2.1 Materials
Propranolol was obtained from MedChemExpress of Chian(https://www.medchemexpress.cn/). AZD5363 (CAS No: 1143532-39-1) and N-Oleoyl glycine (CAS No: 2601-90-3) were purchased from MedChem Express. CCK-8 was obtained from Beijing Zhijie Fangyuan Technology Co., Ltd., and Trizol reagent was purchased from Beijing Ovia Biological Company. Takara Reverse Transcription Kit (Code No. RR047A) was purchased from Dalian Bao Biotakara-Baori Biotech (Beijing). AKT antibody, caspase-3 antibody, and β-actin antibody were purchased from Cell Signaling Technology, USA. BCA protein concentration determination kit was obtained from Beijing Soleibao Technology Co., Ltd.
2.1 Methods
2.1.1 Cell culture and proliferation
The human ovarian cancer cell SKVO-3 obtained from Xiangya Medical College of South Chian University was cultured in RPMI 1640 medium (containing 100 U/mL penicillin, 100 µg/mL streptomycin) containing 10% fetal bovine serum in an incubator (37°C, 5% CO2). Cells (1 x 105 cells/mL) in the logarithmic growth phase were placed in a 96-well plate (200 µL/well) and allowed to adhere. The cells were treated with propranolol (final concentration of 25, 50, 100, 200, and 400 µM) and cultured for 0, 24, 48, and 72 h. Five replicates were set up for each concentration with normal untreated cells used as control and the same volume of RPMI 1640 medium used as the blank. CCK-8 reagent (10 µl/well) was added to the wells 2 h before the end of the experiment. The absorbance (A) was measured at 450 nm on a microplate reader and the cell proliferation was calculated as (A experiment-A blank)/(A control-A blank).
2.1.2 Apoptosis
The SKOV-3 cells were seeded onto sterile cover glasses in a six-well plate and cultured overnight to 50–80% confluence. The cells were treated with 0, 50, and 100µM propranolol for 24 h. The culture medium was aspirated before adding fixative (0.5 mL) for 10 min. The fixative was removed and the cells were washed twice with PBS or 0.9% NaCl, 3 min each time. All the liquid was aspirated before adding 0.5 mL Hoechst 33258 dye for 5 min, then washed twice with PBS, 3 min each time. The slides were mounted and covered with a coverslip for observation under a fluorescence microscope.
2.1.3 Hoechst staining
Hoechst 33258 purchased from MedChemExpress. Prepare 0.5–10 with PBS µ G/mL Hoechst 33258 dye solution. Add SKOV3 cells to the 6-well plate when it reaches 70–80%, and add different concentrations of propranolol for 24, 48, and 72 hours. A), Add an appropriate amount of Hoechst 33258 staining solution into the cell culture, about 1/10 of the volume of cell culture medium, and the sample to be stained must be fully covered. Generally, 1 mL dye solution shall be added to the 6-well plate. B), The cells were cultured at 37 ℃ for 10–20 minutes. C), The cells were washed twice with PBS or suitable buffer. D) Observe directly under fluorescence microscope or observe under fluorescence microscope after sealing film.
2.1.3 Real-time PCR to quantify BCL-2, BAX, and AKT mRNA expression
Total RNA was extracted by the Trizol method, then reverse transcribed into cDNA using the Takara Reverse Transcription Kit according to the manufacturer’s instructions. The DNA was applied according to the Q-PCR reaction system using the primers shown in Table 1. The fold change in the expression of BCL-2, BAX, and AKT in the experimental group compared to the control group was calculated using the 2−△Ct method.
Table 1
| Gene name | Primer sequence (5'- 3') |
| GAPDH-F | GGAGCGAGATCCCTCCAAAAT |
| GAPDH-R | GGCTGTTGTCATACTTCTCATGG |
| BCL-2-F | GTCTTCGCTGCGGAGATCAT |
| BCL-2-R | CATTCCGATATACGCTGGGAC |
| BAX-F | CATATAACCCCGTCAACGCAG |
| BAX-R | GCAGCCGCCACAAACATAC |
2.1.4 Western blotting to detect caspase-3 and AKT protein expression
SKOV-3 cells were treated with 25, 50, 100, and 200 µM propranolol and PBS (blank control), as well as the AKT inhibitor AZD5363 and AKT activator N-Oleoyl glycine for 24 h. The cells were collected and lysed with total protein lysis working solution (mmol/L Tris buffer, 150 mmol/L sodium chloride, 5 mmol/L E3edd DTA, 1% by volume Triton X-100, 1% by volume sodium deoxycholate, 30 mmol/L disodium hydrogen phosphate, 50 mmol/L fluorinated Sodium, and 1 mmol/L sodium vanadate, 1×protease inhibitor). The proteins were quantified using the BCA method and separated by 10% SDS-PAGE before transfer to nitrocellulose membranes (Millipore). The membranes were blocked for 1 h at room temperature before the incubation with rabbit anti-human caspase-3 and AKT antibodies at a dilution of 1:1000 at 4℃ overnight. β-actin was used as the internal control. The membranes were washed three times with TBST (Tris-HCl and polysorbate buffer), and the horseradish-labeled rabbit anti-goat IgG diluted 1:1000 was added, incubated at room temperature for 2 h, and the membrane was washed three times. The protein nads were visualized using ECL luminescent liquid. Image J tool cuts target protein and β-actin.
2.1.5 Statistical analysis
SPSS 19.0 statistical software was used for data analysis and data were expressed as mean ± SD. The comparison between two groups was performed by t-test, between multiple groups by one-way analysis of variance, and the LSD t-test performed a pairwise comparison between groups.