Isolation and culture of HUCMSCs
The sampling scheme of human umbilical cord tissue was approved by the Institutional Review Board of The First Affiliated Hospital of Guangxi Medical University. The signed informed consent was obtained from all participants for this study. The isolation of HUCMSCs from the Wharton’s jelly of the umbilical cords was described previously34 with minor modifications. In brief, umbilical cords were obtained from full-term delivery patients by cesarean section at The First Affiliated Hospital of Guangxi Medical University. The Wharton’s jelly was isolated and cut into 1–2 mm3 pieces, then growth medium was added and cultured in 37 °C humidified incubator. The growth medium was composed by high-glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) and 10% fetal bovine serum (FBS; Gibco, USA) was refreshed every 3 days. After the first subculture, the cells were passaged at a ratio of 1:5 when they reach near 90% confluence. All HUCMSCs undergoing further analysis were used at passages 3–5 in this study. For the differentiation of HUCMSCs, HUCMSCs were cultured in chondrogenic, osteogenic, and adipogenic differentiation medium according to the manufacturer’s instruction, respectively. And the differentiation ability was detected by three kinds of staining. Alizarin red solution (Solarbio, Beijing, China), Oil-Red-O staining (Solarbio, Beijing, China) and Alcian blue staining (Solarbio, Beijing, China) were carried out to detect osteogenic differentiation, adipogenic differentiation and chondrogenic differentiation according to the manufacturer’s instruction, respectively.
Isolation, culture of mature chondrocytes
Primary chondrocytes were harvested from patients (n = 13, average age: 10.8 months, range 6–15 months, male: 7, female: 6) who underwent polydactyly surgery at The First Affiliated Hospital of Guangxi Medical University. Cartilage tissues were obtained from knuckle cartilage and minced into pieces. And then, the cartilage pieces were digested by 2 mg/mL of collagenase type II (Sigma, USA) at 37 °C for 3 hours after treatment with 0.25% trypsin (Solarbio, Beijing, China) for 30 minutes as described previously6. Chondrocytes were cultivated in DMEM culture medium containing 10% fetal bovine serum (Gibco, USA) and 1% penicillin/streptomycin (Solarbio, Beijing, China). The culture medium was replaced by fresh medium every three days. The chondrocytes were re-plated at a ratio of 1:4 when the cells achieved near 100% confluence. All the chondrocytes at passages 3–4 were used in our studies.
Extraction and identification of Exosomes
Chondrocytes-derived exosomes(C-EXO) were extracted by differential centrifugation, as described previously with some minor modifications35,36. Briefly, the culture medium was collected after chondrocytes were cultured with serum-free medium for 48 hours, then centrifuged at 10,000 g for 30 minutes for removal of cell debris and macroparticles. The supernatant was collected and transferred to ultracentrifuge tubes (Beckman Coulter) and then ultracentrifuged at 100,000 g for 1.5 hours by Thermo Scientific Sorvall WX UltraSeries Centrifuge with an AT-50 rotor. The pellets were collected and washed with PBS by centrifugation at 100,000 g for 1.5 hours. All centrifugation procedures were carried out at 4 °C. The purified C-EXO were resuspended by PBS and stored at -80 °C. The characterization of C-EXO was identified by transmission electron microscopy (TEM, H-800, Hitachi, Tokyo, Japan) and Flow Nano Analyzer (NanoFCM, Xiamen Fuliu Biological Technology Co., China).
Cellular uptake of exosomes
Chondrocytes-derived exosomes(C-EXO) were first labeled with FITC-CD9 according to the manufacturer’s instruction (BD Biosciences, USA). Briefly, 200 µL of the cell-labeling solution was added to 500 µL of exosomes suspension and incubated at 37 °C for 30 minutes. Subsequently, the mixture was washed by PBS twice to remove the free dye, and then the sediment was suspended with 500µL of PBS. The HUCMSCs were incubated with labeled C-EXO at 37 °C for 12 hours. The HUCMSCs were then fixed with 4% paraformaldehyde at room temperature for 20 minutes after washing with PBS. Next, cells were dyed with phalloidin and DAPI. Confocal images were sequentially acquired by confocal microscopy (TCS SP8, Leica, Germany).
Cell proliferation assay
Cell counting kit-8 (CCK8, Beyotime, Biotechnology, Haimen, China) analysis was used to measure the proliferation of cells. The HUCMSCs were cultured in 96-well plate, after the cell reached 70%-80% confluence, the culture medium was substituted with 90 µL of fresh medium comprising various concentrations of C-EXO and cultured for 24 hours. After that, 10 µL of CCK-8 solution was added to each well, followed by the optical density (OD) of the culture medium was measured at 450 nm by using a microplate reader (Thermo Scientific, USA) after incubation at 37 °C for 4 hours following the study reported previously37.
Cell viability assay
Live/dead cell viability assay was applied to measure the viability of HUCMSCs. According to the manufacturer's instruction (Invitrogen, Carlsbad, CA), the staining solution was prepared as 0.5% calcein–acetoxymethyl (calcein-AM) and 2% propidium iodide (PI) in PBS. Then the treated or untreated HUCMSCs were washed three times with PBS and stained with staining solution at 37 °C for 5 minutes in the dark. Imaging was captured by the inverted fluorescence microscope (BX53, Olympus, Japan).
Migration assay
The migration of C-EXO-treated HUCMSCs was evaluated by scratch wound assay. HUCMSCs were plated in 12-well plate (2 × 105 cells/well, 3 replicates each group) and cultured in a 37 °C humidified incubator with 5% CO2 until cell fusion. The confluent monolayer of cells was scratched by using a 10-L micropipette tip, and then washed with culture medium three times to remove the shed cells. After that, the HUCMSCs were cultured in a complete medium contained C-EXO, TGF-β or control medium. The images were obtained at the same position at 0 hours, 6 hours, and 12 hours post-wounding. Scratched areas were investigated via Image-J software (National Institutes of Health, Bethesda, MD, USA)
Flow cytometry
Cells were harvested and centrifuged at 1200 rpm for 5 minutes, and then the pellet was resuspended by adding 50µL of binding buffer. Followed by the dyes (FITC Annexin V Apoptosis Detection Kit, BD Biosciences) was added in each group and incubated for 15 minutes at room temperature under the dark environment. Then the samples were treated with 200 µL of binding buffer and analyzed by flow cytometry (BD AccuriTMC6 PLUS, BD Biosciences). For C-EXO detection, fluorescently labeled antibody: human CD9 FITC (2 µl, BD Pharmingen™, Catalog No.555371), human CD63 FITC (2 µl, BD Pharmingen™, Catalog No.550759) were added into 50µL of C-EXO. After incubation at 37℃ for 30 minutes, labeled C-EXO were washed twice, and then the particles were resuspended in PBS and tested by Flow Nano Analyzer (NanoFCM, Xiamen Fuliu Biological Technology Co., China).
Autophagy detection
The observation of autophagy was conducted by double-labeled mRFP-GFP-LC3 adenovirus (Shanghai Genechem Co., China) transfection. First, the HUCMSCs were cultured for two days, and then mRFP-GFP-LC3 lentivirus was introduced into HUCMSCs according to the manufacturer’s protocol. After that, these cells were treated with PBS, C-EXO and TGF-β, respectively for 48 hours. The formation of autolysosome was detected and analyzed by using laser confocal microscopy (TCS SP8, Leica, Germany). Autophagic bodies are represented by yellow spots and autophagic lysosomes by red spots. In addition, cells from different groups were sectioned and observed autophagosomes by using a transmission electron microscopy (TEM, H-800, Hitachi, Tokyo, Japan).
Real-time polymerase chain reactions
Total RNA was extracted from each group cells using total RNA isolation kit (Tiangen Biotechnology, Beijing, China) according to the manufacturer's protocol. The quantity and purity of RNA were determined by Nanodrop (Thermo Scientific, USA). 1000 ng of total RNA samples were used to synthesize complementary DNA by using a reverse transcription kit (Fermentas, Waltham, MA). Real-time polymerase chain reaction (PCR) was conducted using FastStart Universal SYBR Green Master Mix (Roche Company, Basel, Switzerland) and pre-designed primers for 45 cycles of 15 seconds at 95 °C and 1 minute at 60 °C as reported previously38. The primer sequences of the genes are listed in Table 1. The expression level of each gene was normalized by glyceraldehyde − 3- phosphate dehydrogenase (GAPDH). Each experiment was repeated three times. The target gene relative expression was calculated by using the comparative method 2−ΔΔCt.
Table 1
Primers for real-time polymerase chain reaction
| Gene names | Forward primer | Reverse primer |
| Col 2a | CCGTGCTCCTGCCGTTTC | CTGAGGCAGTCTTTCACGTCT |
| Sox-9 | AAGCTCTGGAGACTTCTGAACG | CGTTCTTCACCGACTTCCTCC |
| Acan | CTACACGCTACACCCTCGAC | ACGTCCTCACACCAGGAAAC |
| Col 10 | CGATACCAAATGCCCACAGG | ATGGTCCTCTCTCTCCTGGT |
| Col 1a | GTTCAGCTTTGTGGACCTCCG | GCAGTTCTTGGTCTCGTCAC |
| GAPDH | GTCAAGGCTGAGAACGGGAA | AAATGAGCCCCAGCCTTCTC |
| Note. Col2a, collagen type II; Sox9, SRY-related high mobility group‐box gene 9; Acan, aggrecan; Col10, collagen typeⅩ; Col1a, collagen type I; GAPDH: glyceraldehyde‐3‐phosphate dehydrogenase. |
Western Blot
The western blot analysis was performed as previously described39. Briefly, collected cells were washed by cold PBS, lysed in lysis RIPA buffer containing PMSF (1 mM phenylmethylsulfonyl fluoride). The extracted protein concentration was determined by the BCA protein assay kit (Beyotime, China). Besides, each sample with an equal amount of proteins (70 µg) was added and separated on 10% SDS-polyacrylamide gel and then transferred to polyvinylidene fluoride membranes. Next, the membranes were incubated with an appropriate concentration of primary antibodies, which are as follows: SOX9(1:1000, CST, Catalog No.82630), COL2A(1:1000, Abcam, Catalog No.ab185430), ACAN(1:100, Abcam, Catalog No.ab3778), COL1A(1:1000, Abcam, Catalog No.ab88147), COL10(1:300, Abcam, Catalog No.ab58632) and GAPDH(1:5000, Abcam, Catalog No.ab8245). After washing with TBST at 37℃, the membranes were incubated with secondary fluorescence-conjugated antibodies (1:15000, LI-COR, USA) and imaged by Odyssey Infrared Imaging System (Odyssey, USA).
Establishment of animal models
All animal experiments were approved by The Animal Research Committee of the Guangxi Medical University in this study. The surgical procedure in the rabbit model was carried out as previously described40. Briefly, clinically healthy New Zealand white rabbits (either sex, 6 months old, weighing 1–2 kg) were selected randomly in the study. The general anesthesia was performed with 2% pentobarbital sodium through the auricular vein, the knee joint of the rabbit was exposed through the lateral parapatellar approach, and then a cartilaginous defect with a diameter of 4.0 mm and depth of 3.0 mm was made in the medial side of each patella groove using a hand drill. Then, each animal was received a local fill with masses of HUCMSCs (2 × 106 ) in the defect area. The defects were treated as follows: (1) HUCMSCs, which were cultured with complete medium for 14 days (negative control group, n = 30 knees); (2) C-EXO treated HUCMSCs: HUCMSCs were cultured with complete medium including C-EXO for 14 days, (C-EXO group, n = 30 knees); (3) TGF-β treated HUCMSCs: HUCMSCs were cultured in chondrocyte inducing medium with TGF-β for 14 days, which as positive control. (TGF-β group, n = 30 knees). Penicillin was administered for 3 days post-surgery. Euthanasia was carried out with an overdose of pentobarbital sodium administered by intravenous (I.V.) injection at 4 and 12 weeks after surgery. The treated condyles were harvested for further analysis. The International Cartilage Repair Society (ICRS) scoring system was applied to assess the gross morphological phenotype of the cartilage defect repair in rabbit models41.
Histological examination
The osteochondral blocks containing repaired tissue were harvested, and specimens were decalcified with 14% ethylenediaminetetraacetic acid (EDTA) solution for six to eight weeks after fixation with 10% neutral buffered formalin. And then the tissue samples were embedded in paraffin and serial section conventionally. The sections were stained Hematoxylin and eosin (H&E), and safranin-O/fast green (Solarbio, Beijing, China) according to the standard protocols, then were observed microscopically by light microscope (Olympus BX53, Tokyo, Japan). The results were scored by three qualified examiners who were blinded to the outcome of the cases according to the ICRS Visual Histological Assessment Scale 42.
Immunofluorescence analysis
Immunofluorescence examination was performed as previously described39. For cell immunofluorescence preparation, planted cells were fixed by 4% paraformaldehyde, successively treated with 3% H2O2 for 10 minutes and blocked with goat serum at room temperature for 10 minutes. Primary antibody COL2A was used to detect changes of chondrogenic differentiation. Samples were incubated with anti-COL2A antibody (1:200, Boster, China) at 37 °C for three to four hours, followed by incubated with the secondary antibody (anti-rabbit antibody, 1:50, Boster, China) at 37 °C for 45 minutes, the nuclei were counterstained with 4’, 6-diamidino-2-phenylindole (DAPI; Boster) for 5 minutes. Images were obtained sequentially by fluorescence microscope (BX53, Olympus, Japan).
Statistical analysis
All data collected in this study are analyzed in SPSS (SPSS v22.0; IBM, Armonk, NY). The statistical significance between the two groups was evaluated using the one-way analysis of variance with a t test. P < 0.05 was considered a statistically significant difference.