Antibodies and chemicals
Mouse monoclonal anti-CFTR antibody was obtained from University of North Carolina at Chapel Hill. Rabbit polyclonal actin and polyclonal anti-NA/K ATPase were purchased from Cell Signaling. Mouse monoclonal UBE 2L6 antibody were acquired from Research Diagnostics Inc. Mouse monoclonal Myc, HA, and His-tag antibodies were bought from Abcam. VX-809 and MG132 were obtained from Selleck Chemicals, GlyH101 was obtained from Calbiochem, Forskolin,3-Isobutyl-1-methylxanthine (IBMX) and cycloheximide (CHX) were purchased from Sigma. siRNA was purchased through Dharmacon Inc.
Cell culture and drug treatment
CFBE-F508del expressing cell line was established from CFBE41o− (CFBE), a well-characterized human airway epithelial cell line. CFBE cells was derived from the bronchial epithelial cells of a CF patient with cftr F508del/F508del genetic background and with no detectable expression of the mutant protein. CFBE-F508del cells were cultured in MEM with 10% fetal bovine serum addition of 0.5 μg/L puromycin. All cells were maintained in a humidified atmosphere containing 5% CO2 at 37 °C. Confluent cells were treated with VX-809 in culture medium at the designated concentration for 24 h. Cells were harvested after 24 h treatment. HEK 293 cells were cultured in DMEM with 10% fetal bovine serum.
Plasmid constructs, DNA constructs.
F508del in pcDNA3.1 vector was described previously [35]. The UBE 2L6 and RNF19B cDNA sequence was amplified by PCR and inserted into pcDNA3.1(+) at EcoR1 and EcoRV sites. HA-ubiquitin was purchased from Addgene.
Immunoblotting
Cells were lysed by sonication in lysis buffer (50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 1% NP40, 10% glycerol and protease inhibitors cocktail). Specifically, protein samples were resolved by SDS-PAGE and transferred to PVDF membranes, which were blocked at room temperature for 1 h with 5% (w/v) non-fat milk in TBST (10 mM Tris (pH 8.0), 150 mM NaCl, 0.05% Tween 20). The blots were incubated with primary antibodies in TBST with 10% fetal bovine serum at room temperature for 2-3 h. The blots were then washed three times with TBST and incubated with horseradish peroxidase-conjugated secondary antibodies for 1 h, followed by three washes with TBST. The reactive bands were visualized by incubation with enhanced chemiluminescence substrates (PerkinElmer Products) and exposure to X-ray film (Eastman Kodak Co).
Co-immunoprecipitation (Co-IP) for ubiquitin assay
Cell lysate treated with MG132 in Lysis buffer ( (50 mM HEPES (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% NP-40, 10% glycerol) was precleared with protein A/G-Sepharose beads (Invitrogen). The precleared lysate was mixed with 10ug of the indicated antibody and 25ul of protein A/G-Sepharose beads and incubated overnight at 4ºC with gentle rotation. Immunocomplexes were resuspended in SDS sample buffer and subjected to SDS-PAGE gel and immunoblotting.
Cycloheximide (CHX) chase analysis
After 24 h treatment with designated reagent, cells were continued to be cultured in medium supplemented with 50 μg/ml CHX and harvested at designated time points. Cell extracts were subjected to the immunoblotting analysis with appropriate antibodies.
Biotinylation and pulldown of CFTR on streptavidin beads
After treatment with specified reagent of 24 hours, cells were washed 3 times with PBS and exposed to 0.5mg/ml in PBS EZLink Sulfo-NHS-LC--biotin (Thermo Scientific) for 1 h on ice. Cells were washed 3 time with PBS, quenched with 100mM glycine in PBS, and rinsed 2 time again. Then cells were solubilized by sonication in RIPA buffer (150 mM NaCl, 1 mM Tris/HCl, 0.5% (w/v) deoxycholic acid, 1% (w/v) NP-40, 0.1% SDS, 2 mM EDTA, 50 mM NaF and protease inhibitors). The resulting lysate was centrifuged at 21100 g for 10 min at 40C, and supernatant protein content was determined using protein assay dye reagent (Bio Rad). The supernatant was incubated with streptavidin beads for overnight at 40C. After a brief centrifugation the supernatant was removed, the beads were washed 4 times with lysis buffer. Pull-downed proteins were resolved by SDS-PAGE, transferred to PVDF membranes and performed an immunoblot as described above.
Ussing Chamber experiments
CFBE-F508del cells grown on collagen-coated transwell filters (Costar, 0.33 cm2, 0.4-μm pore) were polarized and treated with indicated reagent 24h. Filters were mounted in Ussing Chambers (Physiologic Instruments #P2300). The basolateral bathing solution consisted of 120 mmol/L NaCl, 25 mmol/L NaHCO3, 3.3 mmol/L KH2PO4, 0.8 mmol/L K2HPO4, 1.2 mmol/L CaCl2, 1.2 mmol/L MgCl2 and 10 mmol/L d-glucose. The apical bathing solution replaced 120 mmol/L NaCl with 120 mmol/L Na glutamate to achieve a transepithelial chloride gradient. The bathing solutions were maintained at 370C and gassed with 95% O2, 5% CO2 to retain a pH 7.4. Short-circuit current and transepithelial resistance were measured continuously using a voltage-clamp (VCC-MC8) and Acquire and Analyze v2.3 data acquisition hardware and software (Physiological Instruments, San Diego, CA, USA).
Filters were equilibrated for approximately 15 min to permit electrical parameters to stabilize, and baseline short circuit current (ISC) was measured. 10 μM forskolin and IBMX was added to the basolateral chamber to activate and remain CFTR-mediated anion secretion. After 3 min and currents had reached steady state ,10 μM/L CFTR inhibitor Glyh 101 was added to the apical solution. Stop record after currents had achieved steady-state. Changes in short-circuit currents were calculated from the mean currents obtained during the 20-s period.
Confocal Microscopy
Immunofluorescence staining of filter-grown cells was performed as described previously [35]. Briefly, CFBE-F508del cells were fixed in 4% paraformaldehyde and permeabilized with a mixture of 4% paraformaldehyde and 0.1% Triton X-100. The cells were then washed three times with buffer A (0.5% BSA and 0.15% glycine at pH 7.4 in phosphate-buffered saline). After blocking with purified goat serum, the monolayers were incubated in the appropriate primary antibodies (anti-Myc 1: 300, and anti-CFTR217 1:300) for 1 hour followed by three washes in buffer A and subsequent incubation with fluorescein isothiocyanate (green) or rhodamine (red)-labeled secondary antibodies (1:1000, Molecular Probes) for another hour. After washing with buffer A, the filters were mounted on glass coverslips using synthetic resin and subjected to confocal microscopy. Collected images were exported to ImageSpace (Molecular Dynamics) for subsequent reconstruction and processing.
Quantitative real-time reverse transcription PCR analysis
Total cellular RNA was extracted using TRIzol reagent and reverse-transcribed to cDNA using a random primer. The real-time PCR reaction mixture containing cDNA template, primers and SYBR Green PCR Master Mix (Invitrogen) was run in a 7,500 Fast Real-time PCR System (Applied Biosystems). Fold changes of mRNA levels were determined after normalization to internal control of β-actin RNA levels [36]. RNF19B Forward primer: TGCATGACTCAGCAAAGTGGA. RNF19B Reverse primer: GCATGAACATGGAGCGAGTCC
Data analysis.
The immunoblot images were scanned at 600 dpi for densitometry analysis using Image J software. The Values are means ± SEM. Statistical significance of differences was determined using paired two-tailed Student’s t-test.