Genetic diversity and population structure analysis of Paris polyphylla Sm revealed by SSR marker

doi:10.21203/rs.3.rs-2338068/v1

Download PDF

Research Article

Genetic diversity and population structure analysis of Paris polyphylla Sm revealed by SSR marker

https://doi.org/10.21203/rs.3.rs-2338068/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 18 Jul, 2023

Read the published version in Heliyon →

Version 1

posted

You are reading this latest preprint version

Paris polyphylla is a threatened medicinal plant with numerous pharmacological effects including prized anticancer phytochemicals. In the present study, the genetic diversity, and population structure of 32 P. polyphylla germplasm collected from natural habitats of three ecological regions Central, Eastern, and Western Nepal was performed using 15 simple sequence repeat (SSR) markers. The polymorphic information content (PIC) value of the SSR marker ranged from 0 to 0.75. The value of the average observed heterozygosity (Ho = 0.63) is greater than the expected heterozygosity (He = 0.53) with average total heterozygosity (Ht = 0.32). The molecular variance analysis (AMOVA) revealed high genetic variation within the population (74%) than low genetic variance (26%) among populations. The value of Fst and gene flow were 0.53 and 0.458, respectively. In STRUCTURE analysis 32 germplasm were separated into two populations where Eastern accessions were separated far from Central and western accessions which were also in complete correspondence to the unweighted pair group method based on arithmetic average (UPGMA) phylogenetic tree and principle coordinate (PCoA) analysis. Further, in the UPGMA and PCoA, accessions collected from the same or relatively similar geographic origin were closer. These genetic results are of great significance for scientifically formulating conservation strategies and commercial cultivation for the medicinally important Vernalable plant P. polyphylla.

Paris polyphylla

SSR marker

genetic variation

conservation

population structure

Paris polyphylla Smith (Love Apple), commonly called Satuwa in Nepal, is an important medicinal herb of temperate forest belonging to the family Melanthiaceae, and native to China, the Indian subcontinent, and the Indochina region (Chauhan, 2020; Gupta et al. 2022; Hara 1969; Kunwar et al. 2020) This plant is assessed for the IUCN Red List of Threatened Species in 2020 and listed as Vulnerable by IUCN and CAMP (IUCN 2004, CAMP 2001 (Chauhan 2020; KC et al. 1970). In Nepal, this plant is mainly distributed in an altitudinal range of 1500–4500 m above sea level from east to west Nepal between 27^◦-30.18^◦ N Latitude and 80.7^◦-88^◦ E Longitude (KC et al. 1970; Kunwar et al. 2020; Chapagain 2014). P. polyphylla grow in moist and shady places (such as under deciduous trees). of forests, bamboo forests, thickets, grassy or rocky slopes, and stream sides. It has a single unbranched stem and 2–3 whorls of leaves are present on the nodes. It flowers during the month of April-May, and the fruit become matured during the month of September-October. It has odd flowers with long yellow radiating anthers and has a rhizome. One healthy fruit contains approximately 30 seeds. The morphological characteristics of the herb are given in Fig. 2.

Secondary metabolites such as daucosterol, polyphyllin D, β -ecdysterone, Paris saponins I, II, V, VI, VII, H, dioscin, oligosaccharides, pentasaccharide, octasaccharide, trigofoenoside A, protogracillin, Paris yunnanosides G-J, padelaoside B, pinnatasterone, formosanin C and 20-hydroxyecdyson saponins have been isolated from P. polyphylla (Negi et al. 2014; Thapa et al. 2022). The Rhizome is the main economic part and has widely used in traditional and modern medicines for its various medicinal properties including anticancerous, antitumor, cytotoxic, anthelmintic, antimicrobial, antiangiogenic, immunostimulating, contractile and hemostatic, anti-inflammatory, wound healing, immune enhancer, and herbal preparations (Gupta et al. 2021; Thapa et al. 2022). The species with a thick rhizome (“medicinal Paris”) has been used as a medicinal herb for more than 2000 years in China and more than 40 commercial drugs and health products have been developed in China using the rhizomes of “medicinal Paris” as raw materials. The Chinese e-commerce platform 'alibaba.com', for example, lists about 97 P. polyphylla items offered by 46 Asian suppliers, of which 21 are situated on the Chinese mainland, 12 in Nepal, 7 in India, 2 in Pakistan, and 1 each in Bhutan, Hong Kong, Thailand, and Vietnam, products offered include the crude drug (dried whole or cut rhizomes) (Cunningham et al. 2018).

The world health organization (WHO) has highlighted the importance of traditional indigenous medicines since a large majority of rural people in developing countries still rely on these medicines as the first protection in healthcare (Goleniowski et al. 2006). With the resurgence of interest in natural or plant-based products, local, national and international demand for medicinal plant products and phytochemicals is consistently increasing (Lubbe and Verpoorte 2011; Pant 2014). The crude or dried plant parts of many medicinal plants of Nepal, including P. polyphylla are hence sourced mainly from the wild and traded illegally in national as well as international markets mainly to India and China through various ways (Kunwar et al. 2020; Rai and Chapagain 2014; Schippmann et al. 2006). The commercial trade of wild alpine medicinal plants like P. polyphylla played an important role in the rural livelihood, contributing on average 12% of annual household income, which is the main source of income of rular people (Kunwar et al. 2021; Shrestha et al. 2022; Olsen and Overgaard Larsen 2003). The trend of unmanaged and excessive injudicious harvesting (unscientific use, illegal/cross-border trade of rhizomes) of this plant has rapidly increased which is coupled with habitat destruction and a decreased natural population of the herb, as a consequence, this species comes under the vulnerable category (Rai and Chapagain, 2014; Negi et al. 2014).

Genetic diversity, also known as genetic variability, is the diversity of genetic characteristics between individuals and populations of the same species, the extent of which depends on the variation in the nucleotide sequences caused by mutation, genetic drift, gene flow, and natural selection (Oliya et al. 2018; Rao and Hodgkin, 2002). Genetic polymorphism varies among species and within genomes and has important implications for the evolution and conservation of species (Ellegren and Galtier, 2016). The genetic diversity of a species is shaped by processes that act on widely different spatial and temporal scales and assessing genetic variation provides basic parameters to any species for conservation plans, sustainable exploitation, and utilization. Genetic diversity can be studied using DNA-, morphological-, and chemical marker, however, DNA-marker provides more reliable information as they are not affected by environmental factors (Barrett, 1991; Oliya et al.2018). Various reports used DNA-based molecular markers to study the genetic diversity and genetic structure of P. polyphylla and its related species inside and outside the region (He tal al. 2007; Feng et al. 2020; Wang et al. 2016; Zhao et al. 2020; Zheng et al. 2012). Zhang et al. 2004 reported the genetic diversity of P. polyphylla var. yunnanensis from Yunnan, Guangxi, and Vietnam using a random amplified polymorphic DNA marker (RAPD) molecular marker. He et al. 2007 used an inter-simple sequence repeat (ISSR) marker to study the genetic diversity of P. polyphylla var yunnanensis of Sichuan and Yunnan Province. Zhao et al. (2020) used codon-targeted (SCoT) polymorphism markers and Sequence-related amplified polymorphism (SRAP) markers molecular markers to study the genetic relationships among Paris polyphylla resources in the Dabie Mountains. Zheng et al. 2012 used microsatellite loci to study the genetic diversity of P. polyphylla var. chinensis of the south of Anhui Province, China. Wang et al. (2016) developed new EST-SSR markers from root transcriptome and used newly developed expressed sequence tag-derived simple sequence repeat markers (EST-SSRs) to study the genetic diversity of P. polyphylla that were collected from Kunming City, Yunnan Province, China. Recently, Gao et al. 2022 developed EST-SSR markers related to polyphyllin backbone biosynthesis and utilized them to study the genetic diversity of P. polyphylla var. yunnanensis Yunnan Province, Southwest China. The SSR markers revealed higher heterozygosity, provide highly reproducible amplicons, and thus can be attributed to the detection of high polymorphism which makes them the most preferred DNA marker compared to other molecular markers (Das Gupta et al. 2022; Oliya et al 2021; Nachimuthu et al. 2015; Oliya et al. 2018).

Many previous studies have been conducted to access the ecological and traditional knowledge of P. polyphylla and mentioned the habitat decline, habitat shifts, and risk of extension of this species in long run from the Nepal Himalaya and highlighted the conservation need for this plant in Nepal (Chauhan 2021; K.C. et al. 1970; Kunwar et al. 2015, 2021; Kunwar, et al. 2020; Rana et al. 2020; Shrestha et al. 2022). However, they have not explored the genetic aspects, which is very important. Therefore, the main objective of this study is to analyze the population genetic diversity and structure of Nepali Paris polyphylla germplasm at the molecular level using SSR markers.

Sample collection and sample size

In this study, young healthy leaf samples of a total of 32 Paris polyphylla germplasms were collected (during April-July) from nine different locations (natural habitat) of three ecological ranges-Central, Eastern and Western Nepal. The plant was identified by taxonomist, and also by comparing the herbarium specimen of National herbarium and Plant laboratories (KATH) (Kath.gov.np) and eflora.org (Annotated Checklist of the flowering plant of Nepal, Taxon ID: 200027820). The photograph of the sampled plant species with its vegetative, underground, and fruit parts is given in Fig. 2. The leaf of single germplasm was collected in a zip lock poly bag separately and properly tagged. Based on the distribution of P. polyphylla in the natural habitat, three to eight germplasm from each collection site were made. However, due to failure in DNA isolation and DNA degradation, all the collected samples from all district could not include in the analysis. Therefore for the SSR genotyping total of 17 germplasms covering 3, 2, 4, and 8 of Lamjung, Gorkha, Kaski, and Manang districts, respectively of Western Nepal, a total of 9 germplasm including one each of Sindhupalchowk, and Ramechhap, two each of Rasuwa, Nuwakot and Dolakha districts of Central Nepal and six germplasms of Thumke, Illam, Eastern Nepal were used. The sampling map was drawn using Arc GIS (Fig. 1, Supplementary Table 1). The collected leaf sample was wrapped in aluminum foil, and stored in liquid nitrogen at a -40 deep freezer before DNA isolation.

DNA isolation

Genomic DNA was isolated using the CTAB method (Doyle 1991) with some modifications. Briefly, 0.2 g of leaves were extracted in liquid nitrogen. To the fine powder, 1ml of CTAB buffer was added and made a fine paste in the mortar and pestle. Then, the pest was homogenized in the vortex at 130 rpm for 5 min (Labnet Vortemp 56) and incubated in the water bath (Memmort) at 65^oC for 45 min The tubes were gently mixed during the incubation period in each 10 m interval. After 45 min tubes were taken out from the water bath and left to cool for 5 min. at room temperature, and then centrifuged at 12000 rpm for 8 min (Mikro 22R). Then, 800 µl of the supernatant was pipette out and poured into the new 2 µl Eppendorf tube. Then an equal volume of Chloroform (24): isoamyl alcohol (1) was added and mixed gently in Labnet Vortemp 56 at 27 rpm for 15–20 min. Then, tubes were again centrifuged at 13000 rpm for 5 min. The upper aqueous part (600 µl) is carefully transferred to the new 1.5 ml Eppendorf tube, and to this, 1/10 volume of 3M sodium acetate was added followed by ice-cold absolute alcohol. It was gently mixed and centrifuged at 13000 rpm for 2 min. After that, the upper part is discarded and to the lower precipitate, DNA was purified by washing with 70% ice-cold ethanol and centrifuged for 1 min. Finally, upper ethanol is discarded, and the DNA is air dried and stored in 200 µl of 1X TE buffer at -20 ^oC until PCR amplification.

PCR amplification

For the PCR amplification, a total of 21 SSR primers were used. Among them, nine EST-SSR primer sequences (SSRPP1, SSRPP-2, PP-1 to PP-7) were obtained from the previous study of (Wang et al. 2016), which was developed from root transcriptomic analysis of Paris Polyphylla var. yunnanensis (SSR-A), and 12 SSR primers that were developed from a (CT)n-enriched genomic library of P. polyphylla var. chinensis (SSR-B) and used for genetic diversity study in the Anhui Province China (Zheng et al. 2012) were used, however, due to failure in PCR amplification and low quality of amplified band only 15 SSR primers (eight of SSR-A and 7 of SSR-B, that provided very clear and reproducible amplicon size were used for genetic diversity and structure analysis.

PCR amplification was performed on a final volume of 25 µl containing 30 ng of genomic DNA, 2X PCR master mix with dye (included 1× PCR buffer, 160 µM of each of the dNTPs, 0.8 U of Taq DNA polymerase, and 6X loading dye (MedChem express, USA) and 0.5 µM each primer. The thermal cycling condition was carried out in a (LongGene, MG96+, UK) programmed at 95°C for 5 min followed by 35 cycles of denaturing at 94°C for 30 s, annealing at 55°C for 1m, extension at 72°C for 2 m, and then a final extension at 72°C for 10 min. To test the utility of the primers, PCR products were detected on 2% agarose gels and visualized by staining with ethidium bromide (1mg/ml) under the bio-gel documentation system (CLIN, China). Only the clear and reproducible amplicon was considered for analysis. The Binary data were scored manually in the form of 0 (for the band absent), and 1 for the band present, considering the very clear and reproducible amplicon in the agarose gel image.

Genetic diversity analysis

Genetic diversity parameters were calculated for each marker and each population using POPGENE version 1.32 (Yeh et al. 1999), including N, the effective number of alleles (Ne), Shannon’s information index (I), observed heterozygosity (Ho), expected heterozygosity (He), total heterozygosity (Ht), Nei’s expected heterozygosity (Nei), and Nei’s genetic distance. The resulting Nei’s genetic distance matrix was used to construct an unweighted pair group method with an arithmetic mean (UPGMA) phylogenetic tree (Sokal and Michener 1958) with 1000 bootstrap replications, which was drawn using the MEGA 11.0 program (Tamura et al. 2013). Similarly, Nei’s genetic distance matrix was used for principal coordinate analysis (PCoA) using GenAlEx 6.5 (Peakall and Smouse 2012) to show the pattern of genetic differentiation. To assess the percentage distribution of genetic variation and fixation index (FST) among and within provinces, a hierarchical analysis of molecular variance (AMOVA) was performed using GenAlEx 6.5 software (Peakall and Smouse 2012).

Population structure analysis

To identify the distribution of populations, a Bayesian clustering method was implemented to deduce population structure using STRUCTURE 2.3.4 software (Pritchard et al. 2000). The admixture model with correlated allele frequencies was used as suggested in the manual. The estimated number of populations (K) was set from 1 to 15, with a 100000 step burning and 500,000 Markov Chain Monte Carlo iterations. This process was repeated 20 times for each K. The probability values were averaged across runs for each cluster. This procedure clusters individuals in populations and estimates the proportion of membership in each population for each individual (Pritchard et al. 2000). The optimal K value was determined using log-likelihood [LnP (D)] based on the rate of change in LnP (D) between successive Ks and the ΔK method (Evanno et al. 2005), using the web-based software STRUCTURE HARVESTER version 0.6.92 (Earl and Vonholdt 2012).

Genetic diversity analysis for SSR primers

Among the 15 SSR primers used, 86.67% primers were polymorphic. A total of 60 number of allele ranging from 50 bp (SSRPP-1, PP-1, PP-2)- to 900 bp (PP-24) were amplified. The maximum number of alleles (total 7) was amplified by primer PP-25 whereas, primer PP-6 and PP-7 amplified the minimum number of alleles (1). PIC value is usually grouped into high (PIC > 0.5), moderate (0.5 > PIC > 0.25), and low (PIC < 0.25) categories and is often used to assess the informativeness level of markers developed (Botstein et al. 1980; Oliya et al. 2018; Wang et al. 2016). The PIC value ranged from 0 (PP-5, and PP-6) to 0.75 (PP-24) with an average value of 0.46. A total of 12 primers have PIC greater than 0.5 and were found to be highly effective, and the other three primers, namely PP-4, PP-5, and PP-6, with PIC less than 0.25, are less effective for the genetic diversity study of P. polyphylla germplasms in this study (Table 1).

Table 1

Primer name, forward and reverse sequence, amplification size, and the PIC value of 15 SSR primers used in 32 *paris polyphylla* germplasms
SN	Primer name	Foreard seq (5’ to 3’)	Reverse Seq (5’ to 3’)	PIC	Size of amplicons (bp)
1	SSRPP1	AGATACTGGCCGGAAGGAGT	GCTTCAGCATTCCACTCCAG	0.53	50–200
2	pp1	AAAGTTCGCCTCCCTTTCTC	CCATTACCTGAGGCCTGAAA	0.50	50–150
3	pp2	GCTGCGATGCAAAACCTTAT	GGCAACCACCACCCTACTAA	0.59	50–300
4	pp3	CCTTTGTAGCATGGGTGGTT	GACAATTGCTCCGACTCAAAA	0.50	50–170
5	pp4	GTATCGACGGTCGCGATTAT	AGCAGGAGATTGAACCCTCA	0.14	120–450
6	pp5	CATTAGCCGAGAAAGGCTTG	ACTGGAGCCTCGATCACAAT	0.00	200
7	pp6	GGAGGAAGACGATGATCGAA	GCCATGTGCAGTCTCTCAAA	0.00	150
8	pp7	CCTCCATCACCACCTAAACC	AACTGAAGGTGGGGTCAGTG	0.50	100–200
9	pp19	TTCTTTCAACCGCCATACCGT	TGCTTTGCTGCTTCTAACTCG	0.54	50–500
10	pp20	AATACTCCGACGGGTGTTG	AGCGATAGCCAGAGGAAAGG	0.50	100–500
11	PP21	CGCCATTAGGACAGGGATTCAC	TCTACTTTGCTGCGGCTCCAC	0.65	100–300
12	PP22	ACCGTCATTTAGTTGGTGCGAG	TGTGAACGCCTTGGAACCCT	0.52	100–300
13	PP23	GTGAGAAAACAACATGAAAGA	ACATCCCAGTATGACAGACG	0.50	100–150
14	PP24	GACGATGAGTTCACGACGCTG	GTGTTTCGCTCACCAAGGACG	0.75	200–900
15	pp25	AGCCTGATCGGTATTGTCGG	CCACGCCCTTTCCTTCTTTA	0.69	100–700
				0.46

The observed number of alleles is greater than the expected number of alleles in all loci. The observed heterozygosity was greater than the expected heterozygosity in all the loci except PP-6 and PP-7. The value of observed heterozygosity ranged from 0 (PP-6) to 0.97 (PP-21), with an average value of 0.63. Similarly, the expected heterozygosity value ranged from 0.0 (PP-6) to 0.81 (PP-24) with an average value of 0.53. The value of total heterozygosity ranged from 0 (PP-6) to 0.48 (PP-21, PP-23), with an average value of 0.32. Similarly, the Shannon information index ranged from 0.16 (PP-4) to 1.79 (PP-24) with an average value of 0.92, and Nei ranged from 0.06 (PP-4) to 0.80 (PP-24) with an average value of 0.52, and the coefficient hierarchical Fst, estimated according to Wright, ranged from 0.18 (PP-2, PP-3, PP-23) to 0.76 (PP-5) with an average value of 0.41. likewise, the value of gene flow detected in each locus across 32 germplasms ranged from 0 (PP-6) to 1.16 (PP-23), with an average of 0.58. The probability for the Chi-square test of the Hardy-Weinberg equilibrium value ranged from 0.0000 to 0.09994 across the primer (Table 2).

Table 2

Genetic diversity indices of 15 SSR primers in 32 *paris polyphylla* germplasms
Primer name	na*	ne*	Ho	He	I*	Ht	Nei	Fst	Nm	HWEP
SSRPP1	4.00	2.50	0.72	0.61	1.09	0.36	0.60	0.40	0.37	0.003155
pp1	3.00	1.98	0.81	0.50	0.74	0.41	0.49	0.18	1.15	0.000610
pp2	5.00	3.09	0.59	0.69	1.25	0.30	0.68	0.56	0.20	0.000295
pp3	2.00	1.91	0.78	0.48	0.67	0.39	0.48	0.18	1.14	0.000577
pp4	3.00	1.07	0.06	0.06	0.16	0.03	0.06	0.49	0.26	0.000396
pp5	3.00	1.47	0.16	0.33	0.61	0.08	0.32	0.76	0.08	0.999444
pp6	2.00	1.44	0.00	0.31	0.48	0.00	0.30	1.00	0.00	0.000000
pp7	4.00	2.08	0.88	0.53	0.82	0.44	0.52	0.16	1.36	0.000000
pp19	3.00	1.98	0.75	0.50	0.74	0.38	0.49	0.24	0.78	0.004895
pp20	3.00	2.05	0.53	0.52	0.76	0.27	0.51	0.48	0.27	0.025094
PP21	5.00	3.58	0.97	0.73	1.42	0.48	0.72	0.33	0.51	0.750158
PP22	3.00	1.98	0.78	0.50	0.74	0.39	0.49	0.21	0.94	0.000010
PP23	3.00	2.43	0.97	0.60	0.96	0.48	0.59	0.18	1.16	0.004407
PP24	9.00	5.04	0.84	0.81	1.79	0.42	0.80	0.47	0.28	0.000001
pp25	8.00	3.51	0.63	0.73	1.55	0.31	0.71	0.56	0.19	0.000000
Average	4.00	2.41	0.63	0.53	0.92	0.32	0.52	0.41	0.58

Genetic differentiation and structuring

AMOVA analysis

AMOVA was performed against the accessions by three provinces. Variation among the population was 26% and among an individual was 74% (Fig. 3). The value for fixation index (Fst), and gene flow were 0.353 and 0.458, respectively. These values were highly significant at P < 0.048, as indicated by the randomization test. Gene flow, also called gene migration, is the transfer of genetic material from one population to another. In this study, the gene flow value among provinces was 0.458 (Table 3). Gene flow within a population can increase the genetic variation of the population, whereas gene flow between genetically distant populations can reduce the genetic difference between the populations.

Table 3

Analysis of molecular variance (of 32 *Paris polyphylla* germplasm by provinces)
Source	Degree of freedom	Sum of square	Mean square	Estimated Variation	Variation %	Fst*	p value	Nm
Among Pops	2	68.251	34.125	1.691	26%	0.353	< 0.001	0.458
Among Indiv	29	42.343	1.460	0.000	0%
Within populations	32	151.500	4.734	4.734	74%
Total	51	173.481		5.281	100%
Fis= -0.529, Fit = 0.011
Fst: pairwise Fst, Nm: gene flow (calculated by (Nm) = [(1/FST) − 1]/4), .f. - degrees of freedom. :Significance tests after 1,000 permutations.

STRUCTURE analysis

Using STRUCTURE program, SSR genotyped data were used to perform the population structure analysis for 32 germplasms under an admixture model. The most likely number of clusters (K) was inferred by the peak ΔK found in the STRUCTURE analysis. According to the method of (Evanno et al., 2005), the highest peak in ΔK revealed the best value for K = 2, which indicates the presence of two different populations (Fig. 4). The cluster indicated by green consists of 8 germplasms collected from Illam, Eastern Nepal (EN), and the cluster indicated by red consists of the rest of the 26 accessions collected from Central- and Western Nepal (CWN).

UPGMA phylogenetic tree

The Nei’s genetic distance data obtained from SSR genotyping were applied to construct the UPGMA phylogenetic tree, where 32 germplasm were separated into two major groups, CL-I and CL-II (Fig. 4). CL-I includes all germplasms collected from Western and Central Nepal, which is in complete correspondence to CWN in STRUCTURE analysis. In this cluster, six sub-clusters (CL-I1-CLI-6) have been observed. In CL-I1 five germplasm that was collected from Lamjung and Gorkha were grouped. Seven germplasms that were collected from Manang were together in CL-I2; similarly, CL-I-3 included three germplasms each of Dolakha, Manang, and Rasuwa, in admixture. In CL-I4, a total of five germplasms, including two of Sindhupalchowk, and one each of Rasuwa, Ramechhap, and Gorkha, were together. Three germplasms belongings to Dolakha, Nuwakot, and Rasuwa were included in CL-I5. All the accessions of Kaski were grouped in CL-I6. In CL-II all the accessions that were collected from Illam, Eastern Nepal were together, which showed complete correspondence to EN in STRUCTURE analysis (Fig. 4). The distribution of accessions in the UPGMA tree is in complete correspondence to STRUCTURE analysis (Fig. 3)

PCoA analysis

In the PCoA analysis, the percentages of variation explained by the first three axes (1, 2, and 3) were 57.98, 9.70, and 8.22, respectively. Their respective cumulative percentage of variance are 57.98,67.68 and 75.90. In the PCoA bi-plot (Fig. 6). In this analysis, all the accessions of Eastern Nepal were separated to the right of the biplot (EN) and the accessions of Eastern and Western Nepal were separated on the left of the bi-plot (CWN) The distribution of accessions in PCoA showed complete correspondence with STRUCTURE analysis (Fig. 3) and UPGMA (Fig. 5) phylogenetic tree.

The increasing interest of pharmaceutical companies and local people in plant-based medicine, illegal and unscientific harvesting, genetic chief caused by the effects of climate change, forest fire, and many other reasons are causing serious threats to the biodiversity of the highly valued medicinal herb P. polyphylla (He et al. 2007; Kunwar, et al. 2020; Puwein and Thomas 2018; Shrestha et al. 2022). Studies performed on the ecological aspect provide a preliminary insight into habitat distribution, however, can not provide the genetic makeup, genetic structure, and diversity of natural populations. For proper planning for commercial cultivation and conservation, molecular marker-based genetic diversity plays a pivotal role and provides strong evidence, identifying the superior genotype between the individual and providing insights into the evolutionary and demographic history of the taxon.

In the present study, using 15 SSR genotyped data 32 natural germplasm of P. polyphylla collected from different geographic locations of Eastern, Central, and Western regions of Nepal exhibited the average value of observed heterozygosity (Ho = 0.63) greater than the expected heterozygosity (0.53), indicating a relatively high level of genetic diversity in the population. Moreover, the average value of total heterozygosity (H = 0.32), and Shannon's diversity estimation (I = 0.92) revealed in this study were similar to the general trend of average microsatellite heterozygosity found in the species with narrow distribution (Nybom & Bartish, 2000). The genetic diversity of the population is greatly affected by the breeding system, where outcrossing species tend to be more genetically diverse (Nybom and Bartish, 2000; Oliya et al. 2018). Although P. polyphylla, is a self-compatible species and can reproduce selfed seeds, it is an insect-pollinated outcrossing species (Liu et al, 2016; Wang et al, 2016). Moreover, the various climatic conditions such as temperature, humidity, and soil may also be the reason for the variation of the species. A similar result was previously observed in the medicinal plant Nilgirianthus ciliates using ISSR and RAPD primer (Shilpha et al. 2013). Similarly, Huang et al. (2016) highlighted the effect of environmental factors causing the high genetic diversity of Caragana microphylla.

The EST-SSR (1 to 8) used in the present study were developed from root transcriptome by Wang et al. (2016). These primers detected a relatively high level of genetic diversity of P. polyphylla collected from the fields of Kunming City, Yunnan Province, China, which is in line with the present finding. The rest of the 7 SSR primers PP-19 to PP-25 were isolated from a (CT)n-enriched genomic library of P. polyphylla var. chinensis and detected low level (observed heterozygosity 2–3 times less than the value of expected heterozygosity) of genetic diversity in P. polyphylla var. chinensis collected from a natural population in the south of Anhui Province, China (Zheng et al. 2012). The genetic diversity obtained in the present study is greater than reported by Zhao et al. (2020) in 33 samples of P. polyphylla collected from Dabie Mountains using SRAP (H = 0.23, I = 0.37 ) and SCoT (H = 0.29, I = 0.45) primers. Using ISSR primer relatively higher level of genetic diversity of cultivated Paris polyphylla var. yunnanensis than that of a natural population of central and eastern parts of Yunnan Province, China was obtained (He et al. 2007). This variation in the genetic diversity could be accounted to the variation in the primer used, stochastic events such as genetic drift and inbreeding, anthropogenic activities, variation in the sample size, sampling distance, and the geographic origin of the sample (Lee et al. 2018).

AMOVA analysis performed against province data revealed that the majority (74%) of the variation is among individuals and only 26% variation was found among the population. The effective gene flow per generation among provinces is (Nm = 0.458) indicating low gene flow among populations that are effectively homogenizing populations to some extent. Thus, AMOVA supports the results of Nei's genetic statistics and Shannon's diversity estimation that there is a moderate degree of population differentiation in Nepali P. polyphylla collection. In general, this study found the ecological distribution of germplasms in the structure analysis, UPGMA phylogenetic tree, and PCoA analysis. The germplasm collected from Illam, the Eastern part belonging to Province-1 was separated into one cluster and in another cluster admixture of accessions from the Gandaki province and Bagmati province (Central Accessions) have observed. This isolation of Eastern accessions could be accounted for the far geographic distance of Illam than the accessions of Western Nepal ( Gandaki Pradesh) and Central Nepal (Bagmati Pradesh). The admixture of accessions from Central and Western regions could be accounted to the proximity, the collection of plants with similar geography, and the easier possibility of migration of germplasm (Oliya et al. 2018; Rameshkumar et al. 2019). Looking closely at Nei’s genetic distance-based UPGMA phylogenetic tree and PCoA analysis, accessions belonging to particular locations were placed together. This is accounted to the same or moderately similar environment of the collected germplasms (Shilpha et al. 2013) or they may have similar putative genes involved in the biosynthesis of novel therapeutic compounds (Wang et al. 2016; Yang et al. 2019).

In the present study, the genetic diversity and population structure of Paris polyphylla collected from natural habitats belonging to three ecological regions Central, Eastern, and Western Nepal were studied using SSR primers. The natural populations showed a relatively high level of genetic diversity. In the population structure, accessions of eastern Nepal and Central Nepal were separated indicating the impact of climatic and geographic attributes on the genetic diversity of this species. Moreover, the germplasm belonging to a particular geographic origin showed no or low variation in its genetic makeup, suggesting a higher risk of extinction in the long run and the necessity of genetic resource management, and conservation. As this species has proven therapeutic properties, it is very important to utilize this genetic resource as a candidate drug to cure various diseases. Therefore, identification of the phytochemically potent germplasm and commercial cultivation is an urgent need for stopping unscientific harvesting of this plant from its natural habitat. Further studies related to phytochemical characterization, transcriptome analysis, and establishment of a plant tissue culture are highly recommended.

Acknowledgements

Auther are greatful to the International Foundation for Science (IFS), Karlavägen 108, 8th floor SE-115 26 Stockholm, Sweden for providing full grant support (grant no. I-1-F-6438-1).

Conflict of interest

Compliance with ethical standards

All authers of this paper declare that there is no conflict of interest.

Barrett, S. (1991). Genetic and evolutionary consequences of small population size in plants: implications for conservation. Genet Conserv Rare Plants 3-30

Botstein D, White RL, Skolnick M. and Davis R (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 32(3): 314.

Chauhan H K (2020). Paris polyphylla. The IUCN Red List of Threatened Species: e. T175617476A176257430.

Chauhan HK (2021). Love Apple (Paris polyphylla): Biology, Uses and Conservation.

Cunningham AB, Brinckmann JA, Bi YF, Pei SJ, Schippmann U, Luo P (2018). Paris in the spring: A review of the trade, conservation and opportunities in the shift from wild harvest to cultivation of Paris polyphylla (Trilliaceae). J Ethnopharmacol 222: 208–216. https://doi.org/10.1016/j.jep.2018.04.048

Das Gupta D, Paul D, Das SK, Mahanta S, Tag H, Hui PK (2022). Molecular insights into genetic diversity and population dynamics of Paris polyphylla Smith in the Eastern Himalaya, India: a threatened anticancer medicinal herb of broad-spectrum therapeutic importance. Vegetos 1–14.

Doyle J (1991). DNA protocols for plants. In Molecular techniques in taxonomy (pp 283–293) Springer.

Earl DA, Vonholdt BM (2012) STRU CTU RE HARVESTER: a website and program for visualizing STRU CTU RE output and implementing the Evanno method. Conserv Genet Resour 4:359–361

Ellegren H, Galtier N (2016). Determinants of genetic diversity. Nat Rev Genet 17(7): 422–433.

Evanno G, Regnaut S, Goudet J. (2005). Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Moln Ecol 14(8): 2611–2620. https://doi.org/10.1111/j.1365-294X.2005.02553.x

Feng T, Jia Q, Meng X, Chen, X, Wang F, Chai W, Liang Z (2020). Evaluation of genetic diversity and construction of DNA fingerprinting in Polygonatum Mill. based on EST-SSR and SRAP molecular markers. 3 Biotech, 10(7): 1–13. https://doi.org/10.1007/s13205-020-02316-z

Goleniowski ME, Bongiovanni GA, Palacio L, Nuñez, CO, Cantero JJ (2006). Medicinal plants from the “Sierra de Comechingones”, Argentina. J Ethnopharmacol 107(3): 324–341.

Gupta D, Das S, Verma SS, Shekher A, Rai V, Awasthee N, Das TJ, Paul D, Das SK, Tag H (2021). Evaluation of antioxidant, anti-inflammatory and anticancer activities of diosgenin enriched Paris polyphylla rhizome extract of Indian Himalayan landraces. J Ethnopharmacol 270: 113842.

Hara H (1969). Variation in Paris polyphylla Smith, with reference to other Asiatic species. Journal of the Faculty of Science, University of Tokyo, Section 3, 10, 141–180.

He J, Wang H, Li DZ, Chen SF (2007). Genetic diversity of Paris polyphylla var. yunnanensis, a traditional Chinese medicinal herb, detected by ISSR markers. Planta Medica 73(12): 1316–1321. https://doi.org/10.1055/s-2007-981617

Huang W, Zhao X, Zhao X, Li Y, Lian J. (2016). Effects of environmental factors on genetic diversity of Caragana microphylla in Horqin Sandy Land, northeast China. Ecol Evol 6(22): 8256–8266.

KC, M, Phoboo S, Jha PK (1970). Ecological Study of Paris Polyphylla Sm. Ecoprint: An Int J Ecol 17: 87–93. https://doi.org/10.3126/eco.v17i0.4121

Kunwar RM., Acharya RP, Chowdhary CL, Bussmann,RW (2015). Medicinal plant dynamics in indigenous medicines in farwest Nepal. J Ethnopharmacol 163: 210–219. https://doi.org/10.1016/j.jep.2015.01.035

Kunwar RM, Adhikari YP, Sharma HP, Rimal B, Devkota HP, Charmakar S, Acharya RP, Baral K, Ansari AS, Bhattarai R (2020). Distribution, use, trade and conservation of Paris polyphylla Sm. in Nepal. Glob Ecol Conserv 23: e01081.

Kunwar, R. M., Fadiman, M., Thapa, S., Acharya, R. P., Cameron, M., & Bussmann, R. W. (2020). Plant use values and phytosociological indicators: Implications for conservation in the Kailash Sacred Landscape, Nepal. Ecol Indic 108: 105679. https://doi.org/10.1016/j.ecolind.2019.105679

Kunwar RM, Rimal B, Sharma HP, Poudel RC, Pyakurel D, Tiwari A, Magar ST, Karki G, Bhandari GS Pandey P (2021). Distribution and habitat modeling of Dactylorhiza hatagirea (D. Don) Soo, Paris polyphylla Sm. and Taxus species in Nepal Himalaya. J Appl Res Med Aromt Plants 20: 100274.

Lee SR, Choi JE, Lee BY, Yu JN, Lim CE (2018). Genetic diversity and structure of an endangered medicinal herb: implications for conservation. AoB Plants, 10(2): 1–10. https://doi.org/10.1093/aobpla/ply021

Liu T, Li X, Xie S, Wang L, Yang S (2016). RNA-seq analysis of Paris polyphylla var. yunnanensis roots identified candidate genes for saponin synthesis. Plant Diversity 38(3): 163–170. https://doi.org/10.1016/j.pld.2016.05.002

Lubbe A, Verpoorte R. (2011). Cultivation of medicinal and aromatic plants for specialty industrial materials. Ind Crop Prod 34(1): 785–801.

Nachimuthu VV, Muthurajan R, Duraialaguraja S. Sivakami R, Pandian BA, Ponniah G, Gunasekaran K, Swaminathan M, KK S, Sabariappan R (2015). Analysis of population structure and genetic diversity in rice germplasm using SSR markers: an initiative towards association mapping of agronomic traits in Oryza sativa. Rice 8(1): 1–25.

Nybom H, Bartish IV (2000). Effects of life history traits and sampling strategies on genetic diversity estimates obtained with RAPD markers in plants. Perspect Plant Ecol Evol 3(2): 93–114.

Oliya BK, Chand K, Thakuri LS, Baniya MK, Sah AK, Pant B (2021). Assessment of genetic stability of micropropagated plants of Rhynchostylis retusa (L.) using RAPD markers. Sci Hort 281: 110008. https://doi.org/10.1016/j.scienta.2021.110008

Oliya BK, Kim, MY, Ha J Lee SH (2021). Analysis of genetic variability and agronomic performance of Indian lettuce (Lactuca indica L.). Genet Resourc Crop Evol 69 (3):1313-1327 https://doi.org/10.1007/s10722-021-01306-1

Oliya BK, Kim MY, Lee SH (2018). Development of genic-SSR markers and genetic diversity of Indian lettuce (Lactuca indica L.) in South Korea. Genes and Genomics 40(6),:615–623. https://doi.org/10.1007/s13258-018-0660-x

Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using multilocus genotype data. Genetics 155:945–959

Puwein A, Thomas SC (2020). An overview of Paris polyphylla, a highly vulnerable medicinal herb of Eastern Himalayan Region for sustainable exploitation. Nat Prod 10(1): 3–14. https://doi.org/10.2174/2210315508666180518081208

Rai JK, Chapagain SP (2014). Value Chain Analysis of Forest Products in Koshi Hill Districts of Nepal.

Ramanatha RV, Hodgkin T (2002). Genetic diversity and conservation and utilization of plant genetic resources. Plant Cell, Tissue and Organ Cult 68(1), 1–19.

Rameshkumar R, Pandian S, Rathinapriya P, Selvi CT, Satish L, Gowrishankar S, Leung DW Ramesh M. (2019). Genetic diversity and phylogenetic relationship of Nilgirianthus ciliatus populations using ISSR and RAPD markers: Implications for conservation of an endemic and vulnerable medicinal plant. Biocatalysis and Agricultural Biotechnology, 18: 101072. https://doi.org/10.1016/j.bcab.2019.101072

Rana SK, Rana HK, Ranjitkar S, Ghimire SK, Gurmachhan CM, O'Neill AR, Sun H. (2020). Climate-change threats to distribution, habitats, sustainability and conservation of highly traded medicinal and aromatic plants in Nepal. Ecol Ind 115: 106435.

Negi SJ, Bisht KV, Bhandari A, Bhatt P, Singh V, Singh N. (2014). Paris polyphylla: chemical and biological prospectives. Anti-Cancer Agents in Medicinal Chemistry (Formerly Curr Med Chem Anticancer) 14(6): 833–839.

Schippmann UWE, Leaman D, Cunningham A B. (2006). A comparison of cultivation and wild collection of medicinal and aromatic plants under sustainability aspects. Frontis 75–95.

Shilpha J, Silambarasan T, Pandian S, Ramesh M. (2013). Assessment of genetic diversity in Solanum trilobatum L., an important medicinal plant from South India using RAPD and ISSR markers. Genet Resourc Crop Evol, 60(3): 807–818. https://doi.org/10.1007/s10722-012-9951-2

Shrestha UB., Lamsal P, Ghimire SK, Shrestha BB, Dhaka, S, Shrestha S, Atreya K. (2022). Climate change‐induced distributional change of medicinal and aromatic plants in the Nepal Himalaya. Ecol Evol 12(8): 9204.

Smith OC, Overgaard LH (2003). Alpine medicinal plant trade and Himalayan mountain livelihood strategies. Geogr J 169(3): 243–254.

Thapa CB, Paudel MR, Bhattarai HD, Pant KK, Devkota HP, Adhikari YP, Pant B (2022) Bioactive secondary metabolites in Paris polyphylla Sm. and their biological activities: A review. Heliyon. 17:e08982.

Thapa CB, Bhattarai HD, Pant KK, Joshi PR, Chaudhary TL, Pant B (2023) Antioxidant, antibacterial, and cytotoxic effect of in vitro callus and in vivo rhizome of Paris polyphylla Sm, Pro. Biochem (124):33-43

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729

Wang L, Yang Y, Zhao Y, Yang S, Udikeri S, Liu T (2016). De novo characterization of the root transcriptome and development of EST-SSR markers in paris polyphylla smith var. yunnanensis, an endangered medical plant. J Agric Sci Technol 18(2): 437–452.

Yang, Z., Yang, L., Liu, C., Qin, X., Liu, H., Chen, J., & Ji, Y. (2019). Transcriptome analyses of Paris polyphylla var. chinensis, Ypsilandra thibetica, and Polygonatum kingianum characterize their steroidal saponin biosynthesis pathway. Fitoterapia 135: 52–63. https://doi.org/10.1016/j.fitote.2019.04.008

Yeh FC, Yang R, Boyle T, Ye Z, Mao JX (1999) POPGENE, version 1.32: Microsoft window-based free ware for population genetic analysis. Computer program and documentation distributed by University of Alberta and Centre for International Forestry Research, Alberta, Canada

Zhao X, Zou G, Zhao J, Hu L, Lan Y, He J (2020). Genetic relationships and diversity among populations of Paris polyphylla assessed using SCoT and SRAP markers. Physiol Mol Biol Plants 26(6): 1281–1293. https://doi.org/10.1007/s12298-020-00808-z

Zheng JY, Wang H, Chen XX, Wang P, Gao P, Li XN, Zhu, GP (2012). Microsatellite markers for assessing genetic diversity of the medicinal plant Paris polyphylla var. chinensis (Trilliaceae). Genet Mol Res 11(3): 1975–1980. https://doi.org/10.4238/2012.August.6.1

Supplementary Table 1 not available with this version.

Download PDF

Journal Publication

published 18 Jul, 2023

Read the published version in Heliyon →

Version 1

posted

You are reading this latest preprint version

Genetic diversity and population structure analysis of Paris polyphylla Sm revealed by SSR marker

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Method

Sample collection and sample size

DNA isolation

PCR amplification

Genetic diversity analysis

Population structure analysis

Results

Genetic diversity analysis for SSR primers

AMOVA analysis

STRUCTURE analysis

UPGMA phylogenetic tree

PCoA analysis

Discussions

Conclusion

Declarations

References

Supplementary Information

Status:

Journal Publication

Version 1