Study Area
The field job was carried out within a radius of 100m at The Municipal Botanical Garden of Bauru (MBGB) (22º20’30”S, 49º00’30”W) in the central-west region of the state of São Paulo, in Southeastern Brazil (Figure 1) in November, 2020, during the pandemic of Covid-19, when it got possible to work in the fields with primates in a more secure condition, once it was advised by the authorities to not work with these species even wearing PPE (Personal Protective Equipment) before having more information about the new disease.
The animals were captured with auto-close, Tomahawk-style (34cm x 13cm x 12cm), covered with black cloth to decrease the stress in the animals, besides traps baited with a mix of bananas, paçoca (Brazilian sweet made with peanuts), and cornflour. All the samples were collected from free-range marmosets and all steps were done by biologists and veterinarians under the approval of the competent authorities in the country (Ethics Committee on Animal Experiments of São Paulo State University) (CEUA - 0157/2019), (COTEC - 292/2020 D31/2020 WLS) and (SisBio - 71758-2).
Control samples
The standard samples were obtained from blood and hair of 6 animals (3 C. jacchus and 3 C. penicillata) from a legalized animal breeding (Sagui Legal, based in Cotia, SP) and from hair of 5 animals (2 C. jacchus, 2 hybrids and 1 C. penicillata) from the Center for Medicine and Research in Wild Animals (CEMPAS), FMVZ, UNESP, SP, in order to standardize the following protocols used in this study.
Study samples
The animals were transported to a laboratory inside MBGB where they were monitored by a veterinarian. They were weighed and immobilized with an injection of ketamine (12 mg/kg) and midazolam (0,6 mg/kg) in the intramuscular region of the outer thigh. Then, they were measured, photographed and the biological samples (hair and blood) were collected.
While the animals were sedated, sex was checked (male or female) and age (juvenile or adult) was predicted based on body measurements (weight, tail length and body length), behavior and number of teeth. Information about body characteristics as color patterns and pre and post-auricular tufts were collected. Body length, tail length, head length, chest and neck circumferences were measured with a measuring tape; hands, feet and ears were always measured with a 50 cm ruler, on the right side.
A plastic organizer box (36 cm x 28 cm x 23 cm) was adapted with led lights, holes and lined with covered cardboard, to be used as a photography studio. Every individual was photographed in portrait, lateral, ventral and dorsal decubitus, as possible, using a Nikon Coolpix L810 camera and an Asus Zenfone Max Shot (Silva, 2018).
Approximately 0,2 – 0,5 mL of whole blood were collected in Vacutainer® tube, preserved in EDTA and then stored at -20ºC. At the end of data collection, trichotomy of the medial part of the tail was performed and the hair at the end of the tail and right tuft were dyed with pararosalin chloride in order to avoid recapture of the individuals. Afterward, animals were returned to cages and released at the same place they were captured as they got recovered from anesthesia (about 2h).
During the procedures, vital parameters such as body temperature, respiratory and heart rates were continuously monitored and recorded in an individual record.
Laboratory protocols
DNA from blood and hair was extracted using a standard proteinase K/phenol/chloroform protocol (Sambrook and Russell 2001) with adaptations and later quantity and quality were verified on a spectrophotometer (NanoDrop ND-1000 Spectrophotometer – Thermo Fisher Scientific) by 260/280 nm absorbance.
Nested Polymerase Chain Reactions (PCR) were performed using primer pairs for the fragments Cytochrome C Oxidase I (COI) and displacement-loop (D-loop) region of mitochondrial DNA (mtDNA), in Thermocycler (Eppendorf® Mastercycler® Nexus X2).
The COI 700 bp fragment region was amplified using the primer pairs F1forward (5’TTTTCAACCAACCACAAAGACATCGG3’) e F5reverse (5’ACTTCTGGGTGGCCGAAAAATCAGAA 3’) (Loiola et al. 2015), while the 1200bp fragment of the D-loop gene was amplified with the pair of primers cal_dloopF1 (5'CCCTAGTAGCTGACCTATTAAC3') and cal_dloopR2 (5'TGAGGTATGCGAGGAGTAAC3') (Malukiewkz et al. 2014). Later, the Nested PCR reactions were performed for both genes, obtaining around 180bp COI fragment using the same primer F1forward and F1reverse (5'AATAAATGCGTGAGATGTGACGAT3') (Loiola et al. 2015); and 1036bp D-loop fragment using the same primer cal_dloopF1 and HVIR (5'ATTCAATATCAGGCGCGATGATAG3'), as described by Malukiewkz et al. (2014).
The PCR reactions were carried out in a final volume of 50μl, containing: 25μl of 2.0x Taq DNA Polymerase Master Mix (Ampliqon©) (2.0 mM MgCl₂), 25pmol of each primer, 50ng of genomic DNA and additional ultrapure water to complete the final volume. Amplification reactions of COI gene were carried out with initial denaturation at 94ºC for 5 minutes, followed by 35 cycles at 94ºC for 30 seconds, 55ºC for 45 seconds, 72ºC for 2 minutes and final extension at 72ºC for 7 minutes, while amplification reactions for D-loop gene were carried out with 5 minutes initial denaturation at 95ºC; 35 cycles of 95ºC for 45 seconds, 57ºC for 30 seconds, 72ºC for 90 seconds; and a final extension at 72ºC for 4 minutes and 30 seconds.
Both fragments obtained were identified by electrophoresis in 1% agarose gel, stained with Gel Red® (Uniscience) (0,1 µl/10 ml), run in 1x Tris- acetate-EDTA (TAE) buffer and then visualized in transilluminator (Benchtop UV Transilluminator, Cambridge, UK) with the UVP® VisionWorksLS™ (LifeScience Software) software. The amplified products were purified after the first PCR of each gene using the Illustra Kit GFX PCR DNA and Gel Band Purification (GE Healthcare), and after used in the Nested PCRs, following the same instructions given.
Thereafter, all the amplified products in Nested PCR were observed in an electrophoresis gel and purified with the same kit as used before. Fragments were sequenced in both directions using the 2 µl BigDye Terminator Cycle Sequencing Ready Reaction Kit versão 3.1 (Applied Biosystems, Foster City, CA), 2 µl of 2,5 Save Money (400 mM Tris-HCl ph 9, 0,10 mM MgCl2) and 5pmol of each primer in ABI3100 Genetic Analyzer (Applied Biosystems) following manufacturer’s instructions.
Data Analysis
The analyzed fragment is of conserved domain and consists of the hypervariable region 1 (HVR1) and part of the hypervariable region 2 (HVR2). The obtained sequences and the electropherograms were analyzed (Geneious v.10.0.9; Biomatters, Auckland, New Zealand), aligned with the Muscle algorithm (Edgar, 2004) and manually checked. The sequences were compared with the gene sequences that belong to the genus and C. jacchus and C. penicillata species using the blast tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Haplotype diversity, nucleotide diversity, number of polymorphic sites, number of haplotypes, and their frequency were estimated using DnaSP version 5.0 program (Librado and Rozas 2009) and Arlequin 3.0 software (Excofer et al. 2005). The same software was used to do the Fu's Fs statistic and the Tajima D tests (Fu 1997; Tajima 1989). The haplotype network design was made utilizing Phylogenetic Network 4.2.0.1 (Forster et al. 2007).