Collagen I is expressed by hepatocytes through activation of AIM2/ASC/caspase-1 signaling pathway

doi:10.21203/rs.3.rs-2360883/v1

Download PDF

Research Article

Collagen I is expressed by hepatocytes through activation of AIM2/ASC/caspase-1 signaling pathway

https://doi.org/10.21203/rs.3.rs-2360883/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Liver fibrosis is the result of diffuse excessive deposition of extracellular matrix (ECM) in liver. Collagen is the main component of extracellular matrix. Absent in melanoma 2 (AIM2) is involved in the formation of inflammsome and plays an important role in inflammatory response. However, it is unclear whether AIM2 is involved in the pathogenesis of liver fibrosis. In the present study, we explored the role of AIM2 in the expression of collagen I.

Methods

In this study, AIM2 was used to co-culture with HepG2 cells. Cell counting kit-8 (CCK-8) was used to measure cell viability. Real time-quantitative PCR (RT-qPCR) and Western blotting were used to detect collagen I expression at mRNA or protein level, respectively. Then HepG2 cells were treated with caspase activation recruitment domain (ASC), pcDNA(+)-AIM2, small interfering RNA (siRNA) and Z-YVAD-fluoromethylketone (Z-YVAD-FMK) to explore their roles in collagen I expression, respectively.

Results

The viability of HepG2 cells could be not affected with the increased concentrations of AIM2 and Z-YVAD-FMK. The filamentous prisms and vacuoles of HepG2 cells became more obvious when the concentrations of AIM2 increased to 80ng/ml. The expression level of collagen I increased with the increased concentrations of AIM2. The expression level of collagen I could be also induced by pcDNA(+)-AIM2 vector. The expression level of collagen I could be inhibited by ASC siRNA and Z-YVAD-FMK, respectively.

Conclusion

Collagen I expression could be induced by AIM2 through ASC/caspase-1 signaling pathway. AIM2 might be involved in the pathogenesis of liver fibrosis through inducing collagen I expression.

AIM2

caspase-1

collagen I

HepG2 cells

liver fibrosis

Fibrosis is caused by excessive deposition of ECM proteins which are excreted by myofibroblasts during the response to chronic inflammation ^{[1, 2]}. Liver fibrosis is a reversible inflammatory reaction process of the body when the liver is damaged. The progressive liver fibrosis could lead to cirrhosis, and increase the incidence of hepatocellular carcinoma (HCC) by 20–30% ^[3].

Inflammasome is composed of NOD-like receptors (NLRs)/AIM-like receptor, the apoptosis-associated speck-like protein that contain caspase activation recruitment domain (ASC) and the inflammatory effector pro-caspase-1 ^{[4, 5]}. The activation of caspase-1 by inflammasome could result in the secretion and maturation of pro-inflammatory cytokine IL-1β and IL-18 ^[6], and lead to cell pyroptosis finally ^[7].

Absent in melanoma 2 (AIM2) is initially identified as a tumor suppressor factor of melanoma ^[8]. AIM2, a member of interferon (IFN)-inducible pyrin and HIN domain (PYHIN) family proteins, serves as the first line barrier against pathogen infection through caspase-1 activation ^[9]. AIM2 plays an important role in the initiation of the innate immune response.

It is reported that AIM2 could be bound with fibronectin 1 (FN1) when cells become abnormal ^[10]. Collagen I and fibronectin compose interstitial matrix and provide structural scaffolding for tissues ^[11]. The increase of collagen I could change the ECM environment and promote the survival, proliferation, invasion, metastasis of cancer cells ^[12–14]. It is reported that overexpression of collagen I is closely related to tissue fibrosis and tumor progression ^[15].

However, it is still unclear that whether AIM2 plays a vital role in the pathogenesis of liver fibrosis. In the present study, we used cell model to study the role of AIM2 in the expression of collagen I and explore its mechanism in the pathogenesis of liver fibrosis.

2.1 Reagents and antibodies

Lipofectamine® 3000 was purchased from Invitrogen, Life Technologies (CA, USA). Z-YVAD-FMK (1mg) was obtained from Med Chem Express (NJ, USA). Human AIM2 protein (11654-H09B) was purchased from Sino Biological (USA). ASC siRNA (sc-37281,10µM) were purchased from Santa Cruz Biotechnology (USA). HepG2 cells were obtained from Procell Life Science & Technology (Procell, China). Plasmid extraction kit (DP103) was purchased from Tiangen Biotechnology (Beijing, China). AIM2 antibody (D5X7K), ASC/TSM1 (E1E3I), caspase-1 antibody (D7F10), Tubulin antibody (AF7011), GAPDH antibody (D16H11), GSDMD antibody (AF4012), COL1A1 (E6A8E) were purchased from Cell Signaling Technology (CST).

2.2 Cells culture

HepG2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Gibco, USA) with 6% fetal bovine serum (FBS, Gibco, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco, USA) at 37°C in a 5% CO₂ incubator.

2.3 Cell viability assay

8×10³ HepG2 cells were inoculated in 96-well plate. Z-YVAD-FMK was an inhibitor specific for caspase-1. CCK-8 was used to evaluate the effect of different concentrations of AIM2 and Z-YVAD-FMK on the viability of HepG2 cells. HepG2 cells were treated with AIM2 and Z-YVAD-FMK for 48 hours. Then 10µl CCK-8 were added to each well and co-cultured at 37℃ for 2 hours. The absorbance was read at 450 nm by using a microplate reader.

2.4 Plasmid constructions and transient transfection

The integration of plasmid pcDNA 3.1 empty vector and pcDNA (+) AIM2 were confirmed by sequencing. Plasmids were transfected into HepG2 cells by using Lipofectamine 3000.

2.5 Transfection of ASC siRNA

HepG2 cells were treated with ASC siRNA (sc-37281,10µM) to explore the role of ASC siRNA in collagen I expression. According to the manufacturer's protocol, ASC siRNA was transfected into HepG2 cells by using Lipofectamine 3000. Transfection efficiency was evaluated by Western blot.

2.6 RNA extraction and RT-qPCR

Total RNA was extracted from HepG2 cells by using GeneJET RNA Purification Kit (Thermo Fisher Scientific, USA) ^{[16, 17]}. The extracted total RNA was reversely transcribed to cDNA. The required genes were amplified with specific primers and cDNA by RT-qPCR in the presence of the SYBR and real time PCR detection machine. The primers were as follows: Collagen I, F: CCCAGAACATCACATATCAC, R: CAAGAGGAACACATATGGAG; IL-1β, F: ATGATGGCTTATTACAGTGGCAA, R: GTCGGAGATTCGTAGCTGGA; GAPDH, F: GGACCTGACCTGCCGTCTAG, R: GTAGCCCAGGATGCCCTTGA.

2.7 Western blot

Total proteins of HepG2 cells were extracted by using radioimmunoprecipitation assay (RIPA) buffer. The concentration of protein was detected by using bicinchoninic acid method. The total proteins were separated by using 10% sodium dodecyl sulfate- polyacrylamide gel electrophoresis (PAGE) gel, and then was electro-transferred into polyvinylidene fluoride (PVDF) membranes. The PVDF membranes were blocked with 5% skim milk powder for 1 hour and incubated with primary antibodies at 4°C overnight. On the next day, the PVDF membranes were washed with Tris-buffered saline with Tween-20 (TBST) buffer three times and incubated with a corresponding secondary antibody for 1 hour at room temperature. The membranes were washed again with TBST buffer. Antibody reaction substances were visualized by using the Pierce Western Blotting Substrate (Thermo Fisher Scientific Inc). The expression level of protein was quantitatively analyzed by ImageJ software.

2.8 Statistical analysis

Statistical analysis was performed by using SPSS 23.0 software, or GraphPad Prism software 8.0. Values were presented as an average of three replicates. Quantitative data were expressed as mean ± standard deviations (SD). Spearman’s two-tailed test, t-test was used to calculate P value, respectively. Differences were considered statistically significant at a value of P ≤ 0.05.

3.1 Cellular viability could not be affected by the increased concentrations of AIM2 and Z-YVAD-FMK.

The effects of different concentrations of AIM2 (10, 20, 40, 80, 160, 320, 640ng/ml) on viability of HepG2 cells were assayed, respectively. HepG2 cells were treated with AIM2 for 48 hours. Then 10µl CCK-8 were added into each well and co-cultured with HepG2 cells at 37℃ for 2 hours. The absorbance was read at 450 nm by using a microplate reader. There was not a significant difference in cellular viability among HepG2 cells treated with the increased concentrations of AIM2 protein (P > 0.05) (Fig. 1A).

The effects of different concentrations of Z-YVAD-FMK (1.56, 3.13, 6.25, 12.5, 25, 50, 100µM) on the viability of HepG2 cells were also assayed, respectively. HepG2 cells were treated with Z-YVAD-FMK for 48 hours. Then 10µl CCK-8 were added into each well and co-cultured with HepG2 cells at 37℃ for 1.5 hours. The absorbance was read at 450 nm by using a microplate reader. There was not a significant difference in cellular viability among HepG2 cells treated with the increased concentrations of Z-YVAD-FMK (P > 0.05) (Fig. 1B). The results above indicated that the viability of HepG2 cells could be not affected with the increased concentrations of AIM2 and Z-YVAD-FMK.

3.2 The morphology of HepG2 cells could be changed with the increased concentrations of AIM2.

HepG2 cells were treated with 0, 5, 10, 20, 40, 80ng/ml AIM2 for 24 hours, respectively. Then the morphologic change of HepG2 cells was observed. As show in Fig. 2, the vacuoles of HepG2 cells became more pronounced with the increased concentrations of AIM2. Our results showed that the filamentous prisms and vacuoles of HepG2 cells became more obvious when the concentrations of AIM2 increased to 80ng/ml.

3.3 The expression level of collagen I increased with the increased concentrations of AIM2.

4×10⁵ HepG2 cells were plated in each cell of six-well plate. When these cells were fused to 50%-70%, they were treated with different concentrations of AIM2 (0, 5, 10, 20, 40, 80ng/ml), respectively. Twenty-four hours later, the expression level of collagen I was evaluated by using Western blot. As shown in Fig. 3A, the expression of collagen I was significantly increased after HepG2 cells were treated with AIM2. The expression level of collagen I protein and collagen mRNA was analyzed by Western blot and RT-qPCR, respectively. Then ImageJ software was used to analyze the images and calculate the gray value. As shown in Fig. 3, the expression level of collagen I protein and COL1A1 mRNA was significantly increased with the increased concentrations of AIM2 (P < 0.0001). The results above showed that the expression level of collagen I increased with the increased concentrations of AIM2.

3.4 The expression level of collagen I could be also induced by pcDNA(+)-AIM2 vector.

To further investigate the role of AIM2 in collagen I expression, HepG2 cells were transfected with pcDNA(+)-AIM2 by using Lipofectamine 3000. The transfection efficiency was evaluated by using Western blot (Fig. 4A). The expression levels of COL1A1, caspase-1 and ASC were analyzed by using ImageJ software, respectively. As shown in Fig. 4B, 4C, 4D, the expressions of COL1A1, caspase-1 and ASC significantly increased after HepG2 cells were transfected with pcDNA(+)-AIM2 (P < 0.05). The results above showed that the expression level of collagen I could be also induced by pcDNA(+)-AIM2 vector.

3.5 The expression level of collagen I could be inhibited by ASC siRNA.

ASC siRNA was used to validate the effect of ASC on the expression of collagen I. ASC siRNA was transiently transfected into HepG2 cells in order to knock down ASC expression. Then AIM2 protein (80ng/ml) was added into the medium and co-cultured with HepG2 cells for 24 hours. As shown in Fig. 6B and 6C, the expression levels of COL1A1 and caspase-1 were significantly decreased in HepG2 cells treated with ASC siRNA and AIM2 compared with the HepG2 cells only treated with AIM2 (P < 0.05). The results above showed that the expression level of collagen I could be inhibited by ASC siRNA.

3.6 The expression level of collagen I could be inhibited by Z-YVAD-FMK.

Z-YVAD-FMK (20 µm), a caspase-1 inhibitor, was co-cultured with HepG2 cells for 1 hour. Then AIM2 (80ng/ml) was added and co-cultured with the HepG2 cells for 24 hours (Fig. 5A-5D, 5H). The expression levels of collagen I and caspase-1 were analyzed by using ImageJ software, respectively. As shown in Fig. 5B and 5C, compared with HepG2 cells untreated with Z-YVAD-FMK, the expression levels of collagen I and caspase-1 significantly decreased in HepG2 cells treated with Z-YVAD-FMK (P < 0.05). Furthermore, the expression level of Gasdermin-D (GSDMD) also significantly decreased in HepG2 cells treated with Z-YVAD-FMK (Fig. 5D). Subsequently, the expression level of IL-1β mRNA was detected by using RT-qPCR. As shown in Fig. 6H, IL-1β mRNA significantly decreased in HepG2 cells treated with AIM2 and Z-YVAD-FMK compared with HepG2 cells only treated with AIM2 (P < 0.05).

Subsequently, we further explored the role of pcDNA(+)-AIM2 in HepG2 cells. HepG2 cells were treated with Z-YVAD-FMK for 24 hours (Fig. 5E-5G). Then pcDNA(+)-AIM2 was transfected into the HepG2 cells. As shown in Fig. 5E, compared with the HepG2 cells only transfected with pcDNA(+)-AIM2, the concentration of AIM2 was increased in the HepG2 cells transfected with pcDNA(+)-AIM2 and treated with Z-YVAD-FMK. The expression of caspase-1 in HepG2 cells transfected with pcDNA(+)-AIM2 was significantly decreased after HepG2 cells were pretreated with Z-YVAD-FMK (P < 0.05) (Fig. 5F). As shown in Fig. 5G, pcDNA(+)-AIM2 induced COL1A1 expression and Z-YVAD-FMK inhibited COL1A1 expression. The results above showed that the expression level of collagen I could be inhibited by Z-YVAD-FMK.

It is reported that hepatic AIM2 expression is significantly increased in CHB patients than in non-CHB patients, and the increased expression of AIM2 is associated with the increased severity of inflammation in the liver ^[18–20]. It is also reported that AIM2 is expressed by Kupffer cells and liver sinusoidal endothelial cells while it is virtually absent in primary hepatocytes ^[21]. Furthermore, AIM2 could promote the pathogenesis of pulmonary fibrosis ^{[22] [23]}, myocardial fibrosis ^[24], renal fibrosis ^[25] and primary myelofibrosis ^[26]. However, it is rarely reported about the effect of AIM2 on the pathogenesis of liver fibrosis.

In the present study, we found that cellular viability of HepG2 cells could not be affected by the increased concentrations of AIM2 and Z-YVAD-FMK. However, the morphology of HepG2 cells became more obvious with the increased concentrations of AIM2. The expression of collagen I increased with the increased concentrations of AIM2 and/or pcDNA(+)-AIM2. Collagen I expression was inhibited by ASC siRNA and/or Z-YVAD-FMK. Taken together, we think that collagen I expression could be affected by AIM2 through ASC/caspase-1 pathway.

Our study showed that cellular viability of HepG2 cells could not be affected by the increased concentrations of AIM2. However, AIM2 plays an important role in the assembly of inflammasome that could result in caspase-1-mediated inflammatory responses and cell death, and suppress cancer cell proliferation ^[27–32]. It was reported that AIM2 could inhibit the viability and increase the apoptosis rate of colorectal cancer (CRC) cells through suppressing the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt) pathway ^[33]. It was also reported that the deficiency of AIM2 could decrease the viability and calcification of vascular smooth muscle cells from murine aortas ^[34]. The knockdown of AIM2 could result in reduction of viability in cutaneous cell carcinoma (cSCC) cells and onset of apoptosis ^[35]. The previous studies showed that AIM2 could promote or inhibit cellular viability of different cells. Interestingly, we found that there was no a significant difference for concentration of AIM2 in cellular viability of HepG2 cells. However, the mechanism of this phenomenon need to be further studied.

Z-YVAD-FMK, a caspase-1 inhibitor, could inhibit the expression of IL-1β, IL-18 and collagen I ^[36–38]. Our results above showed that cellular viability of HepG2 cells could not be affected by the increased concentrations of Z-YVAD-FMK. It was reported that the cellular viability of necrotic renal tubular cells at 1, 2, 4, and 6h in brain death (BD) group are significantly reduced than in BD + Z-YVAD-FMK group ^[36]. The normal cellular viability of hepatocytes was found in control and Z-YVAD-FMK groups, and the decreased cellular viability was found in Cu group. However, the cellular viability of hepatocytes was less damaged in Cu + Z-YVAD-FMK group compared with Cu group ^[37]. The cellular viability of mouse hippocampal neuronal cells (HT22 cells) is normal in control and Z-YVAD-FMK groups. The cellular viability was significantly decreased in oxygen–glucose deprivation/reoxygenation (OGD/R) group. However, the cellular viability of HT22 cells is significantly increased in OGD/R + Z-YVAD-FMK group compared with OGD/R group ^[39]. The results above showed that the cellular viability is stable with increased concentrations of Z-YVAD-FMK in normal cells, which is consistent with our results. Furthermore, the previous studies showed that Z-YVAD-FMK could increase the cellular viability of damaged cells.

In our study, the morphology of HepG2 cells became more obvious with the increased concentrations of AIM2. It was reported that AIM2 is significantly up-regulated in both middle cerebral artery occlusion (MCAO) rats and OGD/R-treated neurocytes compared with that of the control group, and pyroptosis is induced in rats after MCAO ^[40]. It was also revealed that DHA could inhibit proliferation of HepG2215 cells in a dose and time dependent manner, which leads to autophagy in HepG2215 cells by promoting AIM2/caspase-1 inflammasome ^[41]. Those researches showed that AIM2 could affect the morphology of cells through different mechanisms. However, our study showed the cellular viability of HepG2 cells could not be affected by the increased concentrations of AIM2 with the concentrations of 10, 20, 40, 80, 160, 320 and 640ng/ml.

Our results showed the expression of collagen I increased with the increased concentrations of AIM2 in HepG2 cells. It was revealed that AIM2 plays a potential inflammasome-independent role in increasing the production of collagen ^[42]. However, some studies demonstrated AIM2 could inhibit Akt kinase to protect against colon cancer ^{[43, 44]}, and the Akt kinase that involved in cell proliferation and survival could promote the production of collagen ^{[45, 46]}. Subsequently, we studied the mechanism of the expression of collagen I induced by AIM2 in HepG2 cells.

In our results, it showed that the expressions of collagen I, caspase-1 and ASC could be induced by pcDNA (+)-AIM2 in HepG2 cells. The results further showed that AIM2 could play an important role in inducing collagen I expression.

To explore the role of ASC in the regulation of collagen I expression, ASC siRNA was transfected into HepG2 cells to inhibit ASC expression. We found that the expressions of collagen I and caspase-1 were inhibited by ASC siRNA. Previously, ASC siRNA could efficiently suppress the production of caspase-1 cleavage, IL-18 and IL-1β, and pyroptosis in human aortic endothelial cells (HAECs) induced by nicotine ^[49]. The results above were similar to our researches, which further demonstrated that ASC played a vital role in the production of IL-18, IL-1β caspase-1.

We also found that AIM2 was overexpressed when HepG2 cells were treated with caspase-1 inhibitor (Z-YVAD-FMK) in our study. Therefore, we speculated that there might be a negative feedback regulation mechanism in AIM2/ASC/caspase-1 signaling pathway. Some studies previously reported that Z-YVAD-FMK could reduce the occurrence of inflammation and cell death ^{[41, 50]}. However, it was not yet reported about the influence of Z-YVAD-FMK on the secretion of AIM2. Subsequently, we will clarify the negative feedback regulation mechanism in AIM2/ASC/caspase-1 signaling pathway.

It was reported that inflammasome could induce the expression of caspase-1 to promote the pathogenesis of fibrosis in pulmonary fibrosis ^{[22] [23]}, myocardial fibrosis ^[24], renal fibrosis ^[25] and primary myelofibrosis ^[26][51]. Caspase-1 is a crucial protein of the inflammasome and its activation could mediate pyroptosis ^[52]. Pyroptosis, a kind of programmed cell death that depends on caspase-1, could have dual roles in promoting and inhibiting carcinogenesis in different cancers ^{[51, 53]}. Dixon et al have reported the role of caspase-1 in liver fibrosis induced by fatty liver, and the lack of caspase-1 could decrease the severity of liver fibrosis induced by obesity due to high-fat diet ^{[54, 55]}. Activation of inflammasome induces rapid aggregation of ASC and caspase-1 into a fibrillar signaling platform ^[56]. Chen et al reported that AIM2 could promote the degradation of FN1 during the normal process by binding to it, the deficiency of AIM2 could activate EMT process and the migration of hepatoma cells ^[10]. α-SMA could promote collagen I production in pancreatic ductal adenocarcinoma (PDAC) ^[57]. However, the expression of FN1 and the function of α-SMA were not tested in this study and will be explored in the next step.

In the present study, we found that AIM2 could activate ASC and induce the formation of inflammasome which could activate IL-1β through caspase-1 and result in GSDMD-mediated pyroptosis. Caspase-1 could induce collagen I expression. As a result, ECM deposited more and liver fibrosis formed ^[10]. We also found that pcDNA(+)-AIM2 was similar to AIM2 in the regulation of ASC and caspase-1. Notably, Z-YVAD-FMK could induce the overexpression of AIM2. ASC siRNA could inhibit the expression of collagen I.

In sum, we found that AIM2 could promote the expression of collagen I through AIM2/ASC/caspase-1 signaling pathway in HepG2 cells. We think that AIM2 might be involved in the pathogenesis of liver fibrosis. Our results would provide a new therapeutic target and basis for the treatment of liver fibrosis.

Taken together, we proposed the hypothetical mechanism in the following diagram (Fig. 7).

In the present study, we found that collagen I was expressed by HepG2 cells through activation of AIM2/ASC/caspase-1 signaling pathway. The activation of AIM2 induced the activation of ASC, and then activated caspase-1, which led to cell scorching and induced the release of IL-1β and IL-18. This signaling pathway not only played a very important role in liver inflammation, but also was associated with the pathogenesis of liver fibrosis. It might be an attractive target for therapy of liver fibrosis.

Competing interests

The authors declare that they have no conflict of interest.

Funding

This study was funded by research grants from the National Natural Science Foundation of China (Grant No. 81401306), and municipal school joint funding project of Guangzhou Municipal Science and Technology Bureau (202102010130), and Special Clinical Technology of Guangzhou (TS-36).and Sino-German Center for Research Promotion (SGC)'s Rapid Response Funding Call for Bilateral Collaborative Proposals between China and Germany in COVID-19 Related Research (No. C-0032).

Authors’ Contributions

Qiongyu Sheng and Panpan Zhai, Luanluan Chen did the experiments. Liyang Zhou and Xueting Ou collected the data. Xingfei Pan designed the experiment and analyzed the data. Qiongyu Sheng and Panpan Zhai wrote the manuscript. Bing Situ and Jun Huang revised the muanuscript.

Ethical Approval

The study was purely a cell line experiment and did not involve ethical application.

Availability of data and materials

The data sets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Friedman SL. Liver fibrosis -- from bench to bedside. J Hepatol. 2003, 38 Suppl 1:S38-53.
Rock KL, Latz E, Ontiveros F, et al. The sterile inflammatory response. Annu Rev Immunol. 2010, 28:321-342.
El-Serag HB. Hepatocellular carcinoma. New Eng J Med. 2011, 365(12):1118-1127.
Fernandes-Alnemri T, Yu JW, Datta P, et al. AIM2 activates the inflammasome and cell death in response to cytoplasmic DNA. Nature. 2009, 458(7237):509-513.
Hornung V, Ablasser A, Charrel-Dennis M, et al. AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC. Nature. 2009, 458(7237):510-518.
Martinon F, Burns K, Tschopp J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Molecular cell. 2002, 10(2):417-426.
Shi JJ, Zhao Y, Wang K, et al. Cleavage of GSDMD by inflammatory caspases determines pyroptotic cell death. Nature. 2015, 526(7575):660-665.
DeYoung KL, Ray ME, Su YA, et al. Cloning a novel member of the human interferon-inducible gene family associated with control of tumorigenicity in a model of human melanoma. Oncogene. 1997, 15(4):453-457.
Lugrin J, Martinon F. The AIM2 inflammasome: Sensor of pathogens and cellular perturbations. Immunol Rev. 2018, 281(1):99-114.
Chen SL, Liu LL, Lu SX, et al: HBx-mediated decrease of AIM2 contributes to hepatocellular carcinoma metastasis. Mol Oncol. 2017, 11(9):1225-1240.
Lu P, Weaver VM, Werb Z. The extracellular matrix: a dynamic niche in cancer progression. J Cell Biol. 2012, 196(4):395-406.
Li J, Ding YM, Li AQ. Identification of COL1A1 and COL1A2 as candidate prognostic factors in gastric cancer. World J Surg Oncol. 2016, 14(1):297.
Jolly LA, Novitskiy S, Owens P, et al. Fibroblast-Mediated Collagen Remodeling Within the Tumor Microenvironment Facilitates Progression of Thyroid Cancers Driven by BrafV600E and Pten Loss. Cancer Res. 2016, 76(7):1804-1813.
Oleksiewicz U, Liloglou T, Tasopoulou KM, et al. COL1A1, PRPF40A, and UCP2 correlate with hypoxia markers in non-small cell lung cancer. J Cancer Res Clin Oncol. 2017, 143(7):1133-1141.
Jimenez SA, Saitta B. Alterations in the regulation of expression of the alpha 1(I) collagen gene (COL1A1) in systemic sclerosis (scleroderma). Springer Semin Immunopathol. 1999, 21(4):397-414.
Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987, 162(1):156-159.
Boom R, Sol CJ, Salimans MM, et al. Rapid and simple method for purification of nucleic acids. J Clin Microbiol. 1990, 28(3):495-503.
Pan XF, Xu HX, Zheng CL, et al. Human hepatocytes express absent in melanoma 2 and respond to hepatitis B virus with interleukin-18 expression. Virus Genes. 2016, 52(4):445-452.
Du WJ, Zhen JH, Zheng ZM, et al. Expression of AIM2 is high and correlated with inflammation in hepatitis B virus associated glomerulonephritis. J Inflamm (Lond). 2013, 10(1):37.
Han YT, Chen ZP, Hou RP, et al. Expression of AIM2 is correlated with increased inflammation in chronic hepatitis B patients. Virol J. 2015, 12:129.
Boaru SG, Borkham-Kamphorst E, Tihaa L, et al. Expression analysis of inflammasomes in experimental models of inflammatory and fibrotic liver disease. J Inflammation (Lond). 2012, 9(1):49.
Gao J, Peng S, Shan XN, et al. Inhibition of AIM2 inflammasome-mediated pyroptosis by Andrographolide contributes to amelioration of radiation-induced lung inflammation and fibrosis. Cell Death Dis. 2019, 10(12):957.
Trachalaki A, Tsitoura E, Mastrodimou S, et al. Enhanced IL-1β Release Following NLRP3 and AIM2 Inflammasome Stimulation Is Linked to mtROS in Airway Macrophages in Pulmonary Fibrosis. Front Immunol. 2021, 12:661811.
Wang XY, Pan JY, Liu H, et al. AIM2 gene silencing attenuates diabetic cardiomyopathy in type 2 diabetic rat model. Life Sci. 2019, 221:249-258.
Wu Y, Yang H, Xu SJ, et al. AIM2 inflammasome contributes to aldosterone-induced renal injury via endoplasmic reticulum stress. Clin Sci (Lond). 2022, 136(1):103-120.
Liew EL, Araki M, Hironaka Y, et al. Identification of AIM2 as a downstream target of JAK2V617F. Exp Hematol Oncol. 2016, 5:2.
Shrivastava G, Leon-Juarez M, Garcia-Cordero J, et al. Inflammasomes and its importance in viral infections. Immunol Res. 2016, 64(5–6):1101–1117.
Lamkanfi M, Dixit VM. Mechanisms and functions of inflammasomes. Cell. 2014, 157(5):1013–1022.
Schroder K, Muruve DA, Tschopp J. Innate immunity: cytoplasmic DNA sensing by the AIM2 inflammasome. Curr Biol. 2009, 19(6): R262–R265.
Fernandes-Alnemri T, Yu JW, Juliana C, et al. The AIM2 inflammasome is critical for innate immunity to Francisella tularensis. Nat Immunol. 2010, 11(5):385–393.
Rathinam VAK, Jiang ZZ, Waggoner SN, et al. The AIM2 inflammasome is essential for host defense against cytosolic bacteria and DNA viruses. Nat Immunol. 2010, 11(5):395–402.
Connolly DJ, Bowie AG. The emerging role of human PYHIN proteins in innate immunity: implications for health and disease. Biochem Pharmacol. 2014, 92(3):405–414.
Chen JJ, Wang ZJ, Yu SS. AIM2 regulates viability and apoptosis in human colorectal cancer cells via the PI3K/Akt pathway. Onco Targets Ther. 2017, 10:811-817.
Wortmann M, Arshad M, Hakimi M, et al. Deficiencyin Aim2 affects viability and calcification of vascular smooth muscle cells from murine aortas and angiotensin-II induced aortic aneurysms. Mol Med. 2020, 26(1):87.
Farshchian M, Nissinen L, Siljamäki E, et al. Tumor cell-specific AIM2 regulates growth and invasion of cutaneous squamous cell carcinoma. Oncotarget. 2017, 8(28):45825-45836.
Liu WF, Yang DJ, Shi JH, et al. Caspase-1 Inhibitor Reduces Pyroptosis Induced by Brain Death in Kidney. Front Surg. 2021, 8:760989.
Liao JZ, Yang F, Tang ZX, et al. Inhibition of Caspase-1-dependent pyroptosis attenuates copper-induced apoptosis in chicken hepatocytes. Ecotoxicol Environ Saf. 2019, Jun 15;174:110-119.
Ke Y, Tang H, Ye C,et al. Role and Association of Inflammatory and Apoptotic Caspases in Renal Tubulointerstitial Fibrosis. Kidney Blood Press Res. 2016, 41(5):643-653.
Zhang YT Yao ZH, Xiao Y, et al. Downregulated XBP-1 Rescues Cerebral Ischemia/Reperfusion Injury-Induced Pyroptosis via the NLRP3/Caspase-1/GSDMD Axis. Mediators Inflamm. 2022, 2022:8007078.
Liang J, Wang Q, Li JQ, et al. Long non-coding RNA MEG3 promotes cerebral ischemia-reperfusion injury through increasing pyroptosis by targeting miR-485/AIM2 axis. Exp Neurol. 2020, 325:113139.
Shi XL, Wang L, Ren LF, et al. Dihydroartemisinin, an antimalarial drug, induces absent in melanoma 2 inflammasome activation and autophagy in human hepatocellular carcinoma HepG2215 cells. Phytother Res. 2019, 33(5):1413-1425.
Christo SN, Diener KR, Manavis J, et al. Inflammasome components ASC and AIM2 modulate the acute phase of biomaterial implant-induced foreign body responses. Sci Rep. 2016, Feb 10;6:20635.
Wilson J E, Petrucelli AS, Chen L, et al. Inflammasome-independent role of AIM2 in suppressing colon tumorigenesis via DNA-PK and Akt. Nat Med. 2015, 21(8):906–913.
Man SM, Zhu QF, Zhu LQ. et al. Critical Role for the DNA Sensor AIM2 in Stem Cell Proliferation and Cancer. Cell. 2015, 162(1):45–58.
Bujor AM, Pannu J, Bu SZ, et al. Akt blockade downregulates collagen and upregulates MMP1 in human dermal fibroblasts. Invest Dermatol. 2008, 128(8):1906-1914.
Runyan CE, Schnaper HW, Poncelet AC. The phosphatidylinositol 3-kinase/Akt pathway enhances Smad3-stimulated mesangial cell collagen I expression in response to transforming growth factor-beta1. J Biol Chem. 2004, 279(4):2632–2639.
Schroder K, Muruve DA, Tschopp J. Innate immunity: cytoplasmic DNA sensing by the AIM2 inflammasome. Curr Biol. 2009, 19(6):R262-265.
Li JP, Wei W, Li XX, et al. Regulation of NLRP3 inflammasome by CD38 through cADPR-mediated Ca²⁺ release in vascular smooth muscle cells in diabetic mice. Life Sci. 2020, 15(255):117758
Wu XX, Zhang HY, Qi W, et al. Nicotine promotes atherosclerosis via ROS-NLRP3-mediated endothelial cell pyroptosis. Cell Death Dis. 2018 9(2):171
Chen ACH, Tran HB, Xi Y, et al. Multiple inflammasomes may regulate the interleukin-1-driven inflammation in protracted bacterial bronchitis. ERJ Open Res. 2018, 4(1):00130-2017
Thi HTH, Hong S: Inflammasome as a Therapeutic Target for Cancer Prevention and Treatment. Journal of cancer prevention 2017, 22(2):62-73.
Ramirez MLG, Salvesen GS: A primer on caspase mechanisms. Semin Cell Dev Biol. 2018, 82:79-85.
Alegre F, Pelegrin P, Feldstein AE. Inflammasomes in Liver Fibrosis. Semin Liver Dis. 2017, 37(2):119-127.
Dixon LJ, Flask CA, Papouchado BG, et al. Caspase-1 as a central regulator of high fat diet-induced non-alcoholic steatohepatitis. PloS one. 2013, 8(2):e56100.
Dixon LJ, Berk M, Thapaliya S, et al. Caspase-1-mediated regulation of fibrogenesis in diet-induced steatohepatitis. Lab Invest. 2012, 92(5):713-723.
Franklin BS, Bossaller L, De Nardo D, et al. The adaptor ASC has extracellular and 'prionoid' activities that propagate inflammation. Nat Immuno. 2014, 15(8):727-737.
Chen Y, Kim JH, Yang SJ, et al. Type I collagen deletion in αSMA(+) myofibroblasts augments immune suppression and accelerates progression of pancreatic cancer. Cancer cell. 2021, 39(4):548-565.e546.

No competing interests reported.

Highlights.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Collagen I is expressed by hepatocytes through activation of AIM2/ASC/caspase-1 signaling pathway

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

1. Introduction

2. Materials And Methods

2.1 Reagents and antibodies

2.2 Cells culture

2.3 Cell viability assay

2.4 Plasmid constructions and transient transfection

2.5 Transfection of ASC siRNA

2.6 RNA extraction and RT-qPCR

2.7 Western blot

2.8 Statistical analysis

3. Results

3.1 Cellular viability could not be affected by the increased concentrations of AIM2 and Z-YVAD-FMK.

3.2 The morphology of HepG2 cells could be changed with the increased concentrations of AIM2.

3.3 The expression level of collagen I increased with the increased concentrations of AIM2.

3.4 The expression level of collagen I could be also induced by pcDNA(+)-AIM2 vector.

3.5 The expression level of collagen I could be inhibited by ASC siRNA.

3.6 The expression level of collagen I could be inhibited by Z-YVAD-FMK.

4. Discussion

5. Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1