Ethics statement
We conducted research in accordance with the Declaration of Helsinki (1964) and this study was approved by the Ethics Committee of Xiangya Hospital, Central South University (institutional review board equivalent) (202201012).
Written informed consent was signed and obtained from all participants involved in the study. Umbilical cord blood, Wharton’s Jelly and placenta samples were obtained post-delivery from Xiangya hospital. Adipose tissues were collected from patients undergoing surgical treatment undergoing lumbar canal stenosis (DSAT), femoral neck fracture (GSAT), meniscal injury (IPFP) and digestive diseases (ASAT). The harvesting procedure had no impact on the surgery.
Cell Isolation
Isolation of single cell suspension was performed based on previously validated protocols[23–25]. In brief, human tissues were minced into small pieces, washed two to three times with ice-cold Hanks Solution, and digested for about 1h at 37°C. For maternal tissues, the enzyme mix consists 3‰ (w/v) hyaluronidase and collagenase II in HANK’s balanced salt solution (Sigma, USA). For adipose tissues, the enzyme mix consists 0.25% (w/v) collagenase I (Worthington, USA) and 1% Dispase II (Roche, Swiss) in HANK’s balanced salt solution (Sigma, USA). The digestion was stopped by adding the same volume of culture medium (DMEM 4.5 g/L glucose, 10% FCS) and tissue lysates were filtered through a 70-µm nylon mesh. Filtered cell suspensions were then centrifuged at 500 x g for 5 minutes. Cell pellets were then subjected to FACS for isolation of hSSCLCs.
Fluorescence Activated Cell Sorting (Facs)
hSSCLCs were isolated through FACS following previously reported protocols[10, 13]. hSSCLCs should express podoplanin (PDPN), NT5E (CD73), and CD164 as their positive surface markers but lacking PTPRC (CD45), GYPA (CD235a), PECAM1 (CD31), and MCAM (CD146), which are consistent to previous study conducted by Chan et al [10].
After isolation, prepared single-cell suspensions were washed once with ice-cold Flow Cytometry Staining Buffer (Thermofisher scientific, USA) followed by incubation with Fc blocking buffer containing Hu BD Fc Block NALE FC1.3216 (1:200 dilution, BD PharMingen Serotec, USA) for 15 minutes. Protected from light, cells were then incubated for 15 minutes on ice with a mixture of following antibodies in Flow Cytometry Staining Buffer: anti-CD45 Percp/cy5.5, anti-CD235 Percp/cy5.5, anti-CD31 Percp/cy5.5, anti-CD146 PE/cy7, anti-PDPN APC, anti-CD90 APC/cy7, anti-CD73 FITC, and anti-CD164 PE (all primary antibodies were obtained from Biolegend, USA). Finally, cells were washed twice, re-suspended in Flow Cytometry Staining Buffer before FACS. FACS was performed with a BD FACS Aria™ III Sorter (Becton-Dickinson Biosciences, USA). UltraComp eBeads™ (01-2222-42, Invitrogen) were used to set initial compensation and Fluorescence minus one (FMO) controls were used for additional compensation and to assess background levels of each stain. Gating strategies were then established based on internal FMO controls to separate positive and negative populations for each cell surface marker. Collected data were further analyzed through FlowJo (Ver 10.1)
Immunofluorescent Staining Of Adipose Tissues
Immunofluorescent staining of human adipose tissues was performed as previously described[26]. In brief, adipose tissues were fixed with 4% paraformaldehyde, washed twice in ice-cold PBS, incubated in 15% (w/v) sucrose in PBS solution at 4℃ overnight and embedded in OCT (Sakura, Japan). The specimens were then sectioned into 10µm slides. Cryosectioned slides were blocked by donkey sera, followed by primary antibodies incubation overnight at 4°C. Next day, slides were stained with Alexa Fluor conjugated secondary antibodies including Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) (Abcam, ab150077), Donkey Anti-Mouse IgG H&L (Alexa Fluor® 594) (Abcam, ab150108) and Donkey Anti-Mouse IgG H&L (Alexa Fluor® 594) (ab150108) at room temperature for an hour. Nuclear staining was performed with DAPI (BD Bioscience) before mounted with Aquatex (Millipore, USA). Fluorescent microscopy was performed through Zeiss LSM 780 (Zeiss, Germany).
This study employed the following primary antibodies for immunofluorescent staining: Anti-Podoplanin/gp36 antibody [18H5] - BSA and Azide free (Abcam, ab10288), Human 5'-Nucleotidase/CD73 Antibody (Bio-Techne, AF5795), and Rabbit Anti-CD164 antibody (Bioss, bs-12688R).
In Vitro Culture Of Hssclcs
Sorted hSSCLCs were cultured in 75 cm2 culture dishes (Nunclon, Thermo Scientific, Waltham, MA, USA) at a density of 5 × 105 cells/dish in a standard CO2 incubator (37°C, 5% CO2). The culture medium, comprised of DMEM supplemented with 10% human platelet lysate (Sigma-Aldrich, USA), 100 U/ml penicillin, and 0.1 mg/ml streptomycin (1% pen-strep; Life Technologies, Burlington, Canada), was refreshed every three days. Cells were passaged until 80% confluence. When reaching passage 3, hSSCLCs were used for downstream differentiation assays.
Chondrogenic Differentiation And Alcian Blue (Ab) Staining
Chondrogenic differentiation induction of hSSCLCs was performed taking advantage of a commercial kit (HyCyte™ hASC Chondrogenic Differentiation Media, HyCyte Biosciences, China) following manufacturer’s instructions. Briefly, hSSCLCs at passage 3 were digested and resuspended at a density of 2.0×107 cells/mL. Pipettes were adopted to drop 20 µL of the cell suspension to the center of 24-well plates. After being cultured in a standard CO2 incubator (37°C, 5% CO2) for 3h, hSSCLCs were adherent to the bottom of the plates. 1mL chondrogenesis media was added to each well and replaced every three days. After 21 days of chondrogenic differentiation induction, hSSCLCs were rinsed with PBS and fixed with 4% paraformaldehyde at RT for 30 min. Samples were then washed once with PBS, and stained with Alcian Blue (HyCyte Biosciences, China) for 30 min at RT before proceeding to imaging.
Osteogenic Differentiation Induction And Alizarin Red S (Ars) Staining
Osteogenic differentiation induction of hSSCLCs was operated utilizing a commercial kit (HyCyte™ hASC Osteogenic Differentiation Media, HyCyte Biosciences, China) and following the manufacturer’s instructions. For osteogenic induction, hSSCLCs at passage 3 were seeded onto 12-well plates coated with 0.1% gelatin at a density of 2.0×104 cells/well, and cultured in a standard CO2 incubator (37°C, 5% CO2). After the hSSCLCs were 70–80% confluent, culture media was replaced by osteogenesis media, and the osteogenesis media was refreshed every three days. After 21 days of chondrogenic or osteogenic differentiation induction, hSSCLCs were rinsed with PBS and fixed with 4% paraformaldehyde at RT for 30 min. Samples were then washed once with PBS, and stained with Alizarin Red S staining solution (HyCyte Biosciences, China) for 30 min at RT before proceeding for imaging.
Reverse Transcription-quantitative Polymerase Chain Reaction (Rt-qpcr)
After chondrogenic or osteogenic induction for 3 days and 7 days, the total RNA of hSSCLCs was extracted through the classic TRIzol protocol[27]. 2µg total RNA of each sample was used for cDNA synthesis taking advantage of GoScript™ Reverse Transcription Kit (A5001, Promega, USA). The qRT-PCR was performed with GoTaq®qPCR Master Mix (A6001, Promega, USA) according to the manufacturer’s instructions. Target gene expression relative to GAPDH was calculated by the 2−ΔΔCT method. Detailed information of related primers is shown in Table 1.
Table 1
Primer sequences used for qRT-PCR analysis
ID | Gene | Forward Primer | Reverse primer |
1 | RUNX2 | TGGTTACTGTCATGGCGGGTA | TCTCAGATCGTTGAACCTTGCTA |
2 | BGLAP | GGCGCTACCTGTATCAATGG | GTGGTCAGCCAACTCGTCA |
3 | SPP1 | CTCCATTGACTCGAACGACTC | CAGGTCTGCGAAACTTCTTAGAT |
4 | SOX9 | AGCGAACGCACATCAAGAC | CTGTAGGCGATCTGTTGGGG |
5 | COL2A1 | TGGACGATCAGGCGAAACC | GCTGCGGATGCTCTCAATCT |
6 | ACAN | CCCCTGCTATTTCATCGACCC | GACACACGGCTCCACTTGAT |
7 | GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
Western Blotting
Western blotting
Protein isolation and Western blotting were performed as previously described[28]. After 3 days and 7 days of chondrogenic or osteogenic induction, respectively, cells were lysed in RIPA buffer (R10010, Solarbio, China)for the collection of total protein. BCA assay kit (Thermo Fisher, USA) was applied to determine the protein concentration. After 5 minutes of denaturing at 95 ℃, 5 mg total protein of each sample was loaded in each lane in standard polyacrylamide gels. After electrophoresis, the protein was transferred to a PVDF membrane (Millipore). Blocking and antibody binding were conducted in Tris-buffered saline-Tween buffer with 5% nonfat skimmed milk. The primary antibodies used were recombinant Anti-SOX9 antibody (ab185230, Abcam) and Anti-RUNX2 antibody (ab76956, Abcam) and secondary antibodies were Goat anti-Mouse HRP and Goat anti‐Rabbit HRP respectively. The bands were visualized with the ECL plus kit (P0018, Beyotime, China).
Single-cell Rna Sequencing
For ScRNA-seq, dorsal subcutaneous adipose tissue (DSAT) and IPFP were harvested from 3 patients each for library preparation. The library was generated using 10x Genomics Single-Cell V2 Library Construction (Genenergy, Shanghai, China), and sequenced using the Illumina NextSeq 500 Sequencing System, after which the raw reads were analyzed using the Cell Ranger Single Cell Software Suite[29] and R package Seurat[30]. The number of unique molecule identifier (UMI) counts and genes were examined to identify outliers. Dimensionality reduction was done with principal component analysis (PCA), and then UMAP was used for the visualization of the clusters. The Find Conserved Markers function in the Seurat package[30] was used to identify the marker genes and differentially expressed genes (DEGs). Gene Ontology (GO) analysis was significantly enriched according to the DEG results with a false discovery rate ≤ 0.05. For unsupervised exploration of stemness, CytoTRACE[31] was used to compare differentiation states.
Statistical analysis
Quantitative data are presented as means ± sd (standard deviation). Statistical analyses were performed using Prism 8.2 software (GraphPad). One-way ANOVA followed by a Tukey's multiple comparison test was used to evaluate the difference of hSSCLC percentage among tissues or adipose tissue from different sites and the difference of chondrogenic differentiation assay and osteogenic differentiation assay. Details for statistical analyses, including replicate numbers, are illustrated in the figure legends. Analysis and visualization of flow cytometry data were performed using FlowJo (v10.0.7).