Experimental animal and cell lines.
Female BALB/c (6–8 weeks old) were purchased from Vital River Laboratory Animal Technology (Beijing, China). GFP-Foxp3 mice were provided by Prof. Yangxin Fu (University of Texas, Southwestern Medical Center, Texas, USA). All animal experiments were performed according to the institutional ethical guidelines on animal care and the protocols used for this study were approved by the Animal Care and Use Committee at the Institute of Biophysics, Chinese Academy of Sciences. Murine breast cancer 4T1 cells were obtained from ATCC and cultured in 5% CO2 and maintained in RPMI 1640 medium supplemented with 10% FBS (BioInd, Isreal) 100 U/ml penicillin, and 100 mg/ml streptomycin.
Exocellular vesicles purification.
For in vitro experiment, 4T1 cells were cultured in RPMI 1640 media supplemented with 10% EV-depleted FBS (BioInd, Israel). Supernatant was collected and centrifuged at 500g for 10min followed by a step of 3000g for 20 min at 4 ℃ to pellet cells and debris. Collect the supernatant without disturbing the cell/debris pellet and transfer to an ultracentrifuge tube. Centrifuge supernatant at 100000g for 70 min at 10 ℃ and collect EV pellet. Re-suspend the pellet in a small volume of PBS. For tumor tissues, the harvested tumors were dissected and cut into small pieces, followed by culture in RPMI 1640 media supplemented with 10% EV-depleted FBS for 48 hours. Supernatant of tumor pieces was collected for the EVs purification. The EVs was characterized by Transmission Electron Macroscopy (FEI, Tecnai Spirit, 120kV, USA) and quantified by BCA protein assay kit. Total TGF-β1 and the EV-associated TGF-β1 was detected by TGF-β1 ELISA kit and western blot.
TGF-β1 detection by ELISA.
TGF-β1 in supernatant or EV was detected by ELISA (DY1679, R&D Systems, Minneapolis, MN). In brief, coat a 96-well microplate with Capture antibody overnight at room temperature. Wash by filling each well with Wash buffer. Block plate by Block buffer for 1 hour. TGF-β1 was activated by HCl and added to each well and incubate 2 hours at room temperature. Wash wells and add Detection antibody. Cover plate and incubate 2 hours. Wash wells and add Streptavidin-HRP to each well. Wash wells and add Substrate solution to each well followed by add Stop solution. Determine the optical density of each well immediately at 450 nm.
Data sources and processing.
The gene mRNA expression matrix and clinical follow-up information of Breast Invasive Carcinoma patients with information of radiation therapy were obtained from the cBioPortal database (http://www.cbioportal.org). The association between TGF-β1 expression and the overall survival was determined using the Kaplan–Meier survival analysis with the 'survival' package (version 4.1.2) in R statistics software, and the Log-rank test was used to detect significant differences. Immune cell infiltration was obtained from the ImmuCellAI database (http://bioinfo.life.hust.edu.cn/ImmuCellAI#!/) and the clinical information was also acquired from the cBioPortal database by using the patient ID.
Western blot.
Cells were lysed by RIPA lysis buffer and protein concentration was determined by BCA protein assay. Cell lysates were separated by SDS-PAGE gels and transferred to nitrocellulose membranes. The membranes were then blotted with the indicated antibodies (anti-TGF-β1 antibody, ab179695; anti-PKCζ antibody, ab108970; anti-p-PKCζ antibody, ab76129; anti-β-actin antibody, ab8226. Abcam, Cambridge, UK).
PMA and CAL treatment.
Phorbol myristate acetate (PMA) and Calphostin C (CAL) were purchased from Merck and used at the indicated concentrations. 4T1 cells were treated by PMA or CAL for 48 hours. Supernatant was collected and EV was purified.
guideRNA sequence.
gRNA1-F | 5’-caccGTCCTACAAATAGGACGTGC-3’ |
gRNA1-R | 5’-aaacGCACGTCCTATTTGTAGGAC-3’ |
gRNA2-F | 5’-caccgCGACCCACGTAGTAGACGAT-3’ |
gRNA2-R | 5’-aaacATCGTCTACTACGTGGGTCGc-3’ |
TGF-β1 knockout of 4T1 cell line generation.
gRNA targeting sequence were designed as the sequences described above using CRISPR design tool (https://zlab.bio/guide-design-resources) and the sgRNA oligos with BbsI restriction site were prepared by annealing. The gRNA oligos were constructed into pX458M and EZ-Guide plasmids respectively. Digest pX458M-gRNA1 and EZ-Guide-gRNA2 plasmid using XhoI and HindIII Restriction Enzyme (New England Biolabs, Beijing, China) and the two plasmids were ligated by T4 DNA ligase. pX458M-gRNA1 + gRNA2 plasmid were transformed into 4T1 cells by Lipofectamine 3000 Reagent (Thermo Fisher Scientific, Waltham, MA). After 48h transfection, GFP + cells were sorting into 96-well plate by FACS Influx (BD, Franklin Lake, NJ) and cells were identified by qPCR for TGFB mRNA and ELISA for TGF-β1 protein.
Quantitative Real-time PCR (qPCR) assay.
Total RNA wea isolated from cells by Trizol (Invitrogen, Carlsbad, CA). The mRNA was reversely transcribed to cDNA by M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA). qPCR was performed using SYBR Green qPCR SuperMix (Invitrogen, Carlsbad, CA) to detect the expression of TGF-β1 and PKCs mRNA. Gene expression was normalized to GAPDH expression and presented as fold-change compared to the Control experiment.
Primer sequence.
TGF-β1-F | TCGACATGGATCAGTTTATGCG |
TGF-β1-R | CCCTGGTACTGTTGTAGATGGA |
Prkca-F | GTTTACCCGGCCAACGACT |
Prkca-R | GGGCGATGAATTTGTGGTCTT |
Prkcb-F | GTGTCAAGTCTGCTGCTTTGT |
Prkcb-R | GTAGGACTGGAGTACGTGTGG |
Prkcc-F | CTCGTTTCTTCAAGCAGCCAA |
Prkcc-R | GTGAACCACAAAGCTACAGACT |
Prkcd-F | CCTCCTGTACGAAATGCTCATC |
Prkcd-R | GTTTCCTGTTACTCCCAGCCT |
Prkce-F | GGGGTGTCATAGGAAAACAGG |
Prkce-R | GACGCTGAACCGTTGGGAG |
Prkcq-F | TATCCAACTTTGACTGTGGGACC |
Prkcq-R | CCCTTCCCTTGTTAATGTGGG |
Prkci-F | CTTTGCAGTGAGGTTCGAGAT |
Prkci-R | AGCCTCTTCTAACTCCAACTGAG |
Prkch-F | TCCGGCACGATGAAGTTCAAT |
Prkch-R | TACGCTCACCGTCAGGTAGG |
GAPDH-F | AGGTCGGTGTGAACGGATTTG |
GAPDH-R | TGTAGACCATGTAGTTGAGGTCA |
Coculture of EVs and naïve splenocytes.
Anti-CD3 antibody was coated into 96-well U plate overnight. Naïve splenocytes were added into each well. EVs were isolated from cells treated by different reagents and quantified by BCA protein assay. Different EVs were diluted by same times and added to naïve splenocytes with anti-CD28 antibody. After 72 hours, cells were collected, stained with fluorescent antibodies and detected by Flow cytometry.
Immunohistochemistry.
Immunohistochemical studies were done in 5-µm sections of paraffin-embedded tumor tissues using antibodies for TGF-β1 to determine its content in the tumors. The slides were incubated in citrate buffer for 20 min in a steamer and endogenous peroxidase was blocked by incubation with 3% H2O2 for 20 min at room temperature. The anti-TGFβ1 antibody (ab179695, Abcam, Cambridge, UK) were used in a dilution of 1:500. The slides were then stained with the secondary antibody in a dilution of 1:500. To determine the protein expression, stained slides were examined under fluorescence microscopy.
PKC-ζ siRNA.
4T1 cells at 80% confliuence were transfected with siRNA (sc-36254, Santa Cruz) by Lipofectamine 3000 Reagent (Thermo Fisher Scientific, Waltham, MA) for 24 hours. Cells were treated by PMA or radiation for indicated time.
Treg differentiation assay.
Spleen of GFP-Foxp3 transgenic BALB/c mice was harvested and single cell suspension was prepared. Cells were treated with anti-CD3ε/CD28 function antibody and EV or TGF-beta1 or 1D11 (BE0057, InVivoMab, West Lebanon, NH) for 72 hours. Percentage of CD4 + GFP + cells in CD4 + cells was detected by BD FACSCalibur.
Structure Analysis
The following putative structures of mouse PKCs were downloaded from the AlphaFold Protein Structure Database (https://alphafold.ebi.ac.uk/ and used in our study: KPCA (UniProtKB: P20444), KPCB (UniProtKB: P68404), KPCD (UniProtKB: P28867), KPCE (UniProtKB: P16054), KPCG (UniProtKB: P63318), KPCI (UniProtKB: Q62074), KPCL (UniProtKB: P23298), KPCT (UniProtKB: Q02111), KPCZ (UniProtKB: Q02956). Geometrical alignments, as well as visualization, were performed with PyMOL version 2.1.0.
Zinc-Specific Fluorescence Staining.
Before radiation administration, 4T1 cells were treated with Naringenin of 200uM concentration for 30 mins. X-Ray of 2, 4 or 8 Gray dose was used to treat 4T1 cells respectively. After 2h, cells were collected and washed with PBS 3 times. TSQ was dissolved in Lock’s buffer (pH 7.4) and cells were stained with 150nM TSQ for 1 min. After 3 times washing, cells were added into 96-well plate and were examined under a fluorescence microplate reader (Excitation, 345nm; Emission 495nm) (SpectraMax M4 Multi-Mode Microplate Reader, Molecular Devices, San Jose, CA). The instrument measures the intensity of the reradiated light and expresses the result in Relative Fluorescence Units (RFU) using SoftMax Pro Software (Standard Edition 7.1).
Animal model.
4T1 cells were subcutaneously injected at 5×104 cells per mouse. Mice were randomized to treatment groups. Radiotherapy was administrated with a dose of 10Gy when tumor volume reached 70–80 mm3. 100mg/kg naringenin was administrated daily by intragastric administration for 30 days. 5mg/kg 1D11 was injected intraperitoneally 3 times per week for 3 weeks. Tumor volumes were measured twice a week and calculated as length*width*height/2. The survival days of tumor-bearing mice were recorded. All animal experiments were performed according to the institutional ethical guide lines on animal care and the protocols used for this study were approved by the Animal Care and Use Committee at the Institute of Biophysics, Chinese Academy of Sciences.
Trial Registration
Using of tissues from patients with malignant Non-Small Cell Lung Cancer (NSCLC) was approved by the ethics committees at Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, China (NCC2022C-702, from June 8th, 2022).
Flow cytometry and antibodies.
Single-cell suspensions were prepared as mentioned previously 52. Samples were stained (20–30 min) with the following antibodies: anti-CD45, anti-CD3, anti-CD4, anti-CD8α, anti-CD25 antibodies. For intracellular staining, cells were fixed, permeabilized overnight at 4℃ (Fixation/Permeabilization Concentrate and Diluent kit, eBioscience, San Diego. CA) and subsequently stained using anti-Foxp3 antibody for 30 min. All experiments were performed on BD FACSCalibur or BD LSRFortessa and data was analyzed with FlowJo 7.6.1.
Statistical analysis
Student’s t test was used for comparisons of datasets with two groups. For multiple comparisons, we used type II ANOVA with correction of statistical hypothesis testing. Statistical significance was considered reached for p values < 0.05. Survival was analyzed by Log-rank (Mantel-Cox) test.