1.1 Clinical Specimens
In this study, we collected paraffin specimens of 47 pediatric medulloblastoma tissues treated in the Department of Pediatric Neurosurgery of the First Affiliated Hospital of Xinjiang Medical University from January 2011 to December 2019, approved by the ethics committee of the First Affiliated Hospital of Xinjiang Medical University (ethics approval number K202111-10), and all children were not treated with radiotherapy, chemotherapy, or immunotherapy before surgery, with a postoperative follow-up of 40 The follow-up period after surgery was 40–65 months. The study complied with the 2013 revised Declaration of Helsinki and written informed consent was obtained from all patients.
1.2 Cell Lines
The human medulloblast cell line DAOY was purchased from the cell bank of the Chinese Academy of Sciences and was maintained and cultured in the cell laboratory of the Clinical Research Institute of Xinjiang Medical University.
1.3 Main Reagents And Instruments
VASH2 antibody (PA5-113065) was purchased from Thermo Fisher, USA.
GAB1 antibody (ab59362), YAP1 antibody (ab114862), Smad4 antibody (ab230815), Smad2 + 3 antibody (ab207447), Bcl-2 antibody (ab117115), Caspase3 antibody (ab2302), β-actin antibody (ab8227), purchased from Abcam Inc, USA.
Fetal bovine serum FBS, RPMI1640 basal medium, trypsin, and mycin-streptomycin double antibodies Gibco, USA, RPMI1640 medium purchased from Gibco, USA.
AEC enzyme substrate kit, CCK-8 kit, and crystalline violet powder were purchased from Zhongshan JinQiao, China.
Transwell chambers and substrate gel (356234) were purchased from Corning, USA.
MMP-2 antibody (bs-4605R) was purchased from Bosun, China.
VASH2 overexpression lentivirus (42448-2), negative control virus Con238, and
VASH2 knockdown lentivirus (1023B4-1), Target Seq: GCTCCAGGCGATCCAGAATTA
Negative control virus LVCON313 was purchased from Gikai Genetics, China.
Purimycin solution (A610593) and BSA (A602440-0050) were purchased from Shanghai Biotech, China.
1.4 Cell Line Culture And Lentiviral Transfection Grouping
The human medulloblast cell line DAOY was cultured in RPMI 1640 medium containing 10% fetal bovine serum in a 37°C and 5% CO2 cell culture incubator, and when cell fusion reached about 85%, it was passaged, and DAOY cells were transfected by using small interfering RNA technology lentiviral vectors, of which 2 were manufactured in the VASH2 interfering lentiviral vector class, and stably transfected cells were cloned by puromycin screening 3 times after cells were subsequently established with VASH2-NC, VASH2-OE and VASH2-Si#1. as described in our previous work and validated using protein blotting experiments.
1.5 Immunohistochemistry
All paraffin sections were preheated for 0.6 h at 56°C, dewaxed in xylene, and rehydrated by graded alcohol. Antigens were recovered by heating in citrate buffer (pH 6.0) for 20 minutes and quenched in a methanol and hydrogen peroxide bath for 30 minutes to quench endogenous peroxidase activity. Samples were then incubated overnight at 4°C with mouse antibodies and biotinylated goat anti-mouse or rabbit IgG antibodies labeled with streptavidin-horseradish peroxidase (HRP) using a DAB staining kit according to the manufacturer's instructions. Five representative high-magnification fields (400x magnification) are selected for each tissue section for histological evaluation. For each protein, two parameters, positive rate (PR) and staining intensity (SI) were used to describe the range and intensity of expression based on the positively stained cells in the sample. The scoring criteria were: positive staining for GAB1 and YAP1, and VASH2 showed only cytoplasmic staining with dark red granules. According to the specific detailed antibody instructions, positive and negative control, experimental sections were set up. Each pathological section was randomly selected by two pathologists in 10 fields of view under high magnification, and the results were judged by two scoring indexes, including the percentage of positive cells and staining intensity, in addition to the determination of target protein localization. Staining intensity was scored: 0 for no staining, 1 for light red, and 2 for dark red; the percentage of positively expressing cells was scored: 0 for ≤ 5%, 1 for 6–25%, 2 for 26–50%, and 3 for more than 50%. The 2 scores were multiplied and 0–2 was considered negative and greater than or equal to 3 was considered positive.
1.6 Protein Blotting Analysis
Cells were harvested and washed twice with PBS (pH 7.4, 0.15 M), and total protein was extracted with RIPA buffer (Beyotime, Shanghai, China). Approximately 30 µg of total protein was subjected to SDS-PAGE and transferred to PVDF membranes, which were then blocked with 5% skim milk in TBST and incubated with primary antibody (1:1,000) containing 5% BSA overnight at 4° C. The membranes were washed three times with TBST and incubated with HRP-coupled secondary antibody (1:4,000; Santa Cruz, Dallas, TX, USA) for 2 h at room temperature using enhanced chemiluminescence reagents (Chemicon International, USA) exposure and then re-probed-with-anti-β-actin-antibody (Santa Cruz, Dallas, TX, USA) at a dilution of 1:2,000 to confirm the same protein loading. Detection of VASH2, Smad4, Smad2 + 3, Mmp2, Bcl-2, Caspase3.
1.7 Cell Counting Kit 8 (Cck-8) Assay
The transfected groups of cells (8×10 3 ) were inoculated into 96-well plates and incubated with CCK-8 solution (10 µL; Zhongshan JinQiao, China) at different periods (2, 24, 48, 72, and 96 h) and 37°C for 2 hr. Cell viability was expressed by absorbance measured at 450 nm.
1.8 Transwell Assay
Matrigel and Transwell were used to perform Daoy cell invasion assays to construct invasion chambers for the separation of highly invasive and less invasive cells. Cells were inoculated in Matrigel at a density of 1 × 10 5 cells and 100-µL serum-free RPMI-1640 in a 24-well plate Transwell system (Corning, NY, USA) with an 8-µm pore size polycarbonate filter membrane. The lower chamber contains a medium containing 10% FBS. Cells were incubated for 48 h. Cells on the lower surface of the membrane were then fixed in methanol and stained with 1% crystal violet. The stained membranes were photographed by microscopy and the invading cells were counted. The experiment was repeated at least 3 times.
1.9 Flow Cytometry
The concentration of antibody used for staining and the co-incubation time was calculated according to the manufacturer's instructions. 12.5 µg/mL of PE anti-human flatfoot protein antibody was used. 1 × 10 5 cells were resuspended in 100 µL PBS before washing and fixation with 4% paraformaldehyde. no cells were permeabilized because all protein markers were membrane proteins. Samples were analyzed by BD FACS Aria flow cytometry (BD Biosciences).
1.10 Statistical Analysis
Data were analyzed using SPSS 17.0. Quantitative data were expressed as mean ± standard deviation, and Student's t-test was used to analyze statistical comparisons between the two groups. For more than two groups, one-way ANOVA was used to assess differences between all groups, and then the least significant difference (LSD) method was used to compare differences between the two groups. Statistical significance was set at P < 0.05.