Aurora kinase inhibitors regulate T memory stem cell phenotype in T cell receptor-engineered T cells with prolonged persistence

doi:10.21203/rs.3.rs-2352106/v1

Download PDF

Research Article

Aurora kinase inhibitors regulate T memory stem cell phenotype in T cell receptor-engineered T cells with prolonged persistence

https://doi.org/10.21203/rs.3.rs-2352106/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Adoptive T cell therapies including T cell receptor-engineered T (TCR-T) cell therapy are limited by poor in-vivo persistence. According to literature, aurora kinase inhibitors elicit glycolysis suppression and fatty acid oxidation enhancement. Less differentiated memory T cells rely more on fatty acid oxidation with better proliferative potency. Therefore, this study aims to determine whether aurora kinase inhibition during TCR-T cell preparation and expansion promote a more long-lived phenotype leading to T cells with increased in vivo persistence and efficacy.

Methods

The study involves preparing TCR-T cells with aurora kinase inhibitors for 7 days with anti-CD3/CD28 beads and IL-2. And the antitumor effects of these TCR-T cells were investigated in vitro and in subcutaneous and metastatic melanoma models.

Results

TCR-T cells cultured with aurora kinase A and B inhibitor generated more effector T cells (~ 79% and ~ 77%) when compared to cells with beads alone (~ 36%) after in-vitro re-stimulation. And aurora kinase B inhibitor-treatment benefits in vivo persistence of TCR-T cells and extends survival in both subcutaneous and metastatic melanoma model. Phenotypic analysis shows an increased percentage of T cells stem cell-like memory properties in terms of aurora kinase inhibition. The stemness of T cells is maintained by delaying proliferation mediated by limitation of mTOR activity.

Conclusion

Taken together, these data suggest that incorporation of aurora kinase inhibitor in TCR-T cells preparation might be a potential method to generate long-live TCR-T cells with potent therapeutic characteristics.

T-cell receptor-engineered T cells

T cell stemness

Aurora kinase

In-vivo persistence

Adoptive T cell therapy

Solid tumor

Involvement of aurora kinase inhibitor in TCR-T cells preparation showed enhanced therapeutic benefits in solid tumor.
Aurora kinase inhibition in T cells inducing less-exhausted T cells with stem cell-like memory properties and improve persistence of TCR-T therapy.
Stemness of T cells was maintained by delay and proliferation differentiation through suppressing on activity of mTOR substrates.
In-vitro combination of aurora kinases inhibitor with TCR-T cells provides new opportunities for these inhibitors to improve their anticancer effect.

Although adoptive T cell transfer therapy (ACT), for example, T cells receptor-engineered T cell (TCR-T) and CAR-T cell therapy, achieved outstanding progress in solid tumor treatment, therapeutic success is still limited, partly due to insufficient in-vivo persistence and activity of adoptive T cells [1–3].Therefore, it is important to develop methods that can overcome these limitations. The cellular phenotype of final adoptive T cells determines their in-vivo immune capacity [4, 5]. Therefore, to improve ACT, a promising strategy is pharmacological manipulation during in-vitro T cell production, by combining monoclonal antibodies or small molecule inhibitors that might positively influent the activity and persistence of T cells.

Stem cell memory-like T (T_SCM) cells, which could generate all conventional memory T cells [6], exhibited long-term persistence and produce strong effector function than effector T cells [7–9]. Since cellular differentiation depends crucially on division state [10], T_SCM cells can be generated by inhibiting cell cycle progression and differentiation. Multiple small molecule inhibitors have been reported to induce T_SCM and central memory T (T_CM) cells, in the manner of interruption of the T cell differentiation process from T_SCM cells towards terminally differentiated T effector-like (T_EFF) cells. For instance, mTOR inhibitors could increase expression of Bcl-2 and CD62L, which are associated with T memory [11, 12].

Inhibition of MEK potentiated the generation of CD8⁺ T_SCM cells [13]. Other protein kinase inhibitors, including Akt inhibitor and PI3K inhibitor [14–17], have also been successfully used to render T cells with stemness and memory properties. And ex vivo treatment of anti-CD19 CAR T cells with BTK inhibitors, hindering T cell differentiation through inhibition of interleukin-2-inducible T cell kinase, therefore mediated a less differentiated T cell phenotype [18]. In addition, treatment of T cells with the epigenetic modulator BRD4, influencing differentiation into a T_EM cells, showed promising effects on adoptive immunotherapy [19, 20].

Aurora kinase has emerged as a potential drug target for antitumor studies [21, 22]. These aurora kinase inhibitors (AURKi) targeted mitosis by blocking mitotic kinases, such as aurora-A and aurora-B, which are involved in uncontrolled proliferation of tumor [23–26]. Some of these relevant inhibitors (e.g. Alisertib) are already being evaluated in ongoing clinical trials, however, they have failed in the late stages due to inadequate efficacy [27, 28]. Therefore, further investigations are required to improve their antineoplastic effect. Another reason that limits their therapeutic effectiveness is the resistance to therapy. Nguyen et al had investigated aurora kinase A inhibitor (AURKAi) on glioblastoma, and revealed that resistance to AURKAi was caused by enhanced fatty acid oxidation (FAO) and increase expression of PGC1α [29]. These two features, on the other hand, links to naïve-like or stem-like T cells, which are more resistant to functional exhaustion and generate long-lasting immune memory [13]. Not as well known whether aurora kinase might also influence T cells in the same manner. Recently, it has been demonstrated that aurora kinase B combined with mTOR and surviving to regulate G1-S cell cycle checkpoint of T cells [30]. All these findings enlightened us to explore the role of aurora kinase inhibition in T cell proliferation, metabolic reprogramming and direction of T_SCM cell phenotype. This is essential to develop new strategies utilizing aurora kinase inhibitors, so that to overcome their limitation.

Accordingly, we investigated whether aurora kinase inhibition affects persistence and activity of T cells and how the derived knowledge from this study can be leveraged for the development of strategy used to combine TCR-T therapy in vitro with aurora kinase inhibitors, with the aim of exploring new potency of these small molecule inhibitors and improving immune efficiency of ACT. We made the important finding that treatment with AURKi, especially aurora kinase B inhibitor (AURKBi), renders TCR-T cells potent antitumor effects and prolonged survival in tumor-bear mouse models. The response to AURKBi depends on controlling proliferation of T cells during TCR-T cell production. In this manner, the final TCR-T cells became stem-cell like T cells that dependent on fatty acid oxidation.

Manufacturing Of Aurki-treated Tcr-t Cells

Lentiviral plasmids containing HLAA2 restricted NY-ESO-1 specific TCR α and β chains were generated by standard molecular cloning methods. Briefly, a DNA fragment containing the TCR α-P2A-TCR β chain or was generated by overlap PCR and cloned into the pCDH-EF1a vector (System Biosciences). Lentivirus was produced by transient transfection of Lenti-X 293T with a four-plasmid system. Supernatants containing lentivirus particles were collected at 48 and 72 hours after transfection and concentrated by ultracentrifugation. Human peripheral blood mononuclear cells (PBMCs) from healthy donors were purchased from Hemacare BioResearch Products & Services (catalog no. M009C-2) and confirmed to be HLAA2 positive by FITC-anti-HLAA2 antibody (BD Pharmingen, catalog no. 551285). PBMCs were either frozen or further enriched for naive CD8⁺ cells by Naive CD8 + T Cell Isolation Kit (Miltenyi, catalog no. 130-093-244) before freezing. Dynabeads Human T-Expander CD3/CD28 (Gibco, catalog no. 11141D) was used to activate naïve T cells in X-VIVO 15 medium containing 5% human AB serum (Valley Biomedical) supplemented with 10 ng/ml IL-2. To generate AURKi-treated TCR-T cells, additional Alisertib (Selleck, catalog no. S1133) or Barasertib-HQPA (MCE, catalog no. HY-10126) were added. In some experiments, etomoxir (MCE, catalog no.HY-50202) was also added in the medium. Twenty-four hours after activation, TCRαβ-containing lentiviruses were used to transduce T cells at a multiplicity of infection of 30. T cells were expanded for 4 more days in media after removal of the activating beads on day 4.

Tumor Establishment And Mice Treatment

For subcutaneous tumor model, BALB/C nude mice were injected subcutaneously with 1 × 10⁶ A375 cells per mouse in the right flank. For metastatic tumor model, BALB/C nude mice were injected with 2 × 10⁶ A375 cells per mouse via tail vein. Human TCR-T cells (6×10⁶/mouse) were transferred into tumor-bearing mice via tail vein. Treatment in respective groups was started when tumors reached an average size of approximately 0.075 cm³. In some experiments, tumors were collected and processed as described below. Tumors were measured every 3–4 days using a digital vernier caliper, and the tumor volume was calculated using the formula: V = L × W²/2, where V is tumor volume, L is the length of the tumor (longer diameter) and W is the width of the tumor (shorter diameter). Mice were monitored for tumor growth and survival. Mice were killed when the tumor volume reached 2.0 cm³. All experiments involving animals were conducted according to the ethical policies and procedures approved by the institutional animal care and use committee of Sichuan University, China (Approval no. 2021619A).

Flow Cytometry

Fluorochrome-conjugated monoclonal antibodies were purchased from eBioscience, BD Bioscience or Life Technologies. Staining was performed in 1% FBS/PBS for 30 min on ice. For intracellular cytokine staining, cells were reactivated with PMA (50 ng/ml; Sigma) and ionomycin (500 ng/ml; Sigma) in the presence of brefeldin A (0.1%; Biolegend) for 5 h before fixation using Cytofix Cytoperm (BD Bioscience), except for the spheroid co-cultures, where brefeldin A was added directly into the co-culture (without extra re-stimulation) 5 h before staining. All reagents were used as the manufacturers’ instructions. T cells from tumor samples were stained and analyzed similarly by flow cytometry (BD FACSCelesta). The anti-human antibodies used for flow cytometry measurements were: PE- Granzyme B (eBioscience, catalog no. 12-8899-41), PECF594-CD8 (BD Biosciences, catalog no. 562282), BV510-PD-1 (BD Biosciences, catalog no. 563076), BUV496-TCR Vβ8 ((BD Biosciences, catalog no. 749872), Alexa Fluor 488-IFN-γ (eBioscience, catalog no. 53-7319-42), AF700-CCR7 (BD Biosciences, catalog no. 561143), Alexa Fluor 532-CD62L (eBioscience, catalog no. 58-0629-42), APC-CD44 (eBioscience, catalog no. 17-0441-82), PerCP-eFluor-710-CD122(IL2Rβ) (eBioscience, catalog no. 46-1228-42), PE-CXCR5 (eBioscience, catalog no. 12-9185-42), TCF7 Monoclonal Antibody (Invitrogen, catalog no. MA5-14965), PE-PD1 (eBioscience, catalog no. 12-9969-42), PerCP-eFluor™ 710-CD223 (LAG-3) (eBioscience, catalog no. 46-2239-42) and FITC-Annexin V (eBioscience, catalog no. BMS147FI). Fluorochrome-labeled anti-rabbit antibody used was: Alexa Fluor™ 700-Goat anti-Rabbit IgG (H + L) (Invitrogen, catalog no. A-21038). Mitochondrial membrane potential was detected by Mitochondrial Membrane Potential Assay Kit with TMRE (Beyotime, catalog no. C2001S). FlowJo software was used to generate the derived parameter of the two fluorescent signals.

CFSE labelling assay

Cell proliferation was detected by Carboxyfluorescein diacetate, succinimidyl ester (CFDA SE) (Beyotime, catalog no. C1031) labelling. T cells were incubated for 5 minutes at 37℃ with 1 mM CFDA SE in PBS, and then washed extensively. After penetrating the cell membrane, CFDA SE transforms into CFSE, which can occasionally and irreversibly bind to lysine residues or other amino groups of proteins, and thus label the cells. About 24 hours after the probe treatment, cells can be fully labeled, so we measured proliferation of T cells by the relative CFDA SE dilution method after that. For other experiments, cells were labeled by CFDA SE before re-stimulating. To analyze cell cytotoxicity of T cell, A375 cells were labeled by CFDA SE before co-incubated with T cells at the ratio of 1:1. After co-culturing for 24 hours, PI was added before analyzed by FACS. CFSE⁺PI⁺ cells were considered as dead tumor cells. The tumor cell viability was calculated as CFSE⁺PI⁻ cells/( CFSE⁺PI⁻ + CFSE⁺PI⁺) cells. And cell cytotoxicity was calculated as (1-viability)×100%.

Cell Viability Detection

T cells were seeded in 96-well plate and incubated for 24 hours before antibodies was added, and then incubated for another 8 days, the medium was refreshed every 3 days. 10 µl of CCK8 was added at the indicated time, and then incubated for 1–4 hours before analyzed for absorption (optical density). The percentage of cell viability was calculated as (A_experiment-A_blank)/(A_control- A_blank)*100%.

Western Blot

Western blot

T cells were treated as described above. Cell lysates of T cells were prepared following various treatments. Protein concentrations in cell lysates were determined by Pierce BCA Protein Assay Kit (ThermoFisher Scientific, catalog no. 23225). Protein (30–40 µg) was loaded onto Novex 12% Tris-Glycin Mini Gels (ThermoFisher Scientific, catalog no. XP00125BOX) followed by transfer onto nitrocellulose membranes. Membranes were blocked with 3% BSA in Tris buffer followed by overnight probing with antibodies against mTOR, p-mTOR, 4E-BP and p-4E-BP by western blot. The blots were developed with appropriate (anti-rabbit) HRP-conjugated secondary antibodies. The level of β-actin was used as a control. Anti-mTOR (catalog no.2983), anti-phospho-mTOR (catalog no.5536), anti-4E-BP (catalog no.9644) and anti-phospho-4E-BP (catalog no.2855), horseradish peroxidase (HRP)-labeled secondary antibodies were purchased from Cell Signaling Technology.

Histopathological Analysis

Tumors were resected from the mice and fixed with neutrally buffered 3.5% formaldehyde, and applied to hematoxylin and eosin (HE) staining conducted by Biopathology Institute Co., Ltd. (Kunisaki, Japan).

Lactate And 3-hyroxybutyrate Quantification

Lactate and 3-hyroxybutyrate quantification were performed using Lactate Assay Kit (Sigma-Aldrich, catalog no. MAK064) and β-hyroxybutyrate (BHBA) Assay Kit ( Biovision, catalog no. K632-100 )as the manufacturers’ instructions.

Real-time RT-PCR

Sybr Green I dye and an ABI GeneAmp 5700 sequence BioDetector (Applied Biosystems) were used for quantitative RT-PCR. Total RNA was extracted with TRIzol (Invitrogen) and was reverse-transcribed with oligo(dT)12–18 (SuperScript II; Invitrogen). Expression of Glut1 (F- TTGCAGGCTTCTCCAACTGGAC; R- CAGAACCAGGAGCACAGTGAAG), HK2 (F-CGGCCGTGCTACAATAGG; R-CTCGGGATCATGTGAGGG), PRF1 (F-GCTATCGTTAGTGCTAGTGGAT; R- ATCTGTCTGATGCGTATCCAAT) IFNg (F-GAGATGACTTCGAAAAGCTGAC; R-CCTTTTTCGCTTCCCTGTTTTA), TCF7 (F-GTACAAAGAGACCGTCTACTCC; R-GGCTGTTGAAATGTTCGTAGAG), Bcl2 (F-GACTTCGCCGAGATGTCCAG; R-GAACTCAAAGAAGGCCACAATC), SIRT3 (F-GCCATTTTTGAACTCCCATTCT; R-GGAGAAAGTAGTGAGTGACGTT), CPT1A (F-GATTTCCATTCCTTCCCATTCG; R-CTCGTATGTGAGGCAAAACTTG) and PGC1α (F-TCCAGGTCAAGATCAAGGTCTCCAG; R-GTGCGTGCGGTGTCTGTAGTG) were analyzed. Data were procured using StepOnePlus Real-Time PCR System from Applied Biosystems and normalized to the geometric mean of the housekeeping gene Actb (β-actin).

Statistical analysis

For adoptive transfer experiments, recipient mice were randomized before cell transfer. Tumor measurements were plotted as the mean ± SEM for each data point, and tumor treatment graphs were compared by using the Wilcoxon rank sum test and analysis of animal survival was assessed using a log-rank test. In all cases, two tailed test with P values of less than 0.05 were considered significant (*P ≤ 0.05; ***P ≤ 0.001; ****P ≤ 0.0001; ns, not significant). Statistics were calculated using GraphPad Prism 7 software (GraphPad Software Inc.).

Aurora kinase inhibitors (AURKi) -induced TCR-T cells lead higher recall response and longer lasting anti-tumor immune effect

Since combining small molecular inhibitors with T cell therapy is proven to overcome the limitation faced by T cell therapy alone [31]. To determine whether AURKi own potency to enhance TCR-T cells, we developed an in-vitro combination approach by adding AURKi (Alisertib and Barasertib-HQPA) in TCR-T cell preparation process.

The potency to produce more antigen-specific effector T cells is essential to determine in vivo immune response of T cell therapy [32]. Therefore, we first examined the recall response and antitumor effect of AURKi-treated TCR-T cells in an ACT tumor model. TCR-T cells were produced from isolated naïve T cells. Isolated human T cells were incubated with 10 µM of Alisertib - an aurora A inhibitor (AURKAi), and 10 nM of Barasertib-HQPA - an aurora B inhibitor (AURKBi), at the time the cells were activated, followed by specific lentivirus infection.

Then the NY-ESO-1-specific TCR-T cells were amplified in the presence of IL-2 for another 4 days. The viability of T cells was not significantly affected at the concentration of both drugs even for 8 days of incubation (Fig. S1A, B). We also determined the specific functionality of the harvested TCR-T cells. Upon stimulation of NY-ESO-1 peptides and A375 cells (NYESO1⁺HLAA2⁺), expression of effector function markers (IFN-γ, GZMB) and cytotoxicity in AURKi (AURKAi, AURKBi)-treated TCR-T cells were similar to that in control TCR-T cells (Fig. S1C-E), indicating that drugs involvement would not significantly affect specific TCR transduction and expression.

After being re-stimulated with NY-ESO-1 peptides for another 2 days, both AURKAi-TCR-T cells and AURKBi-TCR-T cells produced more CD62L-CD44 + effector T cells than control TCR-T cells (Fig. 1A,B), indicating a stronger antitumor potency. We next tested the immune effects of AURKi-TCR-T cells, in a subcutaneous tumor model that carry specific human antigens, NY-ESO-1 (Fig. 1B).

Upon tumor formation, mice were either treated with or without TCR-T cells. And the TCR-T cells were pretreated with or without AURKi. AURKi, especially AURKBi significantly enhanced antitumor response of TCR-T cells and revealed a prolonged overall survival (Fig. 1C-E). As the results showed, all mice survived in the AURKBi-TCR-T group, while only 60% and 0% survived in other TCR-T groups and no treatment group, respectively (Fig. 1E). Following FACS analysis of tumor infiltrated lymphocytes (TILs) on day 10 after treatment, we found that total CD8⁺T cells in AURKi-TCR-T groups, both AURKAi- and AURKBi-TCR-T groups, significantly exceeded those in conventional TCR-T group. And AURKBi pretreatment produced even more CD8⁺ TILs than AURKAi pretreatment (Fig. 1F). A significant increased percentage of CD8⁺T cells in AURKAi-TCR-T and AURKBi-TCR-T expressed activation markers (IL2Rβ and CXCR5) than those in conventional controlled TCR-T groups were observed (Fig. 1G). We also found an increase in granzyme B and IFN-γ expressed TILs, while an decrease in CD8⁺ T cells expressing inhibitory receptors (LAG3) (Fig. 1H, I), indicating that transferred AURKi-TCR-T cells expanded to functional effector T cells with less exhausted state.

The increased functional effector T cells may benefit from stronger immume memory, as this was confirmed by the observation that more CCR7⁺, TCF1⁺ and CD62L⁺ TILs in AURKi-TCR-T groups compared with those in controlled TCR-T group (Fig. 1J, K). Furthermore, AURKBi-TCR-T group showed higher potency to produce T cells with stem memory phonotypes than AURKAi-TCR-T group did, therefore, persistently generated more CD44⁺ effector T cells even on day 40 after treatment (Fig. 1L). Together, these data show that AURKBi potentially enhances antitumor effects of TCR-T cells, by in-vivo generating more less-exhausted, activated effector T cells, which may drive by larger number of TCR-T cells maintained their stem memory phenotypes.

Dose- and time-dependent AURKB inhibition generates less-exhausted TCR-T cells

Given the in-vivo generation of more stem-like and less-exhausted T cells due to transferred of AURKBi-treated TCR-T cells, we further assessed whether in-vitro AURKB inhibition is directly implicated in the increase of stem memory related markers. To this end, differently concentration of AURKBi was integrated into TCR-T cell preparation, and following expression of CD62L and CCR7 in T cells were analyzed. We found that in a specific range (0–20 nM), the percentage of CD62L- and CCR7-positive CD8 + T cells were elevated (Fig. 2A), suggesting that indeed AURKB inhibition lead to maintenance of naïve- and memory-like properties, and this partially depended on the dose of AURKBi. Next, we used 10 nM and 20 nM of AURKBi, which showed the most significant inducing effect, to address TCR-T cells followed by further investigation of states and phenotypes of the harvested TCR-T cells (Fig. 2B). After IL-2 induced extension, TCR-T cells without AURKBi treatment (Ctrl) or with AURKBi at both concentrations formed proliferation aggregates. Despite that 20 nM of AURKBi leaded to slightly smaller aggregates (Fig. 2C), T cell proliferative ability was not significantly affect in these treatments, as determined by the CFSE labelling (Fig. 2D). Furthermore, we characterized AURKBi-induced TCR-T cells for their memory formation. The proportion of T_CM (CD62L⁺CD44⁺) cells from AURKBi-induced TCR-T cells was similar to that from control TCR-T cells, while the presence of AURKBi resulted in a significant increase in a naïve like phenotype (CD62L⁺CD44⁻) (Fig. 2E). However, unlike naïve cells, these AURKBi-induced TCR-T cells showed higher expression of activation markers (CXCR5 and IL-2Rβ) (Fig. 2F, G). Besides, these naïve-like T cells expressed significantly lower levels of exhaustion (LAG3) (Fig. 2H) and effector function-associated mRNAs (IFNg, PRF1) (Fig. 2I, J). Besides having higher expression of memory (CCR7) marker, AURKBi-induced TCR-T cells also showed upregulated expression of TCF7 and Bcl2 (Fig. 2K, L), which are associated with increased stemness and prolonged survival [33–35]. In addition, these CD62L⁺CD44⁻ T cells in the AURKBi-treated groups showed significant higher proliferative ability (Fig. 2M). And AURKBi-treated T cells also showed reduced apoptosis, as confirmed by lower fluorescence intensity of annexin V (Fig. 2N).Together, AURKBi treatment induced a subgroup of T cells sharing both naïve and memory characteristics. Earlier, a population of less differentiated T cells with stem memory properties, possessed intermediate state between naïve T cells and T_CM cells, has been described [36]. Hence, these data together suggested that AURKB inhibition promoted production of a subset of T cells that are more like stem memory T (T_SCM) cells.

Above observations prompted us to test whether this inducing effect becomes stronger with extended co-incubation time, and further optimize the treatment. We compared percentage of CD62L⁺CD44⁻ T cells between two preparation programs (Fig. 3A). The results showed that late removal of AURKBi (program 2) increased CD62L⁺ T cell population than early removal (program 1) (Fig. 3B, C), indicating the time-dependent effect of exhibit AURKBi induction. However, the total number of cells harvested from program 2 was less than that from program 1 ((Fig. 3D). Despite this, TCR-T cells generated by program 2 exhibited more potent tumor suppression effects and extended survival (Fig. 3E, F). All these data suggested that AURKB inhibition assisted T cells maintained their stem-like phenotypes in a dose- and time-dependent manner, therefore, generated less-exhausted TCR-T cells. Although longer co-incubation of AURKBi slightly attenuated cell extension, it enhanced persistence of TCR-T cells in vivo.

AURKB inhibition mediated enhancement in FAO that maintains stem memory properties

To further characterize T_SCM properties of AURKBi-induced TCR-T cells, we added AURKBi during the whole procedure of TCR-T cells preparation and expansion (Fig. 4A), and observed the harvested TCR-T cells by TMRE (tetramethylrhodamine, ethyl ester), which is used for quantifying changes in mitochondrial membrane potential. We observed lower fluorescence intensity of TMRE in TCR-T cells treated by AURKBi, which acts as a factor of lower mitochondrial potential, a further indication of stem-like characteristics [37]. And 20 nM of AURKBi acquired more significant decrease than 10 nM of AURKBi did (Fig. 4B), again demonstrated this dose-dependent inducing effect by AURKBi treatment in vitro.

Enhanced fatty acid oxidation (FAO) is a strong indicator of memory and long-term cell survival of T cell, and is also a critical factor for stem cell –like memory T cells [38]. Therefore, we next determined the status of FAO in the AURKBi-treated TCR-T cells. AURKBi-mediated TCR-T cells displayed elevated production of β-hyroxybutyrate (BHBA) (Fig. 4C), the final production of fatty acid β-oxidation [39]. In line with this, we found increased and increased expression of CPT1A (Fig. 4D), a rate limiting enzyme of FAO [38], thus showing enhancement of FAO by AURKBi-treated TCR-T cells. Furthermore, we found SIRT3, the downstream of PGC1α [40], was also increased in TCR-T cells after AURKBi inhibition (Fig. 4E, F). In contrast, a suppression effect on Glut1 and HK2 was observed in AURKBi-mediated TCR-T cells (Fig. S2). As a consequence, these TCR-T cells weakened their glycolytic metabolism, resulting in reduced levels of lactate in the culture supernatants (Fig. 4G). These data showed that AURKB inhibition promotes FAO and decreases glycolysis.

To further confirm that enhanced FAO is correlated to T_SCM inducing, we tested whether the increase of T_SCM properties related to AURKB inhibition is attenuated in the context of the combination treatment with etomoxir (Fig. 4H), an inhibitor of CPT1A. The expression of CD62L and CCR7 on T cells, the indicators of naïve and memory phenotypes, were markedly decreased in TCR-T cells with combined treatment compared with those treated with AURKBi alone (Fig. 4I, J). Besides, effector markers (IFN-γ and GZMB) were lower while exhausted marker (LAG3) was higher in terms of combination treatment with etomoxir (Fig. S3). Altogether, these results demonstrated that AURKBi induced T_SCM cells by reprogramming glycolytic-based into FAO-based metabolic programme.

AURKBi induces TSCM cells by decreasing cell proliferation that depends on controlling mTOR substrates

Although short-term incubation of AURKBi did not significantly affect cell proliferation (Fig. 2B), it does maintained T_SCM attributes. Therefore, we next determined how AURKBi affect cell differentiation in this short-term manner (Fig. 5A). We found that the majority of the cells differentiated to effector T (T_EFF) and central memory T (T_CM) cells, while AURKB inhibition enriched T_SCM cells even in the early generations (generations 0 and 1). Indeed, the proportion of T_SCM increased in the new generations (generations 2 and 3), especially when higher dose of AURKBi (20 nM) were involved (Fig. 5B, C). These results confirmed the dose-dependent effect of AURKBi, and prompted us to further determine whether AURKBi affect cell proliferation and differentiation cycle in time-dependent manner. We observed long- term AURKB inhibition significantly decreased cell proliferation (Fig. 5D, E).

Given the fact that retroviruses (including lentivirus) exclusively infect dividing cells [41], we tested the expression of Vβ8, which indicated transduction efficiencies [42], between control TCR-T cell and the TCR-T cell mediated by AURKBi. Surprisingly, only marginal differences in transduction efficiencies were observed. The transduction efficiencies were relatively high for all groups, about 72%, 70% and 65% separately (Fig. 5F). Despite that restraining T-cell expansion and slightly reducing the transduction efficiency, long-term and high-dose of AURKB inhibitions generated about 4-fold higher expression of CD62L and CCR7, which indicating T_SCM properties, than those without AURKBi (Fig. 5G-K). AURKBi caused an increased accumulation of cells in the earlier generations of cell division, indicating a delay in the cell cycle progression. But AURKB inhibition does not significantly affect T cell activation, as was confirmed by similar expression levels of p-PI3K and p-Akt (Fig. 5L, M), which involved in mediating T cell activation [13]. mTOR signal is critical to promote cell cycle progression and cell growth [43]. Earlier, it has been suggested that aurora B is required to fully activated 4E-BP1, a downstream substrate of mTOR, and enhanced phosphorylation of mTOR [30, 44]. Accordingly, we checked the effect of AURKBi on phosphorylation of mTOR and 4E-BP1. As anticipated, in the presence of AURKBi, phosphorylation of mTOR and 4E-BP1 was suppressed (Fig. 5N, O, and Fig. S4), indicating AURKB inhibition directly or indirectly control the activity of mTOR signal. Hence, AURKBi delay cell cycle progression and inhibited their further differentiation without affecting activation of T cells.

Besides, previous studies have demonstrated that MEK and GSK-3β inhibitors involving in the activation of naïve T cells can generate T_SCM cells [13, 45], suggesting that it is the unactivated T cells that be induced into T_SCM cells during their priming process. In this study, we also determine the state of T cells that can be more likely to generate T_SCM cells. In line with previous studies, naïve T cells were robustly reprogrammed into T_SCM cells in their priming process while treated with AURKBi. However, the control TCR-T cells, although still produced T_SCM cells while being treated with AURKBi during second stimulation, generated much less number of T_SCM cells than those treated with AURKBi during the priming procedure (Fig. S5). This observation may attribute to the fact that the proportion of naive T cells decreased in preactivated T cells.

AURKBi-induced TCR-T treatment in BALB/C-nude mice with metastatic tumor from human melanoma

Since we demonstrated that in a long-term and high-dose manner, AURKB inhibition could reprogram TCR-T cells with more T_SCM properties, which may be more potent than conventional TCR-T cells in treatment of solid tumor. Finally, we established a new method for preparing improved TCR-T cells by preparing TCR-T cells for a total of 7 days commitment with incubation of 20 nM of AURKBi. To demonstrate the superiority of the TCR-T cells produced by the method, we first initiated the in vivo studies with metastatic melanoma model, which is more challenged to be treated than subcutaneous model.

The tumor model was established by injecting A375 cells from tail veils (Fig. 6A). After a week, tumor nodes were observed in lung (Fig. 6B), and mice were randomly divided into three groups: no treatment control, conventional TCR-T, and AURKBi-TCR-T. We detected a stronger suppression in tumor growth in mice that received AURKBi-TCR-T cells as compared to no treatment control and conventional TCR-T groups (Fig. 6C). Mice that received AURKBi-TCR-T cells also had a significantly prolonged survival (Fig. 6D). Given that fresh active T cells with effective anticancer activity is largely provided by peripheral tissues [46], we compared the number and state of T cells from blood and spleen between conventional and AURKBi-TCR-T groups, at day 17 and 29 after tumor cell injection. At 17 day, we found that the two cell populations (conventional or AURKBi- TCR-T) had equal levels of T cells in blood and spleen (Fig. 6E, F), and these T cells expressed equal level of exhausted markers (PD1 and LAG3), effector function marker (IFN-γ) and activation markers (CXCR5 AND IL-2Rβ) (Fig. S7). But AURKBi- TCR-T group showed higher expression of stem memory makrers-CCR7 and CD62L (Fig. 6G and Fig. S7), suggesting that AURKBi- induced T_SCM cells kept in a relative rest state without meeting large number of tumor antigens in peripheral tissues. However, the population of total T cells and CD62L⁺ T cells in blood and spleen decreased at day 29 (Fig. S8), partially due to that they were recruited into the tumor. This was confirmed by the observation that AURKBi-TCR-T cell transfer presented higher frequencies of CD8 + T cells in the tumor, at day 29, compared to conventional TCR-T cell transfer (Fig. 6H). Furthermore, intratumoral AURKBi-treated CD8⁺ T cells showed higher expression of CD62L, CD44, CXCR5 and IL2-Rβ expression (Fig. 6I, J and Fig. S9), indicating maintenance of stem-like phenotype and production of more activated effector T cells at the same time in AURKBi-treated CD8⁺T cell compared to non- AURKBi-treated cells. In addition, AURKBi-treated CD8⁺T cells exhibited equal expression of PD-1, with a significantly lower expression of LAG3 compared to non- AURKBi-treated cells, showing effectively activated and less-exhausted state in AURKBi-treated CD8 + T cells (Fig. 6K, L). These result demonstrated that AURKBi-induced TCR-T cells maintained T_SCM population in vivo that played as reservoir for effective tumor infiltrated T cells, which showed potential to effectively suppress metastatic tumor.

As a stand-alone, T cell therapy has failed to provide durable responses in a large range of patients, especially those with solid cancers. On the other hand, aurora kinase inhibitors (AURKi) have shown poor clinical outcome owing to resistance and insufficient response. Currently, strategies blending immunotherapies with small molecular inhibitors exhibit potential advantages in treatment of solid cancer [31]. This combination effect is mediated, in part, by improving antigen presentation and modulation of the TME. For instance, thioredoxin-reductase inhibitor has been demonstrated to convert immune ‘cold’ tumors into immune ‘hot’ tumors [47]. Similarly, BRAF and VEGFR inhibitors increased T cell infiltration into tumors and improved in vivo cytotoxicity [48, 49]. The effects of MEKi on T cell functionality, and their differentiation and memory generation, are further elucidated. A prominent example is a study demonstrating the improved efficacy of CD8⁺ T cells with the treatment of MEK inhibitors, which regenerated stem cell–like memory (T_SCM) cells[13]. Furthermore, AKT inhibition enhanced ACT in vivo by reprogramming of the transcriptional profile of CD8⁺ T cells into memory cells. These evidences could be rationalized into combination approaches with ACT for better clinical outcomes. Aurora kinase A inhibition has been shown to suppress glycolysis, resulting in stalling cell proliferation of GBM cells, and it concomitantly drive FAO that mediated by increase of PGC1α [29]. And these metabolic features seemed to be shared by T_SCM cells [13, 50]. However, the impact of AURKi on T cell fate remains enigmatic. An understanding of their immune modulatory mechanisms may provide new promises to overcome their limitations and develop new and effective therapeutic strategies utilizing AURKi and T cell therapy alone. Usually, small molecule inhibitors could be combined with ACT in two ways: in-vitro and in vivo [51].

In this study, we combined AURKi in vitro during TCR-T cell production, in order to assess the effect of AURKi on T cells directly. AURKAi is previously demonstrated to enhance FAO and delay cell proliferation of GBM cells, we here found AURKBi stalled cell cycle progression and drove FAO in T cells, resulting in the generation of T_SCM phenotypes. While this effect is negative for GBM treatment-caused escape mechanism of GBM cells, it is positive for ACT treatment-generate potent T_SCM cells. Moreover, AURKBi is stronger than AURKAi involved in ACT strategies, as confirmed by the observation that AURKBi-treated TCR-T cells showed better antitumor response than AURKAi-treated TCR-T cells.

The impact of synergism profile of combination will heavily depend on their timing, sequence, and dosage [52]. To gain more insight about the impact of AURKB inhibition on cell cycle progression and differentiation of T cells, we administrated different dose of AURKBi on T cells, and found that in a distinct range, AURKBi treatment generated T cells maintained stem memory phenotype, by delaying their differentiation. Moreover, extension of incubation time based on high dose of drug not only delayed differentiation, but also delayed cell proliferation, thus produced more T_SCM cells. These findings are significant because the activity of aurora B is regulated by both TCR- and IL-2 signals [30, 53]. Therefore, long-term inhibition of aurora B not only affects TCR- but IL-2-induced cell proliferation and differentiation as well. However, although cell proliferation was decreased upon AURKB inhibiting, the expression of phosphorylated PI3K and Akt, which promotes G1-S phase progression, were not affected, suggesting that inhibition of AURKB in T cells occurs independently of PI3K signal activation. Consistently, it has been demonstrated that PI3K is the upstream regulator of aurora B, since PI3K inhibitor completely suppressed the expression of Aurora B [30]. The mTOR signal is not only critical for cell cycle progression, but also required for effector function of T cells [43]. We observed a reduction in the levels of p-mTOR, with a downregulated expression of its downstream substrate-p-4E-BP1, during TCR-T cell preparation and T_SCM cell generation with AURKBi. These results showed, the activity of mTOR was negatively affected due to the inhibition of AURKB, which was consistent with an earlier study [30]. This molecular effect contributed to delaying cell cycle progression, effector T cells differentiation and metabolic reprogramming, which finally leaded to the maintaining of T_SCM phenotype. Together, Inhibition of aurora B during T cell priming and expansion activity affected TCR-, and IL-2-signals accounted at least in part for delaying cell proliferation and differentiation, therefore, sustain stem memory T cell pool. And this effect may also depend on mTOR activity. Deep insight into the mechanism remains to be investigated.

The effect of aurora B inhibition has been studied on cell proliferation of T cells, however not on their differentiation so far. Our experiment suggested that AURKBi integration in the TCR-T cell preparation generate T_SCM T cells, via delaying both their cell cycle progression and differentiation. Given that we have validated improved antitumor effect of these AURKBi-treated TCR-T cells in subcutaneous and metastatic tumor models, AURKBi is potential to combine with different cellular therapies to enhance immune response and prolong persistence.

Acknowledgements

Not applicable.

Authors’ contributions

LY designed research, supervised the experimental work and wrote the manuscript. LY, and YM, completed the main experiments and data analysis. XL, LL and GZ provided some experimental materials; and guidance. YM, XL and LL revised the manuscript. All authors reviewed and approved the manuscript before submission.

Funding

This work was financially supported by National Natural Science Foundation of China (No. 81903148).

Availability of data and materials

All data generated or analyzed during this study are included in this manuscript and its supplementary information files.

Ethics approval and consent to participate

All experiments involving animals were conducted according to the ethical policies and procedures approved by the institutional animal care and use committee of Sichuan University, China (Approval no. 2021619A).

Consent for publication

All co-authors have read and approved the final version of the manuscript and its submission to this journal.

Competing interests

The authors declare no competing interests.

Author details

¹Department of Biotherapy, Cancer Center, West China Hospital, Sichuan University, Chengdu, Sichuan 610064, China. ²Radiation therapy and chemotherapy for cancer; Key Laboratory of Birth Defects and Related Diseases of Women and Children, Ministry of Education Sichuan University; Chengdu, Sichuan 610041, China. ³Development and Related Diseases of Women and Children Key Laboratory of Sichuan Province, West China Second Hospital, Sichuan University, Chengdu, Sichuan 610041, China.

Porter DL, Hwang WT, Frey NV, Lacey SF, Shaw PA, Loren AW, et al. Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia. Sci Transl Med. 2015;7:303ra139.
Sterner RC, Sterner RM. CAR-T cell therapy: current limitations and potential strategies. Blood Cancer J. 2021;11:69.
Stoiber S, Cadilha BL, Benmebarek MR, Lesch S, Endres S, Kobold S. Limitations in the Design of Chimeric Antigen Receptors for Cancer Therapy. Cells. 2019; 8.
Gattinoni L, Klebanoff CA, Palmer DC, Wrzesinski C, Kerstann K, Yu Z, et al. Acquisition of full effector function in vitro paradoxically impairs the in vivo antitumor efficacy of adoptively transferred CD8 + T cells. J Clin Invest. 2005;115:1616–26.
Turtle CJ, Hanafi LA, Berger C, Gooley TA, Cherian S, Hudecek M, et al. CD19 CAR-T cells of defined CD4+:CD8 + composition in adult B cell ALL patients. J Clin Invest. 2016;126:2123–38.
Yi L, Yang L. Stem-like T cells and niches: Implications in human health and disease. Front Immunol. 2022;13:907172.
Biasco L, Scala S, Basso Ricci L, Dionisio F, Baricordi C, Calabria A, et al. In vivo tracking of T cells in humans unveils decade-long survival and activity of genetically modified T memory stem cells. Sci Transl Med. 2015;7:273ra213.
Hurton LV, Singh H, Najjar AM, Switzer KC, Mi T, Maiti S, et al. Tethered IL-15 augments antitumor activity and promotes a stem-cell memory subset in tumor-specific T cells. Proc Natl Acad Sci U S A. 2016;113:E7788–97.
Wang F, Cheng F, Zheng F. Stem cell like memory T cells: A new paradigm in cancer immunotherapy. Clin Immunol. 2022;241:109078.
Good Z, Borges L, Vivanco Gonzalez N, Sahaf B, Samusik N, Tibshirani R, et al. Proliferation tracing with single-cell mass cytometry optimizes generation of stem cell memory-like T cells. Nat Biotechnol. 2019;37:259–66.
Araki K, Turner AP, Shaffer VO, Gangappa S, Keller SA, Bachmann MF, et al. mTOR regulates memory CD8 T-cell differentiation. Nature. 2009;460:108–12.
Urak R, Walter M, Lim L, Wong CW, Budde LE, Thomas S, et al. Ex vivo Akt inhibition promotes the generation of potent CD19CAR T cells for adoptive immunotherapy. J Immunother Cancer. 2017;5:26.
Verma V, Jafarzadeh N, Boi S, Kundu S, Jiang Z, Fan Y, et al. MEK inhibition reprograms CD8(+) T lymphocytes into memory stem cells with potent antitumor effects. Nat Immunol. 2021;22:53–66.
Crompton JG, Sukumar M, Roychoudhuri R, Clever D, Gros A, Eil RL, et al. Akt inhibition enhances expansion of potent tumor-specific lymphocytes with memory cell characteristics. Cancer Res. 2015;75:296–305.
Stock S, Übelhart R, Schubert ML, Fan F, He B, Hoffmann JM, et al. Idelalisib for optimized CD19-specific chimeric antigen receptor T cells in chronic lymphocytic leukemia patients. Int J Cancer. 2019;145:1312–24.
Bowers JS, Majchrzak K, Nelson MH, Aksoy BA, Wyatt MM, Smith AS, et al. PI3Kδ Inhibition Enhances the Antitumor Fitness of Adoptively Transferred CD8(+) T Cells. Front Immunol. 2017;8:1221.
Alsina M, Shah N, Raje NS, Jagannath S, Madduri D, Kaufman JL, et al. Updated Results from the Phase I CRB-402 Study of Anti-Bcma CAR-T Cell Therapy bb21217 in Patients with Relapsed and Refractory Multiple Myeloma: Correlation of Expansion and Duration of Response with T Cell Phenotypes. Blood. 2020;136:25–6.
Fan F, Yoo HJ, Stock S, Wang L, Liu Y, Schubert ML, et al. Ibrutinib for improved chimeric antigen receptor T-cell production for chronic lymphocytic leukemia patients. Int J Cancer. 2021;148:419–28.
Kagoya Y, Nakatsugawa M, Yamashita Y, Ochi T, Guo T, Anczurowski M, et al. BET bromodomain inhibition enhances T cell persistence and function in adoptive immunotherapy models. J Clin Invest. 2016;126:3479–94.
Zheng W, Jones LL, Geiger TL. Modulation of PI3K signaling to improve CAR T cell function. Oncotarget. 2018;9:35807–08.
Bayliss R, Fry A, Haq T, Yeoh S. On the molecular mechanisms of mitotic kinase activation. Open Biol. 2012;2:120136.
Zhang Z, Zeng D, Zhang W, Chen A, Lei J, Liu F, et al. Modulation of oxidative phosphorylation augments antineoplastic activity of mitotic aurora kinase inhibition. Cell Death Dis. 2021;12:893.
Carlton JG, Jones H, Eggert US. Membrane and organelle dynamics during cell division. Nat Rev Mol Cell Biol. 2020;21:151–66.
Schmit TL, Ahmad N. Regulation of mitosis via mitotic kinases: new opportunities for cancer management. Mol Cancer Ther. 2007;6:1920–31.
Dominguez-Brauer C, Thu KL, Mason JM, Blaser H, Bray MR, Mak TW. Targeting Mitosis in Cancer: Emerging Strategies. Mol Cell. 2015;60:524–36.
Liu X, Chen Y, Li Y, Petersen RB, Huang K. Targeting mitosis exit: A brake for cancer cell proliferation. Biochim Biophys Acta Rev Cancer. 2019;1871:179–91.
Liewer S, Huddleston A. Alisertib: a review of pharmacokinetics, efficacy and toxicity in patients with hematologic malignancies and solid tumors. Expert Opin Investig Drugs. 2018;27:105–12.
O'Connor OA, Özcan M, Jacobsen ED, Roncero JM, Trotman J, Demeter J, et al. Randomized Phase III Study of Alisertib or Investigator's Choice (Selected Single Agent) in Patients With Relapsed or Refractory Peripheral T-Cell Lymphoma. J Clin Oncol. 2019;37:613–23.
Nguyen TTT, Shang E, Shu C, Kim S, Mela A, Humala N, et al. Aurora kinase A inhibition reverses the Warburg effect and elicits unique metabolic vulnerabilities in glioblastoma. Nat Commun. 2021;12:5203.
Song J, Salek-Ardakani S, So T, Croft M. The kinases aurora B and mTOR regulate the G1-S cell cycle progression of T lymphocytes. Nat Immunol. 2007;8:64–73.
Sinha D, Smith C, Khanna R. Joining Forces: Improving Clinical Response to Cellular Immunotherapies with Small-Molecule Inhibitors. Trends Mol Med. 2021;27:75–90.
Pearce EL, Walsh MC, Cejas PJ, Harms GM, Shen H, Wang LS, et al. Enhancing CD8 T-cell memory by modulating fatty acid metabolism. Nature. 2009;460:103–7.
Wen S, Lu H, Wang D, Guo J, Dai W, Wang Z. TCF-1 maintains CD8(+) T cell stemness in tumor microenvironment. J Leukoc Biol. 2021;110:585–90.
Zhang J, Lyu T, Cao Y, Feng H. Role of TCF-1 in differentiation, exhaustion, and memory of CD8(+) T cells: A review. Faseb j. 2021;35:e21549.
Karmaus PWF, Chen X, Lim SA, Herrada AA, Nguyen TM, Xu B, et al. Metabolic heterogeneity underlies reciprocal fates of T(H)17 cell stemness and plasticity. Nature. 2019;565:101–5.
Gattinoni L, Lugli E, Ji Y, Pos Z, Paulos CM, Quigley MF, et al. A human memory T cell subset with stem cell–like properties. Nat Med. 2011;17:1290–7.
Rosenblum MD, Way SS, Abbas AK. Regulatory T cell memory. Nat Rev Immunol. 2016;16:90–101.
van der Windt GJ, Everts B, Chang CH, Curtis JD, Freitas TC, Amiel E, et al. Mitochondrial respiratory capacity is a critical regulator of CD8 + T cell memory development. Immunity. 2012;36:68–78.
Patsoukis N, Bardhan K, Chatterjee P, Sari D, Liu B, Bell LN, et al. PD-1 alters T-cell metabolic reprogramming by inhibiting glycolysis and promoting lipolysis and fatty acid oxidation. Nat Commun. 2015;6:6692.
Kong X, Wang R, Xue Y, Liu X, Zhang H, Chen Y, et al. Sirtuin 3, a new target of PGC-1alpha, plays an important role in the suppression of ROS and mitochondrial biogenesis. PLoS ONE. 2010;5:e11707.
Miller DG, Adam MA, Miller AD. Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection. Mol Cell Biol. 1990;10:4239–42.
Zhao Y, Zheng Z, Robbins PF, Khong HT, Rosenberg SA, Morgan RA. Primary human lymphocytes transduced with NY-ESO-1 antigen-specific TCR genes recognize and kill diverse human tumor cell lines. J Immunol. 2005;174:4415–23.
Martin DE, Hall MN. The expanding TOR signaling network. Curr Opin Cell Biol. 2005;17:158–66.
Inoki K, Ouyang H, Li Y, Guan K-L. Signaling by Target of Rapamycin Proteins in Cell Growth Control. Microbiol Mol Biol Rev. 2005;69:79–100.
Sabatino M, Hu J, Sommariva M, Gautam S, Fellowes V, Hocker JD, et al. Generation of clinical-grade CD19-specific CAR-modified CD8 + memory stem cells for the treatment of human B-cell malignancies. Blood. 2016;128:519–28.
Philip M, Schietinger A. CD8(+) T cell differentiation and dysfunction in cancer. Nat Rev Immunol. 2022;22:209–23.
Raninga PV, Lee AC, Sinha D, Shih YY, Mittal D, Makhale A, et al. Therapeutic cooperation between auranofin, a thioredoxin reductase inhibitor and anti-PD-L1 antibody for treatment of triple-negative breast cancer. Int J Cancer. 2020;146:123–36.
Hu-Lieskovan S, Mok S, Homet Moreno B, Tsoi J, Robert L, Goedert L, et al. Improved antitumor activity of immunotherapy with BRAF and MEK inhibitors in BRAF(V600E) melanoma. Sci Transl Med. 2015;7:279ra241.
Adams JL, Smothers J, Srinivasan R, Hoos A. Big opportunities for small molecules in immuno-oncology. Nat Rev Drug Discov. 2015;14:603–22.
Kretschmer L, Flossdorf M, Mir J, Cho YL, Plambeck M, Treise I, et al. Differential expansion of T central memory precursor and effector subsets is regulated by division speed. Nat Commun. 2020;11:113.
Stock S, Kluever AK, Endres S, Kobold S. Enhanced Chimeric Antigen Receptor T Cell Therapy through Co-Application of Synergistic Combination Partners. Biomedicines. 2022; 10.
Vanneman M, Dranoff G. Combining immunotherapy and targeted therapies in cancer treatment. Nat Rev Cancer. 2012;12:237–51.
Liao W, Lin JX, Wang L, Li P, Leonard WJ. Modulation of cytokine receptors by IL-2 broadly regulates differentiation into helper T cell lineages. Nat Immunol. 2011;12:551–9.

Download PDF

Version 1

posted

You are reading this latest preprint version

Aurora kinase inhibitors regulate T memory stem cell phenotype in T cell receptor-engineered T cells with prolonged persistence

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Highlights

Background

Methods

Manufacturing Of Aurki-treated Tcr-t Cells

Tumor Establishment And Mice Treatment

Flow Cytometry

CFSE labelling assay

Cell Viability Detection

Western Blot

Histopathological Analysis

Lactate And 3-hyroxybutyrate Quantification

Real-time RT-PCR

Statistical analysis

Results

Dose- and time-dependent AURKB inhibition generates less-exhausted TCR-T cells

AURKB inhibition mediated enhancement in FAO that maintains stem memory properties

AURKBi induces TSCM cells by decreasing cell proliferation that depends on controlling mTOR substrates

AURKBi-induced TCR-T treatment in BALB/C-nude mice with metastatic tumor from human melanoma

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Version 1