Study Area
This study was conducted at Tikur Anbessa Specialized Hospital, Addis Ababa University College of Health Sciences, Addis Ababa. Addis Ababa is the capital and largest city of Ethiopia, located on a well – watered plateau surrounded by hills and mountains at an altitude of about 2500m above sea level.
The average annual temperature and rainfall are 21oC and 1800 mm, respectively. Tikur Anbessa Hospital is the largest hospital in the country and functions under the authority of the Addis Ababa University College of Health Sciences.
Study Population
Patients included in this study were children under 5 years old with 3 or more loose stools in 24 hours or with an episode of bloody diarrhea. Children that received previous antimicrobial drug treatment were excluded from this study (18)
Study Design and Sampling Methodology
The study was purposive type, i.e., samples were collected from all children less than five years of age with diarrhea. Sample collection was done from January 2017 to March 2018. Approximately 50gm of feces was collected from children with diarrhea in accordance with standard laboratory specimen collection procedures. Specimens from diarrheic children were collected in sample cups on to which buffered peptone water was added for enrichment. Specimens were labeled with unique sample identification numbers, transported in ice box to biomedical laboratory of Microbial, Cellular and Molecular Biology at College of Natural Sciences, Addis Ababa University and inoculated in to primary culture media within the same day of collection.
Isolation of E. coli
Broth specimens were be inoculated on MacConkey Agar and incubated aerobically at overnight. Lactose fermenting colonies on MacConkey Agar were then sub cultured in to eosin Methylene blue and incubated aerobically at overnight. Green metallic sheen colonies on Eosin Methylene Blue were considered as presumptive E. coli isolates.
Presumptive isolateswere stored in nutrient broth for further identification by biochemical tests. All the isolates were also stained by Gram stain to determine cell morphology and purity of the isolates.
Biochemical Characterization of E. coli isolates
Presumptive E. coli isolates were further characterized for their biochemical activity using the biochemical tests indole, methylred, Vogues proskuer and citrate utilization (IMViC). Bacterial isolates that exhibited IMViC pattern of (+ + - -) respectively were considered as E. coli isolates(17)
Indole test
A sterilized test tube containing 4 ml of tryptophan broth was inoculated aseptically by taking an inoculum from 18 to 24 hrs culture on EMB. The broth was incubated at 37°C for 24 –28 hours. 0.5 ml of Kovac’s reagent was added to the broth culture and the presence or absence of ring was observed.Formation of a pink color in the reagent layer on top of the medium within seconds of adding the reagent was considered as positive result. Absence of ring formation considered as a negative result.
Vogues – Proskuer (VP) test
The medium was inoculated with an inoculum taken from an 18-24 hour pure culture and incubated aerobically at 37oc for 24 hours. 1ml of the broth was transferred to a clean test tube following 24 hours of incubation. The remaining broth was reincubated for an additional 24 hours. 0.6ml of 5% alpha-naphthol was added to the 1ml broth and next 0.2ml of 40% KOH was added. By gently shaking to expose the medium to atmospheric oxygen, the tube was allowed to remain undisturbed for 10-15 minutes. Observation of a pink-red color development was considered as a positive VP test. A negative VP test was demonstrated by the appearance of a yellow color on the surface of the medium. Development of a copper-like color was also interpreted as negative.
Methyl red test
Following 48 hours of incubation, 2.5 ml of the broth was transferred to a clean test tube. Five drops of methyl red indicator were added. Development of a stable red color on the surface of the medium after the addition of methyl red indicator was interpreted as positive test. A negative methyl red test was demonstrated by the development of a yellow color on the surface of the medium.
Citrate utilization test
Simmons Citrate Agar was inoculated on the slant by touching the tip of a needle to a colony that is 18 to 24 hours old and incubated at 37oC for 24 hours. Development of blue color on the slant surface due to the alkaline carbonates and bicarbonates produced as by – products of citrate catabolism increasing the pH was considered as positive result. The absence of color change (the medium remains deep green) was considered as negative result.
Antimicrobial Sensitivity Testing
The antimicrobial susceptibility/resistance profiles of the bacterial isolates were determined using Kirby – Bauer – disk diffusion method. Disks impregnated with the following antibiotics were used: Trimethoprim (5µg), chloramphenicol (30 µg), ciprofloxacin (5µg), ampicillin (10 µg), neomycin (10 µg), gentamycin (10 µg), tetracycline (30 µg), Compound sulfonamides (300 µg), chloramphenicol (30 µg), Cefotetan (30 µg), Norfloxacin (10 µg) and streptomycin (25 µg). Pure bacterial colonies were inoculated into 7 ml of Tryptophan soya broth and incubated at 37 ºC for 18 hours until turbidity is seen and were compared to the 0.5 McFarland standards. Mueller – Hinton Agar was used as plating medium. Fifteen minutes after inoculation of the plates using sterile swabs, the antibiotic impregnated disks were applied on the surface of inoculated plates with sterile forceps. All the disks were gently pressed down onto the agar with forceps. The plates were inverted and then incubated aerobically for 18 hours at 37 ºC. The diameters of the zones of inhibition were measured to the nearest whole millimeter using the transparent ruler and were interpreted as susceptible, intermediate and resistant based on the recommendations of Clinical Laboratory Standards Institute (47).
Virulence gene detection
DNA extraction
Biochemically confirmed E. coli isolates were grown in nutrient broth at 370C overnight. Exactly 1.5 ml of the culture was spun by centrifugation at 5000 g for 10 min.
The bacterial pellet was lysed by adding 50 µl of double distilled water and boiling in a water bath at 950C for 10 minutes. The lysate was then centrifuged again as before and 50 µl of the supernatant used directly as template for PCR (13)
Detection of virulence gene sequences byPCR
After extraction, the bacterial DNA was subjected to PCR for the presence of virulence genes. According to the annealing temperatures of the different primers used, five PCR assays were performed. The PCR experiments were carried out using the following protocols.
To detect the presence of stx2 (shigatoxin) genes of STEC and EHEC, a reaction was set up in a 25µl reaction volume in a PCR master mix (Himedia; India, 2017) containing 1µ1 of each primer (EVS1, EVC2), 2.5µl of PCR buffer with 17.5 mmol of MgCl2, 1 µl of 0.35 mm of each dNTP, 0.5 µ1 of Taq polymerase enzyme, 14 µ1of double distilled water and 3 µl of template DNA. The reaction mixture was amplified with an initial denaturation of 1 cycle for 3 min. at 950c; 30 cycles each consisting, 40 s at 950c, 40 s at 550c, 30 s at 720c; and a final extension of 1cycle for 8 min. at 720c.
To detect the eae (intimin) gene of EPEC and EHEC strains,a reaction was set up in a 25µl reaction tube in a PCR master mix (Himedia; India, 2017) containing 1µ1 of each primer (EAE1 and EAE2), 2.5µl of PCR buffer with 17.5 mmol of MgCl2, 1 µl of 0.35mm of each dNTP, 1µ1 of 50Mmol MgCl2, 0.5µl of Taq polymerase enzyme, 15 µ1of sterile distilled water and 3 µl of template DNA. The reaction mixture was amplified with an initial denaturation of 1 cycle for 3 min. at 950c ; 35 cycles, each consisting of 40 s at 950c, 60 s at 550c and 60 s at 720c; and a final extension of 1cycle for 10 min. at 720c.
To detect the bfp (bundle forming pillus) gene of typical EPEC strains,a reaction was set up in a 25µl reaction tube in a PCR master mix (Himedia; India, 2017) containing 0.5µ1 of each primer (BFPF, BFPR) containing 2.5 µl of PCR buffer with 17.5 mmol of MgCl2, 1 µl of 0.35mm of each dNTP, 0.3 µl of Taq polymerase enzyme, 16.2 µl of sterile distilled water and 3 µl of template DNA. The reaction mixture was amplified with an initial denaturation of 1 cycle for 3 min. at 950c; 30 cycles, each consisting of 40 s at 950c, 40 s at 570c, 30 s at 720c; and a final extension of 1cycle for 8 minat 720c.
To detect hylA(hemolysin) gene of EHEC, reaction components were mixed in a 25µl reaction tube in a PCR master mix (Himedia; India, 2012) containing 1µ1 of each primer (EHECF, EHECR) containing 2.5 µl of PCR buffer with 17.5 mmol of MgCl2, 1 µl of 0.35mm of each dNTP,0.3 µl of Taq polymerase enzyme, 16.2 µl of sterile distilled water and 3 µl of template DNA. Then, the reaction mixture was amplified with an initial denaturation of 1 cycle for 3 min. at 950c ;30 cycles, each consisting of 40 s at 950c, 1min. at 450c, 1min at 720c; and a final extension of 1cycle for 10 minat 720c.
To detect aatA(antiagrgation transporter gene) of EAEC strain reactions were set up in a 25µl reaction tube in a PCR master mix (Himedia; India, 2012) containing 1µ1 of each primer (EAECF, EAECR) containing 2.5 µl of PCR buffer with 17.5 mmol of MgCl2, 1 µl of 0.35mm of each dNTP,0.3 µl of Taq polymerase enzyme, 16.2 µl of sterile distilled water and 3 µl of template DNA. The reaction mixture was amplified with an initial denaturation of 1 cycle for 3 min. at 950c ;30 cycles each consisting of,40 s at 950c, 1min. at 450c, 30s at720c ; and a final extension of 1cycle for 10 min.at 720c.
All amplifications were carried out in a thermal cycler (Applied BiosystemsStepOne™ Real-Time PCR System Thermal Cycling Block).
Agarose Gel Electrophoresis
Amplified PCR products were analyzed by agarose gel electrophoresis at 120 volt for 30 minutes in 1.5% agarose containing ethidium bromide (0.5 µg ml-1) using a marker DNA ladder of 100 bp (Himedia; India, 2017). The products were visualized with ultraviolet illumination and imaged with gel documentation system (Biored Gel Doc XR, USA). Details of primer gene sequences and the different reaction temperatures carried out in the PCR assays used were as indicated in table 1
Table 1: Primer gene sequence and PCR conditions
Primer
|
Nucleotide sequence
|
Target gene
|
Pathogenic E. coli strain
|
Denaturing
|
Annealing
|
Extension
|
Product size (Bp)
|
Cycles
|
Reference
|
EAE1
|
F:5’AAACAGGTGAAACTGTTGCC3’
|
eae
eae
|
EPEC/EHEC
|
940c,2 min.
|
550c,60s
|
720c,60s
|
490
|
35
|
Khan et al.(2002)
|
EAE2
|
R:5’-CTCTGCAGATTAACCTCTGC-3’
|
|
|
EVS1
|
F:5’-ATCAGTCGTCACTCACTGGT-3’
|
Stx2
Stx2
|
STEC/EHEC
|
940c,2 min.
|
550c,60s
|
720c,60s
|
110
|
30
|
Khan et al.(2002)
|
EVC2
|
R:5’-CTGCTGTCACAGTGACAAA-3’
|
|
|
EHEC
|
F: 5’-ACGATGTGGTTTATTCTGGA-3’
|
hlyA
|
EHEC
|
950c,3 min.
|
450c,40s
|
720c,30s
|
165
|
30
|
Paton and Paton.(1998)
|
EHEC
|
R:5’-CTTCACGTCACCATACATAT-3’
|
hlyA
|
|
|
|
|
|
|
|
EAEC
EAEC
|
F:5’CTGGCGAAAGACTGTATCTAT-3’
R:5’CAATGTATAGAAATCCGCTGTT-3’
|
aatA
aatA
|
EAEC
|
950c,3 min.
|
450c,40s
|
720c,30s
|
630
|
30
|
Chattawayet al.(2011)
|
BFP
|
F:5’AATGGTGCTTGCGCTTGCTGC-3
R:5’GCCGCTTTATCCAACCTGGTA-3’
|
bfpA
bfpA
|
EPEC
|
950c,3 min.
|
570c,40s
|
720c,30s
|
324
|
30
|
Christian et al.(2010)
|
EPEC = EnteropathogenicE. coli; EHEC= EnterohemorrhagicE. coli; STEC= Shiga – like toxin producing E. coli; EAEC= EnteroaggregativeE. coli
Questionnaire Survey
Questionnaire for data collection was prepared and administered to the attendants of children from whom specimens were collected. Data were collected on child demographics and clinical condition such as child age, sex, residence, onset of diarrhea, clinical diagnosis, history of previous illness, RVI status, BMI, household members and history of illness, etc.
Ethical approval
Before the start of the work, the proposal was submitted to the Ethics committee of Addis Ababa University College of Natural Sciences to get Ethical approval to conduct the study (CNSDO/237/09/2017). During sample collection the objectives of the work was explained to the parents of children visiting hospitals in order to get consent of the parents or attendants of children. In addition, all samples were collected by health professionals
Data Management and Analysis
Data describing the diarrheagenic conditions suggestive of E. coli infection observed on children along with age were classified filtered and coded using Microsoft Excel® 2007. The data were then exported to SPSS windows version 20.0 (IBMSPSS INC.Chicago, IL) for statistical analysis. The prevalence of E. coli strains from the total diarrheic children and the prevalence of pathogenic strains from total E. coli isolates along with their susceptibility profiles were determined by using descriptive statistics.