Animals and treatments
40 old male BALB/c (18–20 g) mice at five weeks of age were purchased from the Harbin Medical University. All experimental studies were conducted in accordance with the humanitarian spirit. Two groups of mice were randomly selected: the control group (CG) and the Zn-low group (LG). The CG group were fed a normal Zn diet (34 mg/kg) and the LG group mice were fed Zn deficient diet (2 mg/kg). The feed was purchased from Haida Feed Company. All animals were housed in a room with a temperature of 24 ± 2 ℃, 12 h rotating shaded lighting and suitable humidity. Cervical dislocation execution of mice was performed after 42 days of feeding. Liver tissue was divided into two groups: CG group (34 mg/kg) and LG group (2 mg/kg). The remaining tissues were stored at -80°C environment (Table 1).
Table 1
Brief list of feed ingredients (feed content per kg)
Mineral substance | | |
Mg | (g) | 2.5 |
Na | (g) | 2.5 |
K | (g) | 5.5 |
Cu | (mg) | 11.0 |
Fe | (mg) | 113.7 |
Mn | (mg) | 75 |
Zn (defcient group) | (mg) | 2 |
Zn (normal group) | (mg) | 34 |
Se | (mg) | 0.15 |
I | (mg) | 0.6 |
Protein calorie ratio | | 14.30% |
Fat calorie ratio | | 15.70% |
Water | | 8.70% |
Carbohydrate | | 61.30% |
Histological analysis
The liver was excised and taken, and the tissue was cut into smaller pieces of 3 mm3, and placed in formalin fixative for seven days. Sections were treated with paraffin wax. The H&E staining was performed after dehydrating, rehydrating, staining, transparent and sealing the section samples. Tissue changes were observed under a biological microscope (Olympus).
Cell Culture
HEPG2 Cell high sugar medium was supplemented with 10% fetal bovine serum, and 0.5% penicillin mix. Cells were incubated at 37 ℃ with 5% CO2 concentration. N,N,N,N′-Tetrakis-(2-pyridylmethyl)-ethylenediamine (TPEN) (Sigma-Aldrich, Germany) was used as the chelating agent for Zn to treat the cells: the CCG group (add 0 umol TPEN), C50 group (add 50 umol TPEN), C100 group (add 100 umol TPEN).
ROS Analysis
Liver tissue homogenate was centrifuged (1000 rpm/min) for 5 min according to the instructions of the ROS assay kit. The supernatant was added to a 96-well plate, and 2 ul of DHE fluorescent dye was added to the each well and incubated for 30 min. Liver tissue ROS level was detected at 510/610 nm. The cells were spread in six plates, and DHE dye was diluted with serum-free medium, and 1ml of DHE dye was added to the cells cultured in six-well plates per well. The stained cells were observed under a fluorescence microscope.
Antioxidant Enzyme Assays
The liver tissue was weighed accurately, and made into 10% homogenate with cold saline, and centrifuged at 2500 rpm for 10 min. Test the absorbance of the supernatant according to the instructions. The contents of MDA, SOD, CAT, GSH-PX and T-AOC were calculated. TBA method to detect MDA level, the WST-1 assay kit to detect SOD level, ammonium molybdate assay for CAT level, a colourimetric glutathione peroxidase assay kit to detect GSH-PX level, a colourimetric total antioxidant capacity detection kit to detect T-AOC level. HEPG2 cells were digested, centrifuged, and the supernatant was poured off, leaving the cells. Pre-cooled saline was added, and the same operation as the tissue was continued to determine the antioxidant enzyme content inside the cells. The antioxidant kits were purchased from Nanjing Jiancheng Biotechnology Co.
Real-Time PCR
Weighing 0.1 g of the liver tissue sample, and grind thoroughly with liquid nitrogen in a pre-cooled mortar. Then, 1 ml of Trizol was added, and the grinding was continued. Chloroform was added and centrifuged, isopropanol was added, and then 75% ethanol was added. Finally, the obtained RNA was reverse transcribed. 1 µl of enzyme mix and 10 µl hybrid mix were added to obtain cDNA. The reverse transcription process would be conducted in a 37°C water bath for 20 min, and the enzyme inactivation reaction would be conducted in a 98°C water bath for 5 min. Then, we designed primer sequences. The expression of GRP78, IRE-1α, ATF6, PERK, Chop, caspase-12, caspase-9, caspase-3, caspase-7, PARP gene were detected using β-actin as the internal reference primer (Table 2).
Table 2
The primers used in the present study.
Gene | Primer | Reverse primer (5′ -3′) |
GRP78 | Forward | CTACTCCTGTGTTGGAGTGTTC |
| Reverse | GTTAGAGGTCAGCTGGTTCTTC |
IRE-1α | Forward | AGACATGGCGAGAGGTTAGA |
| Reverse | TGCGAGTTTGGATGCGTATTA |
ATF6 | Forward | CATTGAGGTGGCGTGTTATG |
| Reverse | TCGATCCGCTCTTTAATTGC |
PERK | Forward | GAAGGCAAAGGAGACCAT |
| Reverse | CTAGAGAGAATGAAGTAGA |
Chop | Forward | GATACAGCCGTTCAATATCT |
| Reverse | GATGTGTGAGTCTCTGCCTTT |
Caspase-12 | Forward | CTGTGGTGAAACCTCCACCT |
| Reverse | CATGGTGACCACAGGAGATG |
Caspase-9 | Forward | AAGGAAAGTGCAGGAGCTGA |
| Reverse | TCACGCTCTCCACAAGAAGA |
Caspase-3 | Forward | GCTGTCTGCTTCACGCTCAA |
| Reverse | CTTGGAAGTGACATTTGCTTTT |
Caspase-7 | Forward | CCTGAGAACCTGGACAAGAGC |
| Reverse | CCGTAGGAAGACAGGATGTG |
PARP | Forward | CCAACCACAATGAGTGATA |
| Reverse | GAGAAAAGAGTTGTGC |
β-actin | Forward | TGTCCTGTGTCCATGCCTCT |
| Reverse | GGTTACGGCTTATGTCAACG |
Western blotting
Firstly, weighing an appropriate amount of liver tissue. The tissue was ground up with lysis solution in a glass homogenizer, and left to sit on ice for 30 min before centrifugation at 4 degrees and 12000 rpm for 15 min. The extracted proteins were obtained by adding Western Blot Fast Stripping Buffer and soaking in 95°C water bath for 15 min. The cell proteins were extracted by first washing the cells with PBS, then adding the lysis solution prepared in advance, followed by the same operation as the tissue. The extracted proteins were subjected to SDS-PAGE gel electrophoresis under constant pressure conditions at 80 and 120 volts, respectively. After the completion of electrophoresis, the cut gels were transferred to the membrane at a constant current of 200 mA. After completion of membrane transfer, the skim milk was closed for two hours. After that, the primary antibodies were incubated overnight at a dilution of 1 : 1000. The antibodies purchased were GRP78, IRE-1α, p-IRE-1α, ATF6, PERK, p-PERK, Chop, Cleaved caspase-12, caspase-9, caspase-3, caspase-7, PARP (all antibodies were purchased from Shenyang Wan Class Biotechnology Co). The incubated membranes were washed with TBST for 30 min and then incubated with enzyme-labelled goat anti-rabbit secondary antibody for 1 h. The secondary antibody was diluted 1 : 5000, followed by TBST for 30 min. The signals were obtained using the enhanced chemiluminescence detection reagents (Applygen, China) with a Chemiluminescence imaging system (Chemiluminescence imaging system purchased from Hangzhou Shenhua Technology Co). Finally, the strips were analyzed using Image J software and normalized with β-actin.
Cell live & dead detection
The HEPG2 cells were stained according to the AO/EB kit instructions. AO solution and EB solution were added to PBS in a one-to-one ratio. The cells were washed twice with PBS, and staining solution was added. The stained cells were observed under a fluorescence microscope.