, and the cerebellum, brainstem, dura mater, pia mater and blood vessels were removed on ice. Transfering the remaining brain tissues to a petri dish that had been added with Hank's buffer, and cut up the brain tissues. After Hank's buffer was removed by pipetting, 3 mL trypsin was added and digested in cell incubator for 10 min. The samples were blew gently and added 1 mL DNase to tissue digestion. The tissue digestion was terminated by adding 3 mL DMEM complete medium. For the isolation and culture of primary neurons, the resuspended cells were added to poly-lysine coated petri dishes containing high glucose DMEM medium and incubated in the 37℃ incubator for 4h. The high glucose DMEM medium was removed, neurobasal medium containing 2% B27, 1% glutamic acid, 1% HEPES and 1% penicillin/streptomycin was added and cultured in the 37℃ incubator. The neurobasal medium was replaced every three days and cultured for 7–10 days to obtain the primary neurons.
Cell culture
The primary neurons were cultured in neurobasal medium (Solarbio, China) supplemented with 10% fetal bovine serum (FBS, Hyclone, USA) in a 37℃ incubator.
Cell transfection
All the plasmids (vector-miR-126a-5p inhibitor and vector-circRNA_0000927 over-expression) were purchased from Sangon Biotech. Co., Ltd. (Shanghai, China). The cells were transfected by lipo3000 (Biosharp, China) according to the manufacturer’s protocol. 24-48h later, cells were used to transfection-efficiency testing via RT-qPCR.
Hypoxia/reoxygenation cell model
The mouse neuronal injury was simulated by neuron hypoxia/reoxygenation. According to the adjustment of the preliminary experimental results, the time of hypoxia was determined for 3h and the time of reoxygenation for 24h, and the process of primary neurons injury in vitro was successfully simulated. The complete DMEM medium was replaced with FBS-free and glucose-free DMEM medium. Then, the cells were placed in an anaerobic producing airbag containing an oxygen indicator, and the bag was filled with mixed gas until the oxygen indicator turned pink. The bag was sealed and placed in an incubator for hypoxia 3h. After the end of hypoxia, the culture plate was removed from the anaerobic airbag and the medium was updated. The high-glucose DMEM medium containing 10% FBS was replaced and reoxygenated in a normal incubator for 24h to simulate the injury of primary neurons in vitro.
Flow cytometry
The primary neurons were collected with adjusting the cell density of 1×106 cells/mL. Then the cells were washed with PBS two times and centrifugal collected 5 ×105 cells. Next, the cells were resuspended by 500µLbinding buffer and 5µL Annexin V-FITC was added and mixed. Finally, 5µLPropidium Iodide was added and mixed at room temperature and reacted for 15 min in dark. Flow cytometry was used to detect and analyze the proportion of cell apoptosis. The above experiment was repeated for three times and recorded the data.
Histopathological examination
For Hematoxylin-eosin (HE) staining, the mouse brain tissues were fixed with 4% PFA, dehydrated in gradient ethanol, soaked in xylene, embedded in paraffin, dewaxed wirh xylene and gradient ethanol successively and sectioned. The thickness of the sections was about 3µm. The slices were sealed with permount TM mounting medium (Genink, Tianjing China,), observed and photographed using a microscope (Olympus BX51, Japan).
Immunofluorescence (IF)
For immunofluorescence, FITC labeled fluorescent primary antibodies Iba-1 (Affinity, USA, dilution:1:200), GFAP (CST, USA, dilution:1:200) and NeuN (CST, USA, dilution:1:200) were incubated overnight at 4°C. On the next day, sections were rewarmed, washed with PBS, anti-rabbit IgG (H + L) Alexa Fluor® 488 Conjugate secondary antibody (CST, USA, dilution:1:500) was incubated in dark for 1h. After restaining with DAPI, the slices were observed by fluorescence microscope (OLYMPUS, Japan, BX51) and photographed.
Fluorescence in situ hybridization (FISH)
The mouse brian tissues were fixed with fresh formaldehyde (1–4%) for 1-2h at room temperature, centrifuged at 12000g for 5min, poured off the supernatant and resuspend the samples with 1xPBS (pH 7.6). The samples were stored in a 1:1 mix of PBS/ethanol at -80°C until further processing. For the hybridization mixtures, adding 1 volume of probe working solution (50 ng.µL− 1 DNA) to 9 volume of hybridization buffer in a 0.5-mL microfuge tube and keeping the probe working solution dark and on ice. Hybridization vessels were prepared from 50 mL polyethylene tubes, inserted a piece of blotting paper into a polyethylene tube and soaked it with the remaining hybridization buffer. 10 µL hybridization mix was added to the samples in each well and place the slide into the polyethylene tube (in a horizontal position) and incubated at 46°C for at least 90 min. The slices were quickly rinsed carefully with a bit of washing buffer, transfered slices into preheated washing buffer and incubated for 25 min at 48°C. Then the slices were rinsed with distilled H2O and counterstained with 10 µL DAPI solution, and incubated for 3 min. Finally, the slices were sealed with permount TM mounting medium (Genink, Tianjing China), observed and photographed using a microscope (Olympus BX51, Japan).
ELISA assay
The mouse fresh brain tissues and cell samples were added to PBS buffer (Solarbio, China) and ground using a high-throughput tissue homogenizer (Techin TJ-800D, China). The homogenate was centrifuged at 10000×g for 5min, and the supernatant was collected. The BCA protein detection kit (Beijing Solarbio Biotechnology Co., Ltd., China) was used for protein quantification. The concentrations of IL-1β (Cloud-Clone, USA) was detected by ELISA kit. The ELISA kit was detected according to the kits instruction.
Western blotting
The mouse fresh brain tissues and cell samples were ground and lysed in RIPA buffer (Solarbio, China). After tissues or cell samples lysis, the samples were centrifuged at 12000rpm for 10min at 4℃ and supernatants were obtained. The protein concentration was determined using the BCA kit (Solarbio, China). The proteins were denatured by boiling water, and the samples were loaded for SDS-PAGE gel electrophoresis. After electrophoresis, the proteins were transferred to PVDF membrane (Millipore, USA), and the condition was 250mA constant flow for 1.5h. Samples were blocked with 5% non-fat milk solution for 1 h and then probed with primary antibodies PGC-1α (1:1000, Abcam, USA)、NLRP3 (1:1000, Abcam, USA)、ASC (1:1000, Affinity, USA) and Caspase-1 (1:1000, Abcam, USA) for shaking incubation at 4℃ overnight. After 1×TBST buffer washing for three times, secondary antibody was used for detection included HRP-conjugated anti-rabbit IgG (1:3000, Bioss, China). The samples were incubated for 1 h at room temperature and washed three times with 1×TBST, and incubated with ECL kit (Solarbio, China) for 2min at room temperature for color development. After ECL kit detection, the automatic chemiluminescence image analysis system (Tanon, China) was used for scanning imaging and taking photos. The software Gelpro32 (Tanon, China) was used to analyze the gray values.
RT-qPCR
The Trizol reagent (Invitrogen, USA) was used for total RNA of fresh brain tissues and cell samples extraction. The purity and concentration of RNA were detected by NanoDrop and the operation process was performed in strict accordance with the kit operation instructions. The RNA reverse transcription was performed using Revertaid First Strand cDNA Synthesis Kit (Thermo, USA). RT-qPCR was performed using SYBR®Green Kit (TaKaRa, Japan) with GAPDH as the reference gene. The Applied Biosystems Step One Plus Real-Time PCR system (Thermo, USA) was used for Ct values detection. Relative expression of target genes was analyzed using Ct values and 2−△△Ct values. The primers used in this study were synthesized by BGI (China), and the primer sequences are shown in Table 1.
Table 1
Primers used in this study
Gene name
|
|
Sequences (5’-3’)
|
Size(bp)
|
CircRNA_0000927
|
F
|
TTAGGCAGGTGGGAGATGATG
|
81
|
R
|
CTGCAATTATTAAATGCTCATCACTG
|
miR-126a-5p
|
F
|
CGCCATTATTACTTTTGGTACGCG
|
|
PGC-1α
|
F
|
CTGGGTGGATTGAAGTGGTGTAG
|
75
|
R
|
TATGTTCGCAGGCTCATTGTTGT
|
GAPDH
|
F
|
GGTGGACCTCATGGCCTACA
|
82
|
|
R
|
CTCTCTTGCTCTCAGTATCCTTGCT
|
U6
|
F
|
CTCGCTTCGGCAGCACA
|
94
|
|
R
|
AACGCTTCACGAATTTGCGT
|
Double luciferase assay
The binding sites between miR-126a-5p and PGC-1α mRNA and circRNA_0000927 and miR-126a-5p were predicted basing bioinformatics database. The deionized water was diluted the 5×PLB before use. Added 50 µL of diluted 1×PLB to each well and shaked on a shaker for 30 min. The 24-well microplate was added with 50 µL of supernatant to each well, and 500 µL of Luciferase Assay Reagent (Boster, China) premixed was added. After the measurement was completed, 450 µL of stop reagent premixed was added to each well and allowed to stand for 5 s, and then the data was measured to determine the intensity of the luciferase reaction. Finally, the results were calculated the ratio of the two sets of data.
Statistical analysis
The classic scientific software SPSS 24.0 (IBM, USA) was used for data statistical analysis. The data were expressed as mean ± standard deviation.The t-test was used for comparison between the two groups and one-way ANOVA analysis of variance was used among the multiple groups. P < 0.05 was considered statistically significant. The analyzed data were plotted using GraphPad Prism 7.0 software (La Jolla, USA).