2.1 Cell Culture
Healthy yak ovaries were removed manually and preserved in 0.9% saline solution on pasture after obtaining permission from the Institutional Animal Care and USE Committee (IACUC) of Gansu Agricultural University. In the laboratory, follicular fluid was isolated by puncturing ovarian follicles (3-5mm diameter) and subjected to centrifugation at 1500 r/min for 20 min. The precipitates were collected and suspensions were prepared using DMEM F-12 containing 10% fetal bovine serum (FBS, Gibco, CA, USA), 10% penicillin, and streptomycin. Suspensions containing yak GCs were seeded onto cell culture plates and cultured at standard cell culture conditions (5% CO 2 , humidified at 37°C). Media were changed every 24-h interval. Yak GCs were trypsinized by 0.25% trypsin, and neutralized using DMEM F-12 containing 10% FBS when cells were grown to 90-100% confluence in culture plates. The suspensions were centrifuged at 1500 r/min for 5 min. The precipitates were suspended in solution (DMEM : FBS : DMSO = 7:2:1). After rigorous mixing, GCs were cryopreserved.
293T cells were purchased form Genepharma company and routinely cultured using DMEM F12 medium containing 1.5 mg/L Glutamine, 100 U/ml Penicillin and 100 μg/ml Streptomycin in a 37°C, 5% CO2 saturated humidity incubator.
2.2 Cell transfections with rhLncRNA MEG3 plasmids and miR-23a mimics
Tubes containing yak GCs were removed from liquid nitrogen and quickly placed in a shaking water bath at 37°C. After melting, 3mL fresh media was added and the mixture was centrifuged at 1500 r/min for 10 min. The supernatant was removed, and cells were resuspended in DMEM with additional 10% FBS. Yak GCs were seeded on 12-well plates after mixing. After 12h incubation, culture media was replaced with fresh one. Cells were transfected with rhLncRNA MEG3 plasmids (pcDNA3.1-LncRNA MEG3, pEX-1-EGFP, p-EX-3) or miR-23a mimics (sense: GAGGCUUGCUGGCAUAAAUTT; antisense: AUUUAUGCCAGCAAGCCUC T, 100 nM, Genepharma, shanghai, China), negative control (100 nM, Genepharma, China) alone or both of them, respectively. Transfection mixture was replaced with 1 mL of fresh media after 4-6 h, and cells were harvested 24h or 48 h later. After transfection, GCs were treated with FSH (10μg/mL) or LH (100 μg/mL) according to experimental needs.
2.3 Luciferase reporter assay
The sequences of LncRNA MEG3 and ASK1 were found in GenBank (https://www.ncbi.nlm.nih.gov/ gene), and that of miR-23a were queried from miRBase (http://www.mirbase.org) databases. Online software of Targetscan (https://www.Targetscan.org) was used for predicting binding sites between ASK1 and miR-23a, and other online software (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid) was used to predicte binding sites between LncRNA MEG3 and miR-23a. Wild-type and mutant vectors for LncRNA MEG3 (WT:CTGCCCCACCAGCGGGCCTGGGGAGCCCGACCCCTGTGTGCACAGGGTGTGGGCCCCGGG GTGGGGGTCT; MUT:CTGCCCCACCAGCGGGCCACCCCTGCCCGACGGGACTGTCGTCAGGCAC ACCGCCCCGGGGTGGGGGTCT) and ASK1 5’untranslated region (5’UTR) (WT:CATGTGATTGTGCA TCACTGGAACAAAACCAAAATGTGACCATAACTTTTTAGGTTATGTATGTTTGTA;MUT:CATG TGATTGTGCATCACTGGAACAAAACCAATTACACTCCATAACTTTTTAGGCTTATGTATGTTTGA) and the mimics (sense: GAGGCUUGCUGGCAUAAAUTT; antisense: AUUUAUGCCAGCAAGCCUCT, 100 nM, Genepharma, Shanghai, China) and inhibitors (UGGAAAUCCCUGGCAAUGUGAU, 50 nM, Genepharma, Shanghai, China) of miR-23a were synthesized. 239T cells were cultured and transfected with wild-type and mutant vectors for LncRNA MEG3 or ASK1 and miR-23a mimics using Lipofectamine 2000. Cells were harvested to analysis luciferase activity using Dual-Luciferase Reporter Assay System at 24h and 48h after transfection.
2.4 Fluorescence in situ hybridization assay
Yak GCs were seeded in 35 mm dishes of chambered slides at density of 2×104/well for 48h. Cells were washed in PBS and fixed with 4% paraformaldehyde in pH 7.4 for 3h at room temperature. Subsequently, 0.1% Buffer A was added to each well and incubated at room temperature for 15 min. Cells were washed and incubated with 2×Buffer C in each well at 37°C for 30 min. 100 µL of probe mix (LncRNA MEG3 probe : TTCCAT CCTAGT+TTGCCGAT+TGTGG; bta-miR-23a probe :TGGAAA+TCCCTGGCAATG+TGAT; Genepharma, Shanghai, China) per 100 µL medium was added to each slide, and placed in an incubator at 5% CO2 and 37°C and incubated for 10 h under protection from light. It was subsequently washed in preheated (42°C) 0.1% Buffer F and 2×Buffer C for 30 min and then stained with 100 μL of DAPI for 5 min and visualized under fluorescence microscope.
2.5 Quantitative real-time PCR assay
Yak GCs were cultured and processed as described previously. Cells were harvested at 24h or 48h and lysed using Trizol RNA extraction kit (C06-01029, Bioss, BeiJing, China). Total RNA was extracted according to the manufacturer’s instructions and stored at -80°С. Total RNA was reverse transcribed to cDNA using Reverse Transcription kit (Takara, Tokyo, Japan). According to strict instructions from GoScriptTM reverse transcription system and Mir-X miRNA First-Strand Synthesis Kit (Takara, Tokyo, Japan), cDNA used for miR-23a levels detection was synthesized. Quantitative real-time PCR (qRT-PCR) was performed to examine the expression of LncRNA MEG3, miR-23a, and mRNA (ASK1, JNK1, JNK2) genes, (Primer information: Additional file 1). β-actin and U6 were used as housekeeping gene controls. Three (3) replicates of each gene were included in each experiment. The 2-ΔΔct method was used to analyze the experimental results.
Table 1 Primer information
Genes
|
Primer sequences
|
Annealing temperature(℃)
|
Product length
(bp)
|
ASK1
|
F:AGAGGAAGGAGATTGTGAAG;
R:GGCGATTCTGACTTGGTT;
|
58-60
|
138
|
JNK1
|
F:TATACGGGTGCTGGAGAG;
R:CTGACTCGGAACACAACA;
|
58-60
|
114
|
JNK2
|
F:CTTTATGATGACTCCCTATGTG;
R:GCTTGACTTGCGTTCTCT;
|
58
|
102
|
Bax
|
F:TGCTTCAGGGTTTCATCC;
R:CTTCAGACACTCGCTCAG;
|
58
|
98
|
Bcl2
|
F:TGAGTTCGGAGGGGTCATGT;
R:AGGTGCCGGTTCAGGTACTC;
|
58
|
110
|
miR-23a
|
ATCACATTGCCAGGGATTTCCA
|
60
|
|
U6
|
F:GGAACGATACAGAGAAGATTAGC;
R:TGGAACGCTTCACGAATTTGCG;
|
60
|
|
LncRNA
MEG3
|
F:CGGAAGGTGAGGAAGGAA;
R:ATAGAAGAGGCGGTCAGTA;
|
56-62
|
196
|
β-actin
|
F:GGAACCGCTCATTGCCGATGG;
R:CGTCCGTGACATCAAGGAGAAGC;
|
56-62
|
108
|
2.6 Western blot analyses
Total protein was extracted using Radio Immunoprecipitation Assay (RIPA) buffer (R0010, solarbio Life Sciences, Beijing, China). A phosphatase inhibitor cocktail (78420, ThermoFisher Scientific, Massachusetts, USA) and phenylmethylsulf-onyl fluoride (PMSF) were later added. Cells were lysed for 30 min and the cell suspension was centrifuged. Total protein concentration was obtained by the bicinchoninic acid (BCA) protein assay kit (PC0020, Solarbio Life Sciences, Beijing, China), and the supernatant of protein was stored at -80°C. Total protein lysates were denatured at 95°C for 10 min after adding protein loading buffer (P1015; Solarbio Life Sciences). Total protein was separated by SDS-polyacrylamide gel electrophoresis and then transferred from the gel to PVDF membrane using a wet transfer method. The membranes were blocked with 5% skim milk for 2 h and incubated with primary antibodies overnight at 4°C. The primary antibodies included: anti-ASK1 antibody (1:900; AF6477; Affinity); anti-P-967 antibody (1:1000; 3764S; CST); anti-P-845 antibody(1:1000; 3765S; CST); anti- JNK1/2 antibody (1:2000; ab179461; abcam); anti-P-JNK1/2 antibody (1:1300; 9251s; CST); anti-Bax antibody (1:700; LS-C353915; LSBio); anti-Bcl2 antibody (1:1500; ab692; abcam); anti-Beclin-1antibody (1:1000;11306-1-AP;Proteintech); anti-LC3B antibody (1:1000; 18725-1-AP; Proteintech); anti-P62 antibody (1:2000; 227207; CST); anti-β-actin antibody (1:5000; AF7018; Affinity). The next day, PVDF membrane was washed with TBST for 30 min and incubated in secondary antibody. Secondary antibodies included Goat anti-Mouse IgG-HRP (1:8000; abs20039; Absin Bioscience) and goat anti-rabbit IgG-HRP (1:8000; abs20040; Absin Bioscience). Subsequently the membrane was washed with TBST 3 times for 10 min each. Finally, the bands were visualized with chemiluminescence using an ECL detection kit (P0018FS, Beyotime, Shanghai, China), the Amersham Imager 600 system (GE Healthcare Life Sciences, Marlborough, USA), and semi-quantified with ImageJ software.
2.7 TUNEL assay
Yaks GCs were cultured and treated as described. After incubation, cells were washed with PBS two times, fixed in 4% paraformaldehyde (P0099, Beyotime, shanghai, China) for 8 h at 25°C and then permeabilized with 0.3% Triton X-100 (ST797, Beyotime, Shanghai, China) for 1h after washing with PBS. Granular cells were washed again in PBS, and incubated with TUNEL reaction mixture (In Situ Cell Death Detection Kit, Roche; Mannheim, Germany) at 37°C for 1 h. The reaction was shielded from light. After washing, cells were stained with 4’, 6-Diamidino-2-phenylindole (DAPI) (C1002, Beyotime, shanghai, China) and visualized by fluorescent microscopy (a DeltaVisionTM Ultra, GE Healthcare Bio-Sciences Corp).
2.8 pCMV-mCherry-GFP-LC3B assay
To assess autophagy levels of yak GCs, cells were transfected with pCMV-mCherry-GFP-LC3B (20 MOI/ mL) (D2816, Beyotime, Shanghai, China) using lip8000 (catalog number C0533; Beyotime Biotechnology) according to manufacturer’s instructions for PCMV- mCherry-GFP-LC3B transfection. The media was replaced with fresh media after 24 h. After 48 h of transfection, cells were processed as described above. Cells were fixed in 4% paraformaldehyde and then permeabilized with 0.3% Triton X-100 after washed with PBS. Cells were stained with DAPI, and then the slides were sealed with nail polish and photographed using a laser confocal fluorescence microscope (a DeltaVisionTM Ultra, GE Healthcare Bio-Sciences Corp). One yellow puncta was considered equal to one autophagosome, and red puncta (mCherry) represented autolysosome.
2.9 Immunofluorescence and Immunohistochemistry assay
Yak GCs were identified by immunofluorescence (IF) and immunohistochemistry (IHC) assay using FSHR antibody. Cells were grown to 80-90% confluence as described previously and later fixed by 2% paraformaldehyde and then penetrated by 1% Triton X-100. Subsequently, cells were washed 3 times for 5 min each with PBS and then incubated in FSHR antibody (1:300; bs-0895R; Bioss; China) overnight at 4°C. A day after, cells for IHC assay were incubated with goat anti-rabbit secondary antibody and conjugated tertiary antibodies according to SP kit instructions (SP0023, Bioss, Beijing, China). Then, cells were photographed using inverted microscope (DP71, Olympus, Japan). Yak GCs that were used for IF staining were washed with PBS two times, and incubated with F (Ab ') 2 Fragment (Alexa Fluor® 594) (1:1000; 8889S; CST) for 1 h at 25°C. Lastly, the cells were stained with DAPI and photographed using a laser confocal fluorescence microscope (a DeltaVisionTM Ultra, GE Healthcare Bio-Sciences Corp).
2.10 Data analysis
All data were represented as mean ± standard deviations (SD). The results are representative of more than four independent experiments unless indicated otherwise. Statistical analysis of autophagy and apoptosis were performed via one-way analysis of variance (ANOVA) with SPSS (Statistical Package for the Social Sciences 19.0) software package (Chicago, IL, USA) and figures produced using Prism version 11 (GraphPad Software, CA,USA) statistical software packages. A P-value < 0.05 was considered as statistically significant. 0.01<p < 0.05 (#), and p < 0.01 (*).