MicroRNA-mediated repression of endocannabinoid CB1 receptor expression contributes to simvastatin-induced skeletal muscle toxicity

doi:10.21203/rs.3.rs-2328769/v1

Download PDF

Article

MicroRNA-mediated repression of endocannabinoid CB1 receptor expression contributes to simvastatin-induced skeletal muscle toxicity

https://doi.org/10.21203/rs.3.rs-2328769/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 23 Aug, 2023

Read the published version in Cell Death & Disease →

You are reading this latest preprint version

Statins are the most prescribed lipid-lowering agents worldwide. Their use is generally safe, although muscular toxicity occurs in 1 in 10.000 patients. In this study, we explored the role of the endocannabinoid system (ECS) during muscle toxicity induced by simvastatin. In murine C2C12 myoblasts exposed to simvastatin (30 µM), we found that the levels of the endocannabinoids 2-AG and AEA as well the expression of specific miRNAs (mostly miR-152) targeting the endocannabinoid CB1 gene were increased. Rimonabant, a selective CB1 antagonist, exacerbated simvastatin-induced toxicity in myoblasts, while the opposite effect was observed with GAT211, a CB1-positive allosteric modulator. In antagomiR-152-transfected myoblasts, simvastatin toxicity was prevented along with the rescue of CB1 expression. Notably, similar alterations were found in skeletal muscles of C57BL/6J mice treated with simvastatin 20 mg Kg-¹ and in primary human myoblasts. In sum, we identified the ECS as a novel mechanism participating in statin-induced myopathy.

Biological sciences/Cell biology/Mechanisms of disease

Biological sciences/Cell biology/Cell death/Apoptosis

Simvastatin

Endocannabinoid System (ECS)

CB1 receptors

microRNA (miRNA)

myopathies

Statins are a class of drugs widely used worldwide to reduce cholesterol levels in the blood. In pathological conditions such as hypercholesterolemia, the excessive amount of low-density lipoprotein (LDL) also called “bad” cholesterol, leads to fat deposits in the artery and vessel walls, with consequent formation of atheromatous plaques, which cause atherosclerotic cardiovascular diseases (ASCVDs). According to estimates of the Global Burden of Disease Study 2019, ASCVDs still are the first leading cause of death globally ^1,2. Statins are the most effective drugs for reducing LDL cholesterol and reducing cardiovascular event risk in both primary and secondary prevention ³. As lipid-lowering agents, statins exert beneficial effects through the selective and competitive inhibition of hydroxymethylglutaryl-CoA (HMG-CoA) reductase, the enzyme responsible for converting HMG-CoA to mevalonate in the cholesterol synthesis pathway in both hepatic and non-hepatic cells ⁴. Even though this mode of action is common to all statins, they may differ in terms of pharmacokinetics, pharmacodynamics, bioavailability and safety properties ⁵. Cross-sectional and observational studies revealed that the most frequently used statin is atorvastatin (42.8%), followed by simvastatin (27.6%) and rosuvastatin (22.8%) ^6,7. All statins are generally well-tolerated. However, their use may cause serious side effects, especially in patients with multimorbidity and/or taking several different medications. The major reason for statin therapy discontinuation is because of skeletal muscle toxicity, which can occur in 10–30% of patients and includes myalgia, myopathy and myositis with elevated CK (creatinine kinase) and, in more severe cases (fortunately, less than 1%) rhabdomyolysis ^8,9. Lifestyle interventions, vitamin supplementation and coenzyme Q10 were found to be ineffective at reducing the risk, or improving the symptoms of statin-associated myopathy ^9,10.

The endocannabinoid system (ECS) is a complex modulatory system involved in the fine-tuning of cell responses to various intrinsic as well as extrinsic stimulants through a complex cascade of receptor activation, gene expression, substrate mobilization, and enzyme reactions. In particular, the synthesis on demand of the two lipid mediators anandamide (AEA) and 2-arachidonoylglycerol (2-AG), followed by the activation of the two specific metabotropic receptors named cannabinoid receptor of type 1 (CB1) and type 2 (CB2), as well as of the transient receptor potential vanilloid 1 (TRPV1) channel, are the foremost ECS mechanisms regulating a variety of physiological and pathophysiological processes in the body tissues and organs. In addition to AEA and 2-AG, an expanded ECS including other N-acylethanolamines like AEA, mono-acylglycerols like 2-AG, and N-acyl amino acids, has been identified ^11–14.

However, despite the acknowledged importance of the ECS and its potential use for the treatment of many human disorders ^11,13,15,16, including skeletal muscle disorders ^17–19, to date, the potential implication of the ECS in statin-induced muscle toxicity is unknown. Based on this background knowledge, we have endeavoured to understand the role played by the ECS in simvastatin-induced myotoxicity in both murine C2C12 and skeletal muscle tissues of C57BL/6 mice using an interdisciplinary approach based on molecular biology, biochemical and pharmacological tools. Additionally, the role of ECS in simvastatin-induced cell toxicity was explored in human primary myoblasts.

Simvastatin causes alteration of the ECS activity in C2C12 cells

To explore whether in skeletal muscle cells statin exposure could induce changes in the ECS activity, we used C2C12 cells, which are murine myoblasts commonly used for their ability to rapidly exit the cell cycle upon serum withdrawal and form differentiated myotubes ²⁰. In good agreement with previous studies ²¹, we found that myoblasts were more sensitive to simvastatin than myotubes (Fig. 1A). In myoblasts exposed to simvastatin 30 µM (corresponding to the IC₅₀ value, Fig. 1A) for 3h, we found that the levels of both AEA and 2-AG were significantly increased compared to the control (vehicle-treated) cells (Fig. 1B). On the other hand, after 24h of exposure, AEA levels were further increased (~ 10 folds), whereas 2-AG levels were no longer higher than those detected in control cells (Fig. 1C). Using quantitative PCR (qPCR), we found that changes in the levels of AEA and 2-AG described above were accompanied by changes in the expression of genes involved in their synthesis (Abh4, Gde-1, Napepld for AEA and Dagla, and Daglb for 2-AG) and/or catabolism (Faah for AEA and Abdh6, Abdh12 and Magl for 2-AG). Furthermore, we found that simvastatin in a time-dependent manner significantly reduced the transcript expression levels of Cb1, Cb2 and Trpv1 genes (Fig. 1D). In Fig. 1E, the bar graph shows the quantification of Cb1 mRNA expression in myoblasts exposed to simvastatin 30 µM for 3 and 24 h. Changes in CB1 mRNA levels were then confirmed by western blot analysis (Fig. 1F and G). In myotubes exposed to simvastatin, the levels of AEA and 2-AG were unchanged, while the expression of the Cb1 gene was less reduced than in myoblasts (Fig. S1). Based on these results, we conducted all subsequent experiments in myoblasts using simvastatin 30 µM, a concentration which corresponds to the EC₅₀ for its induction of toxicity (Fig. 1A).

Pharmacological blockade of CB1 receptors worsens simvastatin toxicity in C2C12 cells

To understand whether changes in endocannabinoid levels and CB1 expression were associated with statin-induced skeletal muscle cell toxicity, we exposed C2C12 myoblasts to simvastatin (30 µM) in the presence or absence of selective CB1 receptor full agonists (ACEA and noladin ether) or antagonists (rimonabant and AM251) for 24 h. Cells viability measured using the MTT assay revealed that the toxic effect of simvastatin 30 µM was not modified by ACEA (1 µM) or noladin ether (1 µM), whereas in the presence of rimonabant (1 µM) and AM251 (1 µM), cell toxicity was slightly worsened (Fig. 2A). Additionally, measurement of caspase 3/7 activity in the same experimental conditions confirmed that C2C12 myoblasts were more susceptible to simvastatin when CB1 receptors were blocked in the presence of rimonabant or AM251, and, also in this case, ACEA or noladin ether did not show significant effects (Fig. 2B). Representative images of cell populations exposed to simvastatin in the presence or absence of ACEA or rimonabant are shown in Fig. 1C.

Next, using FACS analysis, we explored more in-depth the role of CB1 receptors during simvastatin-induced muscle cell toxicity. Therefore, proliferating C2C12 myoblasts, as previously described, were exposed to simvastatin 30 µM in the presence or absence of rimonabant (1 µM) or Acea (1 µM) for 24h. Subsequently, the cells were stained with FITC annexin V and Propidium iodide (PI), being this procedure a common method to detect early or late apoptotic cells as well as to discriminate apoptotic vs necrotic cell death ²². The results obtained indicate that in control C2C12 cells exposed to vehicle (DMSO, < 0.03%), the number of apoptotic (early or late) and necrotic cells detected ranged between ~ 0.8% and ~ 4.5%. The little fraction of dead cells was most likely attributed to the mechanical detachment from Petri dishes as also documented by others ²². In agreement with the results described above, simvastatin significantly increased the number of cells in both early (~ 50%) and late (~ 10%) apoptosis. While no effect of simvastatin on necrosis was detected (Fig. 3A). Interestingly, in myoblasts treated with simvastatin in the presence of rimonabant, the percentage of cells in early and late apoptosis significantly increased (~ 60% and ~ 30%, respectively). By contrast, the combination of simvastatin with ACEA did not change the number of dead cells vs the group of cells treated with simvastatin alone (Fig. 3A). Quantification of these results is shown in Fig. 3B. Finally, the effect of enhancing CB1 receptor activity induced by endogenous orthosteric agonists was explored using GAT211, a positive allosteric modulator (PAM) of this receptor. We found that GAT211 had a slight, albeit statistically significant, effect at preventing statin toxicity in myoblasts (Fig S2).

Simvastatin Causes A Mirna-mediated Suppression Of Cb1 Gene Expression In C2c12 Myoblasts

Next, we went on to elucidate the molecular mechanisms through which simvastatin causes time-dependent down-regulation of the CB1 gene in C2C12 myoblasts. Toward this goal, using bioinformatics tools, we identified a large set of microRNA sequences (miRNAs) targeting the three prime untranslated region (3′-UTR) of the CB1 mRNA (Fig. 4A). Among them, we selected only those highly conserved among vertebrates such as miR-18, miR-190, miR-128, miR-19, miR-29, miR-181, miR-130, miR-301, miR-148, and miR-152. Therefore, by quantitative PCR analysis, we measured the expression of all the aforementioned miRNA in myoblasts exposed to vehicle or simvastatin 30 µM for 3 and 24 hours. We found that, after 3h of exposure, the expression of miR-18, miR-128, miR-29, miR-130, miR-152, and miR-148 was significantly up-regulated by simvastatin as compared to control cells (Fig. 4B). After 24–hours, we observed a further up-regulation only for miR-18, miR-29, miR-130, and miR-152 with the latter showing the strongest up-regulation (Fig. 4C). The alignment of miR-152 among vertebrates is shown in Fig. 4D.

Antagomir-152 Prevents Simvastatin-induced Cytotoxicity By Rescuing Cb1 Expression In C2c12 Cells

Based on the results described above, we deemed it plausible that, in skeletal muscle cells exposed to simvastatin, excessive activity of miRNAs that suppress CB1 expression could be a pathological mechanism contributing to cell death. To pursue this hypothesis, myoblasts were transiently transfected with specific antagomir sequences directed against miR-152, 24h before cell exposure to simvastatin. Additionally, myoblasts transfected with control negative antagomir (scramble) and subsequently treated with vehicle (DMSO) or simvastatin served as control groups. After treatment for 24h with simvastatin, cells were analyzed by FACS analysis. As expected, simvastatin significantly increased the percentage of dead cells (by about 60–70%) as compared to scramble-transfected myoblasts treated with vehicle (DMSO) (Fig. 5A and B). Notably, in antagomiR-152-transfected myoblasts, the number of cells in both early and/or late cell apoptosis was significantly reduced (Fig. 5A and B). Besides, we found that in antagomiR-152-transfected myoblasts exposed to simvastatin, CB1 mRNA expression was restored at levels comparable to control cells (Fig. 5C).

Simvastatin Causes Alterations Of Ecs Signaling In The Skeletal Muscle Of C57bl/6j Mice

Next, we moved on to exploring whether simvastatin could cause changes in ECS activity in vivo. For this purpose, 10-week-old male C57BL/6J mice were randomized into two groups receiving a daily oral dose of simvastatin 20 mg kg^− 1 by gavage for 30 days following published protocol ²³. Following this procedure, we found that, in mice treated with simvastatin, muscle strength was significantly reduced compared to their control littermates (Figure S3), confirming a plausible increased statin-dependent susceptibility to myopathy. Therefore, at the end of the treatment, skeletal muscle tissues (gastrocnemius) were dissected from control and simvastatin-treated mice to measure i) endocannabinoid levels, ii) CB1 mRNA expression, and iii) changes in the expression of miRNAs targeting CB1. Treatment with simvastatin did not cause significant changes in muscle levels of AEA and 2-AG (Fig. 6A), although a modest reduction of CB1 mRNA expression was observed (Fig. 6B). However, similarly to what observed in C2C12 myoblasts, we found that simvastatin in gastrocnemius induced a significant up-regulation of miR-29, miR-181, and miR-152 (Fig. 6C)

Simvastatin Causes A Mirna-mediated Dysregulation Of Cb1 Expression In Primary Human Myoblasts

Finally, simvastatin-induced dysregulation of the expression of miRNAs causing inhibition of CB1 expression was explored in primary human myoblasts. In this case, similarly to what was observed in C2C12 myoblasts, we found that simvastatin 30 µM induced cell death in more than 60% of human myoblasts (Fig. 7A). Most importantly, simvastatin caused a significant reduction of CB1 mRNA expression associated with up-regulation of miR-29, miR-130 and miR-152 (Fig. 7B and C).

In this study, we demonstrated that simvastatin-induced myotoxicity in both murine and human skeletal muscle precursor cells is accompanied by dysregulation of the two endocannabinoids AEA and 2-AG along with alteration of specific miRNAs causing repression of the CB1 receptor gene, overall leading to impaired activity of endocannabinoid signalling at CB1. Subsequently, we explored the role of CB1 in simvastatin-induced myotoxicity using both genetic and pharmacological tools and found that simvastatin-induced impairment of CB1 signaling underlies, at least in part, the cytotoxic and pro-apoptotic effect of this drug on murine and human myoblasts.

According to recent estimates, the use of lipid-modifying agents (LMAs) to prevent cardiovascular diseases (CVDs) has grown massively worldwide, particularly over the last two decades ²⁴. Statins are the most prescribed class of LMAs showing the largest average growth from 2008 to 2018 ²⁵. The biggest turning point in the growth of statin use was in 2013 when the American College of Cardiology (ACC) and the American Heart Association (AHA) revised the existing guidelines for preventing the risk of CVDs and their complications expanding the population of patients eligible for statin therapy ²⁶. Therefore, according to the new ACC/AHA recommendations, statin prescription is recommended not only to those patients who have a high risk of cardiovascular events but also to those without a history of CVDs ²⁷. Moreover, the use of statins has been further broadened due to their cholesterol-independent (pleiotropic) effects, which may include improvement of endothelial dysfunction, antioxidant properties, inhibition of inflammatory responses, and stabilization of atherosclerotic plaques ²⁸. Therefore, given that the patient population thought to benefit from the use of statins will undoubtedly continue to increase in the next years, unwanted adverse effects must be kept under control.

The clinical spectrum of myopathies caused by statin may include myalgia, myositis, muscle pain, cramps, and less frequent rhabdomyolysis ²⁹. However, the exact pathophysiological mechanism(s) responsible for statin-induced myopathy is not fully known. According to a review by Gluba-Brzozka and colleagues ³⁰, statin intolerance is mainly attributable to the perturbation of several molecular mechanisms including the reduced production of coenzyme Q10, impairment of the ubiquitin pathway, reduced production of sarcolemmal or sarcoplasmic reticular cholesterol, diminished production of prenylated proteins, disruption of calcium metabolism, induction of skeletal muscle apoptosis and mitochondrial dysfunction ³⁰. Alternatives to statin therapy include the use of cholesterol absorption inhibitors and bile-acid sequestrants. However, the efficacy of these drugs to reduce the levels of LDL cholesterol is much lower than that of statins. In 2015, a new class of LDL inhibitors made by human monoclonal antibodies directed against the PCSK9 enzyme, a master regulator of the LDL receptor, was approved by the US Food and Drug Administration ³¹. However, the relatively high cost and the existence of conflicting data about their long-term safety profile have significantly limited the widespread use of these therapeutic tools ³². Therefore, statins remain irreplaceable for the treatment of hypercholesterolemia and the prevention of CVDs ³³. In this regard, simvastatin appears to be the best choice in terms of cost and safety, while atorvastatin and rosuvastatin are more effective to reduce cholesterol levels ³⁴. However, compared to atorvastatin, simvastatin is associated with a higher risk of myalgia ³⁵.

Excessive or impaired ECS activity is associated with a plethora of pathological conditions affecting both the brain and peripheral organs and tissues ^11,13,36. For example, chronic over-activation of CB1 receptors by higher tissue levels of endocannabinoids is recognized as a pathological mechanism causing exacerbation of inflammatory responses and oxidative stress as well as obesity and its consequences, such as type 2 diabetes, liver and kidney dysfunctions and atherogenic inflammation. In some other pathological conditions, instead, transient and site-specific activation of the ECS and its activity at either CB1 or CB2 receptors takes part in the body’s compensatory responses to several insults, thus reducing symptoms and/or slowing the progression of disease ¹¹. The rationale for the present study relied on published studies documenting that CB1 receptors in skeletal muscle cells regulate important metabolic pathways including insulin sensitivity and glucose uptake ^37,38. Additionally, we demonstrated that the pharmacological stimulation of CB1 receptors by endogenous (mainly 2-AG) or synthetic agonists (ACEA) promotes the proliferation of both murine and human myoblasts and concomitantly inhibits their differentiation into mature myotubes ¹⁷. Accordingly, using a mouse model of Duchenne muscular dystrophy (DMD), which is the most frequent and detrimental form of hereditary myopathy, we found that the selective antagonism of CB1 by rimonabant prevents locomotor impairment and promotes muscle regeneration by halting the inflammatory response ¹⁸. Additionally, CB1 receptors are key regulators of both autophagy and mitophagy in both myoblasts and myotubes exposed to toxic stimuli (Iannotti et al. manuscript under review). These latter findings are in line with recent studies reporting that CB1 is also localized on muscle mitochondria where its stimulation participates in mitochondrial respiration and regulation of oxidative activity ³⁹. These observations suggest that muscle dystrophies such as DMD may be listed among those pathological conditions that benefit from CB1 receptor antagonism rather than agonism.

Interestingly, in this study, we found, instead, that antagonism of CB1 receptors by rimonabant or AM251 worsens muscle cell toxicity induced by simvastatin, whereas direct CB1 activation by orthosteric ligands, ACEA or noladin ether, did not produce any protective effect. Of note, GAT211, a positive allosteric modulator of CB1 at least in part prevented the simvastatin-induced toxicity in C2C12 myoblasts. This suggests that the impairment by simvastatin of CB1 expression is such that residual amounts of such receptors in myoblasts are not sufficient for exogenous agonists to reverse the myotoxic effect of the drug, possibly because already fully engaged by residual muscle endocannabinoids, which are likely to counteract this effect. Conversely, positive allosteric modulation might instead take advantage of low levels of CB1 receptors and its endogenous ligands to potentiate the protective effects of residual endocannabinoid signalling at these receptors.

Simvastatin also caused myoblast toxicity and reduced CB1 signaling in C57BL/6 mice, thus confirming previous studies carried out with the same drug (and supported also by histological analyses) ^40,41. However, these effects were less prominent in mouse skeletal muscle tissues than in C2C12 or human myoblasts. The most plausible reason for this difference is the fact that myoblasts represent only a minor population (less than 10%) of progenitor cells in the skeletal muscles of mammals ⁴². Therefore, the presence of other cell types in skeletal muscle tissues including fibroblasts, fibro/adipogenic progenitors (FAPs) cells, immune, endothelial and blood cells might have mitigated the effect of simvastatin on CB1 expression in vivo. Overall, the regeneration of myofibers relies on the activation, proliferation, and fusion of muscle precursor cells including satellite cell-derived myoblasts ⁴³. Therefore, we believe that the reduced expression of CB1 signalling caused by statins in skeletal muscle tissues might directly compromise myoblast proliferation and fusion, and, consequently, myoblast ability to terminate differentiation into mature myotubes to complete the muscle regeneration process, which is continuously ongoing even under healthy conditions.

As to the cause of simvastatin inhibitory effects on CB1 expression, we identified a specific set of miRNAs, among which miR-152 was the most up-regulated, as being potentially responsible for the suppression of CB1 gene expression in both murine and human myoblasts and mouse skeletal muscle exposed to simvastatin, and hence of the myotoxic effects of this drug. Accordingly, the antagonism of miR-152 reversed both the cytotoxic and the CB1 expression inhibitory effect of simvastatin. This is, to the best of our knowledge, the first time that CB1-targeting miRNAs are shown to underlie a pathological situation in which CB1 receptors are involved. Again in the skeletal muscle, we have also shown that, instead, suppression of CB1-targeting miRNAs, rather than their up-regulation, is responsible for some of the pathological features of DMD in vitro and in vivo (Iannotti et al. manuscript under review).

In conclusion, we propose that CB1 receptors may represent a novel target for adjuvant therapies to prevent statin-induced myopathies and their toxic effects on muscle precursor cells. Although we could not reverse nor ameliorate here simvastatin-induced myotoxicity with CB1 agonists (which would have little therapeutic use anyway, due to their unwanted psychotropic effects), our results, based on the worsening effects of rimonabant and AM251, open the way to the use of positive allosteric modulators of CB1 as possible treatments for this condition. Conversely, the proposed use of CB1 receptor antagonists as anti-atherogenic drugs ⁴⁴ in combination with statins might need to be rediscussed based on our present results.

Animal model and drug treatment The Animal Study Protocol (IACUC; 536/2018) was approved by the Italian Ministry of Health and Ethics Committee for the use of experimental animals being conformed to guidelines for the safe use and care of experimental animals following the Italian D.L. no. 116 of 27 January 1992 and associated guidelines in the European Communities Council (86/609/ECC and 2010/63/UE). In this study, 5 weeks old male C57BL/6 mice were purchased from Charles River Laboratories (Milan IT). All mice were housed in ventilated cages with a 12-h light-dark cycle and received standard mouse chow (Harlan Teklad) and water ab libitum. Animals were randomly subdivided into two groups. The first group of mice daily received vehicle (dimethyl sulfoxide – DMSO 0.03%, Cat# 276855 Merk) dissolved in water by gavage to serve as the control group; the second group received a daily oral dosage of simvastatin 20 mg kg^− 1 (Cat# S6196 Merk) following published procedures ²³. Each experimental group included five mice. The experimenter(s) performing the treatments and locomotor testing was blind to the genotype and treatment.

Grip strength test To test the forelimb strength, control and simvastatin-treated mice were handled by the base of the tail and allowed to grasp four weights of 20, 33, 46, and 59 g. If the mouse dropped the first weight (20g) in less than 3 seconds (s), we tried the same weight again a maximum of three times. If the mouse held it for 3 s, then we tried it on the next heaviest weights. The mouse was assigned the maximum time/weight achieved. The final total score is calculated as the product of the number of links in the heaviest chain held for the full 3 s, multiplied by the time (s) it is held ¹⁹.

Cell Culture and reagents Murine C2C12 myoblasts were propagated in a growth medium (GM) composed of Dulbecco’s modified Eagle’s medium (Cat# 11995065; Life Technologies) supplemented with 10% fetal bovine serum (FBS, Cat# 16000044; Life Technologies), 5000 U/ml penicillin plus 5000 µg/ml streptomycin (Cat# 15070063; Life Technologies), and 1% L-glutamine (Cat# A2916801; Life Technologies). Proliferating C2C12 cells were differentiated into myotubes following their exposure in a differentiation medium (DM) composed of Dulbecco’s modified Eagle’s medium supplemented with 2% horse serum heat-inactivated (Cat# 26050070, Merk) for four days ¹⁹. Primary human myoblasts were provided by Innoprot (Cat# P10977; Bizkaia-Spain) and propagated in a growth medium (GM) recommended by the same company (Skeletal Muscle Cell Medium, cat. no. P60124). Arachidonyl-2′-chloroethylamide hydrate (ACEA) was from Merk (cat# A9719); Noladin ether (cat# 1411), Rimonabant/SR141716A (cat# 0923) and AM251 (cat# 1117/1) were purchased from Tocris (UK). GAT211 (cat# SML1926) was purchased from Merk (IT).

Cell Transfection and antagomir overexpression. Myoblasts at a confluency of 60% were transiently transfected with antagomiR-152 (cat# MIN0000162, Quiagen Italy) using Lipofectamine 2000 (cat# 11668019, Thermo Fisher Italy) according to the manufacturer’s instructions. After 24h, C2C12 myoblasts were treated with simvastatin for 24 h and then subjected to FACS analysis.

RNA Extraction and Quantitative PCR (qPCR). Total RNA was isolated from C2C12 and human myoblasts, or muscle tissues by use of TRIzol Reagent (cat# 15596018, Life Technology), reacted with DNase-I (cat# AMPD1 Merk) for 15 min at room temperature, followed by spectrophotometric quantification. Subsequently, the RNA integrity number (RIN) for each RNA sample was analyzed on the Agilent 2100 bioanalyzer. Purified RNA was reverse-transcribed by the use of the iScript cDNA Synthesis Kit (cat# 1708841 Biorad). Total miRNAs isolation was performed using RNeasy Mini Kit (cat# 217004, Qiagen). Reverse transcription of total miRNAs was performed using miScript II RT Kit (cat# 218161, Qiagen).

Quantitative PCR (qPCR) was carried out in a real-time PCR system CFX384 (Bio-Rad) using the SYBR Green PCR Kit (Cat# 1725274, Bio-Rad for mRNAs; Cat# 218073, Quiagen for miRNAs) detection technique and specific primer sequences ¹⁷. Primer sequences for miRNA and/or antagomiRNA152 were provided by Qiagen. Quantitative PCR was performed on independent biological samples ≥ 5 for each experimental group. Each sample was amplified simultaneously in quadruplicate in a one-assay run with a nontemplate control blank for each primer pair to control for contamination or primer-dimer formation, and the cycle threshold (Ct) value for each experimental group was determined. The housekeeping genes ribosomal protein S16 and U6 (RNU6‑1) were used to normalize the Ct values, using the 2^{^−ΔCt} formula. Differences in mRNAs and miRNAs content between groups were expressed as 2^{^−ΔΔCt}, as previously described ¹⁹. The primer sequences used were: murine CB1 forw 5’-GGGCACCTTCACGGTTCTG-3’; murine CB1 rev 5’-GTGGAAGTCAACAAAGCTGTAGA-3’; murine S16 forw 5’-CTGGAGCCTGTTTTGCTTCTG-3’; murine S16 rev 5’-CTGGAGCCTGTTTTGCTTCTG-3’; human CB1 forw 5’-TCGGACGCAAGAAGACAGCGA-3’; murine CB1 rev 5’-GTGGAAGTCAACAAAGCTGTAGA-3’; human S16 forw 5’- TCGGACGCAAGAAGACAGCGA − 3’; human S16 rev 5’-agcgtgcgcggctcaatcat-3’. Primer sequences for miRNAs were provided by Qiagen (IT).

miRNA target prediction Bioinformatic analysis to predict putative miRNA target sites within the 3’UTR region of both human and murine CB1 genes was performed using the free software TargetScan (http://www.targetscan.org/vert_80/).

Western blot Total protein from control and statin-treated C2C12 cells were exacted using a 1x TNE buffer [50 mm Tris–HCl (pH 7.4); 100 mM NaCl. 0.1; mM EDTA) plus 1% (v/v) Triton X-100 (Cat# T8787, Sigma-Aldrich) and protease inhibitor (Cat# P8340, Sigma-Aldrich). Lysates were kept in an orbital shaker incubator at 220 rpm at 4°C for 30 min and then centrifuged for 15 min at 13,000 g at 4°C. The supernatants were transferred to tubes and quantified by DC Protein Assay (Cat# 5000116, Bio-Rad, Milan, Italy). Subsequently, protein samples (80 µg of total protein) were heated at 70°C for 10min in 1X LDS Sample Buffer (Cat# B0007, Life Technology) plus 1X sample reducing agent (Cat# B0009, Life Technology) and loaded on 10% Bis-Tris Protein Gels (Cat# NW00102BOX, Life Technology) and then transferred the membrane using Trans-Blot Turbo Mini 0.2 µm PVDF Transfer Packs (Cat# 1704156 Bio-Rad). The primary antibodies used were: a) rabbit anti-CB1 (Cat# Y409605, ABM Canada) and b) an anti-α-tubulin antibody (1D4) (Cat#. T6199; Merk) Reactive bands were detected by Clarity Western ECL Substrate (Cat# 1705061 Bio-Rad). The intensity of bands was analyzed on a ChemiDoc station with Quantity-one software (Biorad, Segrate, Italy).

3-(4,5-Dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) assay C2C12 myoblasts or myotubes were seeded in 24-well culture plates (25000 cells/well). Myoblasts were allowed to attach overnight or to differentiate into myotubes for 4 days before starting the treatment with the compounds of interest. Cells were then treated for 24 h with the test compounds. Afterwards, cell media was replaced by MTT solution (0.5 mg/mL, pH 7.4) for 3 h at 37°C. Formazan precipitates formed were dissolved using isopropanol solution and absorbance was recorded at 595 nm using a Promega GloMax Plate Reader.

Caspase3/7 Assay C2C12 myoblasts (2000 cells/well) were seeded in 96-well black plates. After 24h, cells were treated for 24 h with compounds of interest. Caspase3/7 activation was determined using the Caspase-Glo 3/7 Assay System (cat# G8090, Promega). Luminescence was measured with a Promega GloMax Plate Reader. Chemiluminescent signals were acquired using a ChemiDoc station (Biorad, Segrate, Italy).

Flow cytometry and Cell Cycle Analysis Cell apoptosis was analyzed using an Annexin V-FITC kit purchased from BD Pharmingen (San Diego, CA, USA) according to the manufacturer's instructions. C2C12 cells were seeded in 6 well plates and allowed to attach overnight. The cells were treated with simvastatin (30 µM) in the presence or absence of Rimonabant (1 µM) or ACEA (1 µM) for 24. After this time, cells were collected and washed twice with PBS. Samples were then taken to determine baseline and drug-induced apoptosis by Annexin V-FITC/Propidium Iodide (PI) (Beckman Coulter; Brea, CA) double staining or PI staining and flow cytometry analysis using a FACSCanto II 6-colour flow cytometer (Becton Biosciences, San Jose, CA), as described previously ⁴⁵. To detect early and late apoptosis, both adherent, and floating cells were harvested together and resuspended in annexin V binding buffer (10 mM HEPES/NaOH pH 7.4, 140 mM NaCl, 2.5 mM CaCl2) at a concentration of 106 cells/mL. Subsequently, 5 µL of FITC-conjugated Annexin V and 5 µL of PI were added to 100 µL of the cell suspension (105 cells). The cells were incubated for 15 min at room temperature in the dark. Finally, 400 µL of annexin V binding buffer was added to each tube. A minimum of 50000 events for each sample were collected and data were analyzed using FlowJo v10 software (Tree Star, Ashland, OR, USA).

Measurement of Endocannabinoids Murine or human skeletal muscle cells were collected and sonicated in a solution containing 50 mmol/L chloroform/methanol/cell media (2:1:1, vol/vol). Muscle tissues were first dounce-homogenized in a solution containing 50 mmol/L chloroform/methanol/Tris·HCl, pH 7.5 (2:1:1, vol/vol) and then sonicated for 8 min. After sonication, internal standards [[2H]8 anandamide (AEA) 10 pmol; [2H]5 2-arachidonoylglycerol (2-AG)] were added to the solutions. The organic phase containing lipids was dried down, weighed, and purified by open-bed chromatography on silica gel. Fractions were obtained by eluting the column with 99:1, 90:10, and 50:50 (vol/vol) chloroform/methanol. The 90:10 fraction was used for AEA and 2-AG quantification by liquid chromatography–atmospheric pressure chemical ionization–mass spectrometry by using a Shimadzu HPLC apparatus (LC-10ADVP) coupled to a Shimadzu (LCMS2020) quadrupole mass spectrometry via a Shimadzu atmospheric pressure chemical ionization interface as previously described ⁴⁶. The amount of endocannabinoids in both cells and tissues, quantified by isotope dilution with the above-mentioned deuterated standards, is reported as pmol/mg of the total amount of lipids extract.

Statistical analysis Data and statistical analysis comply with the recommendations on experimental design and analysis in pharmacology ⁴⁷. Data are expressed as means ± SEM of values. All data were analyzed by one-way ANOVA with Tukey's multiple comparisons test (comparison of multiple groups) with GraphPad Prism 8 (GraphPad Software, La Jolla, CA, US). Significance was determined as p < 0.05. GraphPad Prism log (agonist) vs response-variable slope (four parameters) non-linear regression analysis was used to determine the effect of simvastatin in myoblast and myotubes cells.

Acknowledgements We thank Dr Fabrizia De Maio for the precious assistance during the experimental procedures and Drs. Roberta Verde and Marco Allarà for technical help with LC-MS and cell culture.

Author contributions F.A.I. conceived the study. F.A.I. and V.D. wrote the manuscript; C.M., E.P., H.K., E.P., F.P. conducted the experiments; F.A.I., E.P., E.P., R.C. analyzed the data

Competing Interest Statement: The authors have declared that no conflict of interest exists

Libby P, Buring JE, Badimon L, Hansson GK, Deanfield J, Bittencourt MS et al. Atherosclerosis. Nat Rev Dis Primers 2019; 5: 1–18.
Roth GA, Mensah GA, Johnson CO, Addolorato G, Ammirati E, Baddour LM et al. Global Burden of Cardiovascular Diseases and Risk Factors, 1990–2019: Update From the GBD 2019 Study. Journal of the American College of Cardiology 2020; 76: 2982–3021.
Naci H, Brugts JJ, Fleurence R, Tsoi B, Toor H, Ades AE. Comparative benefits of statins in the primary and secondary prevention of major coronary events and all-cause mortality: a network meta-analysis of placebo-controlled and active-comparator trials. Eur J Prev Cardiol 2013; 20: 641–657.
McNamara DJ. CHOLESTEROL | Sources, Absorption, Function and Metabolism. In: Caballero B (ed). Encyclopedia of Human Nutrition (Second Edition). Elsevier: Oxford, 2005, pp 379–385.
Chong PH, Seeger JD, Franklin C. Clinically relevant differences between the statins: implications for therapeutic selection. Am J Med 2001; 111: 390–400.
Reiner Ž, Tedeschi-Reiner E. Prevalence and types of persistent dyslipidemia in patients treated with statins. Croat Med J 2013; 54: 339–345.
Lippi G, Mattiuzzi C, Cervellin G. Statins popularity: A global picture. Br J Clin Pharmacol 2019; 85: 1614–1615.
Keen HI, Krishnarajah J, Bates TR, Watts GF. Statin myopathy: the fly in the ointment for the prevention of cardiovascular disease in the 21st century? Expert Opin Drug Saf 2014; 13: 1227–1239.
Ward NC, Watts GF, Eckel RH. Statin Toxicity. Circulation Research 2019; 124: 328–350.
Barry AR, Beach JE, Pearson GJ. Prevention and management of statin adverse effects: A practical approach for pharmacists. Can Pharm J (Ott) 2018; 151: 179–188.
Pacher P, Kunos G. Modulating the endocannabinoid system in human health and disease – successes and failures. The FEBS Journal 2013; 280: 1918–1943.
Battista N, Bari M, Bisogno T. N-Acyl Amino Acids: Metabolism, Molecular Targets, and Role in Biological Processes. Biomolecules 2019; 9: E822.
Cristino L, Bisogno T, Di Marzo V. Cannabinoids and the expanded endocannabinoid system in neurological disorders. Nat Rev Neurol 2020; 16: 9–29.
Iannotti FA, Di Marzo V. The gut microbiome, endocannabinoids and metabolic disorders. J Endocrinol 2020. doi:10.1530/JOE-20-0444.
Lowe H, Toyang N, Steele B, Bryant J, Ngwa W. The Endocannabinoid System: A Potential Target for the Treatment of Various Diseases. Int J Mol Sci 2021; 22: 9472.
Pagano E, Iannotti FA, Piscitelli F, Romano B, Lucariello G, Venneri T et al. Efficacy of combined therapy with fish oil and phytocannabinoids in murine intestinal inflammation. Phytotherapy Research 2021; 35: 517–529.
Iannotti FA, Silvestri C, Mazzarella E, Martella A, Calvigioni D, Piscitelli F et al. The endocannabinoid 2-AG controls skeletal muscle cell differentiation via CB1 receptor-dependent inhibition of Kv7 channels. Proc Natl Acad Sci U S A 2014; 111: E2472-2481.
Iannotti FA, Pagano E, Guardiola O, Adinolfi S, Saccone V, Consalvi S et al. Genetic and pharmacological regulation of the endocannabinoid CB1 receptor in Duchenne muscular dystrophy. Nat Commun 2018; 9: 3950.
Iannotti FA, Pagano E, Moriello AS, Alvino FG, Sorrentino NC, D’Orsi L et al. Effects of non-euphoric plant cannabinoids on muscle quality and performance of dystrophic mdx mice. British Journal of Pharmacology 2019; 176: 1568–1584.
Iannotti FA, Panza E, Barrese V, Viggiano D, Soldovieri MV, Taglialatela M. Expression, localization, and pharmacological role of Kv7 potassium channels in skeletal muscle proliferation, differentiation, and survival after myotoxic insults. J Pharmacol Exp Ther 2010; 332: 811–820.
Sanvee GM, Bouitbir J, Krähenbühl S. C2C12 myoblasts are more sensitive to the toxic effects of simvastatin than myotubes and show impaired proliferation and myotube formation. Biochemical Pharmacology 2021; 190: 114649.
Bundscherer A, Malsy M, Lange R, Hofmann P, Metterlein T, Graf BM et al. Cell Harvesting Method Influences Results of Apoptosis Analysis by Annexin V Staining. Anticancer Research 2013; 33: 3201–3204.
Silva JYG da, Rodrigues PAS, Holanda MO, Silva BB da, Lima CLS, Lira SM et al. Hypolipidemic and reduced nitrergic effects of p-hydroxycinnamic diesters extracted from Copernicia prunifera in mice challenged by a high-fat diet. Biomed Pharmacother 2021; 142: 111930.
Laslett LJ, Alagona P, Clark BA, Drozda JP, Saldivar F, Wilson SR et al. The Worldwide Environment of Cardiovascular Disease: Prevalence, Diagnosis, Therapy, and Policy Issues: A Report From the American College of Cardiology. Journal of the American College of Cardiology 2012; 60: S1–S49.
Blais JE, Wei Y, Yap KKW, Alwafi H, Ma T-T, Brauer R et al. Trends in lipid-modifying agent use in 83 countries. Atherosclerosis 2021; 328: 44–51.
Pencina MJ, Navar-Boggan AM, D’Agostino RB, Williams K, Neely B, Sniderman AD et al. Application of New Cholesterol Guidelines to a Population-Based Sample. N Engl J Med 2014; 370: 1422–1431.
Jarrah MI, Ababneh MJ, Tawalbeh LI, Hammoudeh AJ, Barukba HM, Othman A. Statin eligibility based on the ACC/AHA guidelines among Middle Eastern patients with diabetes mellitus presenting with acute myocardial infarction. Ann Med Surg (Lond) 2020; 61: 148–154.
Davignon J. Beneficial Cardiovascular Pleiotropic Effects of Statins. Circulation 2004; 109: III–39.
Tomaszewski M, Stępień KM, Tomaszewska J, Czuczwar SJ. Statin-induced myopathies. Pharmacol Rep 2011; 63: 859–866.
Gluba-Brzozka A, Franczyk B, Toth PP, Rysz J, Banach M. Molecular mechanisms of statin intolerance. Arch Med Sci 2016; 12: 645–658.
Lepor NE, Kereiakes DJ. The PCSK9 Inhibitors: A Novel Therapeutic Target Enters Clinical Practice. Am Health Drug Benefits 2015; 8: 483–489.
Kosmas CE, Skavdis A, Sourlas A, Papakonstantinou EJ, Peña Genao E, Echavarria Uceta R et al. Safety and Tolerability of PCSK9 Inhibitors: Current Insights. Clin Pharmacol 2020; 12: 191–202.
Yu Q, Chen Y, Xu C-B. Statins and New-Onset Diabetes Mellitus: LDL Receptor May Provide a Key Link. Front Pharmacol 2017; 8: 372.
Davies JT, Delfino SF, Feinberg CE, Johnson MF, Nappi VL, Olinger JT et al. Current and Emerging Uses of Statins in Clinical Therapeutics: A Review. Lipid insights 2016; 9: 13.
Turner RM, Pirmohamed M. Statin-Related Myotoxicity: A Comprehensive Review of Pharmacokinetic, Pharmacogenomic and Muscle Components. Journal of Clinical Medicine 2020; 9: 22.
Veilleux A, Di Marzo V, Silvestri C. The Expanded Endocannabinoid System/Endocannabinoidome as a Potential Target for Treating Diabetes Mellitus. Curr Diab Rep 2019; 19: 117.
Esposito I, Proto MC, Gazzerro P, Laezza C, Miele C, Alberobello AT et al. The cannabinoid CB1 receptor antagonist rimonabant stimulates 2-deoxyglucose uptake in skeletal muscle cells by regulating the expression of phosphatidylinositol-3-kinase. Mol Pharmacol 2008; 74: 1678–1686.
González-Mariscal I, Montoro RA, O’Connell JF, Kim Y, Gonzalez-Freire M, Liu Q-R et al. Muscle cannabinoid 1 receptor regulates Il-6 and myostatin expression, governing physical performance and whole-body metabolism. FASEB J 2019; 33: 5850–5863.
Mendizabal-Zubiaga J, Melser S, Bénard G, Ramos A, Reguero L, Arrabal S et al. Cannabinoid CB1 Receptors Are Localized in Striated Muscle Mitochondria and Regulate Mitochondrial Respiration. Frontiers in Physiology 2016; 7.https://www.frontiersin.org/article/10.3389/fphys.2016.00476 (accessed 10 May2022).
Trapani L, Melli L, Segatto M, Trezza V, Campolongo P, Jozwiak A et al. Effects of myosin heavy chain (MHC) plasticity induced by HMGCoA-reductase inhibition on skeletal muscle functions. FASEB J 2011; 25: 4037–4047.
Chung HR, Vakil M, Munroe M, Parikh A, Meador BM, Wu PT et al. The Impact of Exercise on Statin-Associated Skeletal Muscle Myopathy. PLOS ONE 2016; 11: e0168065.
Yin H, Price F, Rudnicki MA. Satellite Cells and the Muscle Stem Cell Niche. Physiol Rev 2013; 93: 23–67.
Demonbreun AR, Biersmith BH, McNally EM. Membrane fusion in muscle development and repair. Semin Cell Dev Biol 2015; 45: 48–56.
Patel PN, Pathak R. Rimonabant: a novel selective cannabinoid-1 receptor antagonist for treatment of obesity. Am J Health Syst Pharm 2007; 64: 481–489.
Panza E, De Cicco P, Armogida C, Scognamiglio G, Gigantino V, Botti G et al. Role of the cystathionine γ lyase/hydrogen sulfide pathway in human melanoma progression. Pigment Cell Melanoma Res 2015; 28: 61–72.
Matias I, Gonthier M-P, Orlando P, Martiadis V, De Petrocellis L, Cervino C et al. Regulation, function, and dysregulation of endocannabinoids in models of adipose and beta-pancreatic cells and in obesity and hyperglycemia. J Clin Endocrinol Metab 2006; 91: 3171–3180.
Curtis MJ, Bond RA, Spina D, Ahluwalia A, Alexander SPA, Giembycz MA et al. Experimental design and analysis and their reporting: new guidance for publication in BJP. Br J Pharmacol 2015; 172: 3461–3471.

(Not answered)

SupplFigures.pdf
Supplementary figure 1: Effect of simvastatin on ECS activity in C2C12 myotubes. Bar graph with individual points showing the levels of AEA and 2-AG (A) and the expression levels of Cb1 mRNA (B) in C2C12 myotubes exposed to simvastatin 30 µM for 24 h. Each bar is the mean ± S.E.M. from five independent biological samples. * = p≤0.05; ** = p≤0.01; versus the indicated experimental group. Supplementary figure 2: Cell viability measured in C2C12 myoblasts exposed to simvastatin in the presence of GAT211. Measurement of cell viability using MTT assay in myoblasts exposed to simvastatin (30 µM) for 24h in the presence or absence of the selective CB1 positive allosteric modulator (PAM), GAT211. Each bar is the mean ± S.E.M. from five independent biological samples. **** = p≤0.001; *** = p≤0.001; ** = p≤0.07 between the indicated experimental groups. Supplementary figure 3: Measurement of muscle strength in C57BL/6 mice treated with simvastatin. Muscle strength was measured in control and mdx mice treated for 3 weeks with simvastatin (20 mg kg⁻¹/daily/oral gavage) using the weight test. The bar chart shows the latency to drop the weight. Each bar is the mean ± S.E.M. from five independent biological samples. * = p≤0.05 versus the indicated experimental group

Download PDF

Journal Publication

published 23 Aug, 2023

Read the published version in Cell Death & Disease →

Editorial decision: revise
19 Jan, 2023
Review #1 received at journal
03 Jan, 2023
Reviewer #1 agreed at journal
16 Dec, 2022
Reviewers invited by journal
15 Dec, 2022
Submission checks completed at journal
01 Dec, 2022
First submitted to journal
30 Nov, 2022
Unknown event
30 Nov, 2022
Editor assigned by journal
30 Nov, 2022

You are reading this latest preprint version

MicroRNA-mediated repression of endocannabinoid CB1 receptor expression contributes to simvastatin-induced skeletal muscle toxicity

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Simvastatin causes alteration of the ECS activity in C2C12 cells

Pharmacological blockade of CB1 receptors worsens simvastatin toxicity in C2C12 cells

Simvastatin Causes A Mirna-mediated Suppression Of Cb1 Gene Expression In C2c12 Myoblasts

Antagomir-152 Prevents Simvastatin-induced Cytotoxicity By Rescuing Cb1 Expression In C2c12 Cells

Simvastatin Causes Alterations Of Ecs Signaling In The Skeletal Muscle Of C57bl/6j Mice

Simvastatin Causes A Mirna-mediated Dysregulation Of Cb1 Expression In Primary Human Myoblasts

Discussion

Materials And Methods

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1