Aspirin inhibited the Warburg effect induced by Ni-refining fumes via the Wnt/β-catenin pathway in Beas-2B cells

doi:10.21203/rs.3.rs-2372491/v1

Download PDF

Research Article

Aspirin inhibited the Warburg effect induced by Ni-refining fumes via the Wnt/β-catenin pathway in Beas-2B cells

https://doi.org/10.21203/rs.3.rs-2372491/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The natural metal nickel (Ni) can be found in the air, water, sediment, and soil. Although epidemiological research and experimental data have shown that nickel is linked to lung cancer, the precise mechanism of nickel carcinogenesis is unclear. We investigated whether Ni-refining fumes stimulated the Wnt/β-catenin pathway and caused the Warburg effect in Beas-2B cells, then if aspirin could protect the cells. The findings demonstrated that Beas-2B cells were significantly toxicated by Ni-refining fumes. With the increase of Ni-refining fumes concentration, the proteins and mRNAs level of the Wnt/β-catenin pathway were significantly increased and Warburg effect-related proteins: pyruvate dehydrogenase kinase 1 (PDK1), monocarborxylat transporter 1 (MCT1) and lactate dehydrogenase A (LDHA) also increased significantly. Pyruvate dehydrogenase (PDH) activity was reduced and reactive oxygen species (ROS) production was increased. When given the Wnt/β-catenin pathway inhibitor XAV-939, Warburg effect-related proteins expression can be inhibited. Aspirin at various concentrations could improve the relative viability of cells exposed to nickel refining fumes, with 2.5 mmol/L aspirin providing the most significant protection (P<0.05). Compared with the nickel staining group, aspirin treatment significantly decreased the expression of the Wnt/β-catenin pathway and Warburg effect-related proteins whereas it inhibited the production of ROS, too.

Ni-refining fumes

Wnt/β-catenin pathway

Warburg effect

Aspirin

ROS

As one of the most abundant elements in the earth's crust, nickel is widely distributed in nature. High nickel doses or long-term nickel exposure may cause a variety of side effects. The hazards of nickel include genotoxicity, hematotoxicity, teratogenicity, immunotoxicity and carcinogenicity [1]. Nickel affects health through inhalation and intake, and industrial damage to health is mostly through inhalation. The International Agency for Research on Cancer has classified nickel as a human carcinogen (IARC) [2].

The Warburg effect (also known as "aerobic glycolysis") is a unique mode of cellular metabolism of tumor cells. Recently, some studies have shown that the Warburg effect is very important in nickel-induced malignant cell transformation [3]. In an oxygen-rich environment, aerobic glycolysis is still the preferred mode of metabolism. It can promote angiogenesis and tumor metastasis by increasing lactic acid secretion [4].

The Wnt/β-catenin pathway can regulate tumor biological behavior brought by the tumor microenvironment. It is a central regulatory pathway to regulate the key functions of normal and cancer cells. The Wnt/β-catenin pathway plays a critical role in the occurrence of pulmonary fibrosis [5, 6].

Aspirin (acetylsalicylic acid, ASA) is a chemical drug and it has anti-inflammatory, antipyretic, analgesic and antithrombotic effects [7]. In clinical practice, aspirin has been used to alleviate fever, pain, rheumatism, and the risk of heart attack and stroke [8]. Aspirin has the ability to alter glucose metabolism in platelets, cells, and tissues by lowering ATP levels and inhibiting glucose uptake or transport [9]. Many studies have also shown that aspirin targets key enzymes involved in glucose metabolism, such as 6-phosphofructo-2-kinase (PFKFB3), glucose-6-phosphate dehydrogenase (G6PD), fructose-6-phosphate-1-kinase (PFK) and glyceraldehyde 3-phosphate dehydrogenase (GADPH) [10, 11, 12, 13].

In this study, we used Beas-2B cells to observe if Ni-refining fumes increased the expression of the Warburg effect via the Wnt/β-catenin pathway. After given 2.5 mmol/L aspirin to the cells, we discussed the potential molecular mechanisms underlying these processes. Our findings showed that Ni-refining fumes inhibited cells proliferation and promoted ROS production while increasing the expression of the Warburg effect via the Wnt/β-catenin pathway. Aspirin alleviated the Warburg effect and the level of ROS production by inhibiting the Wnt/β-catenin pathway.

2.1. Cell culture

Beas-2B cells were provided by the Chinese Academy of Sciences, and cultured in DMEM medium containing 10% fetal bovine serum and 1% penicillin and streptomycin antibiotics (HyClone, USA), and developed in a 37°C, 5% CO₂ incubator. We replaced the culture medium every day and passaged cells every 2 days.

2.2. Preparation of Ni-refining fumes

Ni-refining fumes were collected from nickel production mines in a refinery workshop. The sample was ground in an agate mortar until 99 percent of the particles had a diameter of less than 5 µm. Before research, the particles were weighed and sterilized with ultraviolet radiation for 2 h, then placed in phosphate-buffered saline (PBS; Beyotime, China) to form a liquid suspension (1000 µg/mL).

2.3. Cell viability assay

The CCK-8 was used to assess cell viability (KTA1020, Abbkine, China). Beas-2B cells were cultured into 96-well plates (1×10⁴ cells/well). The cells were treated with different concentrations of Ni-refining fumes suspension (0, 6.25, 12.5, 25, 50 and 100 µg/mL) for 24 h and cleaned the nickel dust with PBS. First, we added 100µL DMEM to each well, then 10µL CCK-8 solution for 2 h at 37℃. The absorbance at 450 nm was measured by microplate reader (SpectraMax Plus 384, Molecular Devices, USA).

2.4. Lactate production assay

Beas-2B cells were cultured into 6-well plates and treated with nickel suspension at different concentrations. Cell supernatants were collected 24 h later. The OD value was measured at 450 nm, the lactic acid content was calculated, according to the instructions of the Lactate Assay Kit (KTB1100, Abbkine, China).

2.5. ROS generation level

Beas-2B cells were cultured into 12-well plates and treated with different concentrations of Ni-refining fumes. After 24 h, the growth solution was discarded and washed three times with PBS. Then the cells were covered with 600 µL of DCFH-DA at a volume concentration of 10 µmol/L, and incubated in a cell incubator at 37ºC for 20 minutes according to the ROS detection kit instructions (S0033S, Beyotime, China). Observe under fluorescence microscope.

2.6. PDH activity assay

Beas-2B cells were cultured into 10-cm dishes and treated with various concentrations of nickel suspensions. The cell precipitate was collected after 24 h. Activity was calculated according to the instructions of the pyruvate dehydrogenase activity assay kit (G0836W, Abbkine, China).

2.7. Western blot analysis

After 24 h of treatment with Ni-refining fumes, it was lysed on ice for 30 minutes in RIPA lysis buffer (Beyotime, China) containing 1% PMSF, and vortexed every 10 minutes for complete lysis. After 20 minutes of centrifugation at 12000r/min and 4℃, the supernatant was collected. The protein samples were electrophoresed on 10% SDS-PAGE gels (PG112, EpiZyme, China) and transferred onto 0.45 µm PVDF membranes (Millipore, USA). The PVDF membranes were blocked with 10% non-fat milk containing TBST for 2 h at room temperature, and then incubated with primary antibodies against β-catenin (1:3000, 51067-2-AP, proteintech), MCT1 (1:1000, #DF7144, Affinity) and PDK1 (1:1000, #BF0312, Affinity), LDHA (1:1000, #3582, Cell Signaling Technology), β-actin (1:2000, TA811000, ORIGENE) at 4℃ overnight. After three washes with TBST, the blots were incubated with secondary antibodies for 1.5 h (1:10000, AS014, AS003, ABclonal). Finally, enhanced chemiluminescence (biosharp, China) was used to identify the protein bands. The grayscale value on the bands was then analyzed by ChemiAnalysis image analysis software (Clinx Science Instruments, China).

2.8. XAV-939 inhibited the Wnt/β-catenin pathway

XAV-939 is a potent tankyrase inhibitor against the Wnt/β-catenin pathway (HY-15147, MCE, USA). The 10 µmol/L concentration of XAV-939 had no toxic effect on the survival of Beas-2B cells [14, 15]. Cells were treated with XAV-939 reagent for 2 h at 37°C before being treated with Ni-refining fumes suspension for 24 h.

2.9. RT-PCR analysis

Total RNA in Beas-2B cells was extracted with TRIzol reagent (Invitrogen, USA), and obtained the cDNA of the target RNA sample with a ReverTra Ace® qPCR RT Kit (Toyobo, Japan). β-actin acted as an internal reference. The expression levels of target mRNAs were calculated using formula 2^−ΔΔCt. The primers were shown in Table 1.

Table 1

The primers used in RT-qPCR analysis
Gene	Forward	Reverse
β-catenin	TGGATTGATTCGAAATCTTGCC	GAACAAGCAACTGAACTAGTCG
PDK1	AACCGACACAATGATGTCATTC	ATGCGACTCATGTAGAATCGAT
MCT1	TGGCTGTCATGTATGGTGGA	AAGTTGAAGGCAAGCCCAAG
LDHA	ATG GCA ACT CTA AAG GAT CAG C	CCA ACC CCA ACA ACT GTA ATC T
β-actin	CTC CAT CCT GGG CTC GCT GT	GCT GTC ACC TTC ACC GTT CC

2.10. Effect of aspirin on cell activity

Beas-2B cells were pretreated with 0 mmol/L, 0.625 mmol/L, 1.25 mmol/L, 2.5 mmol/L, 5 mmol/L, and 10 mmol/L aspirin for 2 hours, and then exposed to 25 µg/mL nickel for 24 hours. 0 µg/mL was used as a blank control group. Then the CCK-8 assay was used to detect the effects of aspirin concentration groups on cell viability after exposure to Ni-refining fumes.

2.11. Effect of aspirin on the Warburg effect in Beas-2B cells

Beas-2B cells were grouped into a blank control group, a 25 µg/mL nickel-dyed group, an aspirin (A5376, Sigma-Aldrich, USA) group treated alone, and a 25 µg/mL nickel + 2.5 mmol/L aspirin-treated group. The aspirin-treated group needed to treat the cells 2 hours in advance, then discarded the aspirin and continued incubation with the growth solution and 25 µg/mL of nickel-refined soot suspension for 24 hours.

2.12. Effect of aspirin on ROS production in Beas-2B cells

Beas-2B cells were respectively pretreated with DMEM and 2.5 mmol/L aspirin for 2 h and then exposed to 25 µg/mL nickel for 24 h. 0 µg/mL was used as the blank control group, and then the ROS production level was detected according to the ROS production volume kit.

2.13. Statistical analysis

All experimental results were independently repeated three times and were expressed as‾x ± SD. Graphpad prism 8.0 software was used to analyze the relevant data. One-way ANOVA was used for statistical comparison between groups. These differences were deemed statistically significant at P < 0.05.

3.1 Ni-refining fumes effect on cytotoxicity of Beas-2B cells

As the exposure concentration increased, the survival rate of cells decreased gradually, which was 100%, 83.48%, 79.19%, 62.05%, 19.96% and 4.00% respectively ( Fig. 1 A). In addition, the number of cells decreased under high power fields of view, and most cells lost their normal shape and became fragmented (Fig. 1 B).

3.2 Effect of Ni-refining fumes on lactic acid produced by Beas-2B cells

We found that the content of lactic acid produced by cells in each exposed group increased significantly (5.39, 7.64, 10.56, 19.11, 26.87 and 28.85 mmol/L respectively) (Fig. 2), compared with the control group. There was a dose-response relationship between the content of lactic acid produced by cells and the concentration of nickel refining dust (P<0.05).

3.3 Effect of Ni-refining fumes on ROS production in Beas-2B cells

ROS production increased significantly with the increase in nickel refining flue gas concentration (Fig. 3). The fluorescence intensity of ROS increased gradually at a high power field, indicating that Beas-2B cells were stimulated by nickel refining soot to produce oxidative stress.

3.4 Effect of Ni-refining fumes on PDH activity in Beas-2B cells

As shown in Table 2, the activity of PDH in the nickel refining fumes exposure group were significantly lower than that in the control group, and with the increase in the dose of nickel refining fumes, the activity of PDH decreased continuously, and the difference was statistically significant. (P<0.05).

Table 2 The PDH activity in the Beas-2B cells of each infected group(x( — ) ±s , n=3)

group	dose(μg/mL)	PDH activity(U/10⁴ cell)
control group	0.00	0.38±0.0027
Infected group	12.50	0.23±0.0060^**
	25.00	0.16±0.0060^**
	50.00	0.073±0.0028^**

Compared with the control group, ^**P<0.01.

3.5 Ni-refining fumes promoted the activation of the Wnt/β-catenin pathway and induced the Warburg effect in Beas-2B cells

Our research showed that the expression of β-catenin was higher than the match group (Fig. 4 A, B). Meanwhile, the Warburg effect proteins expression also increased, which was proved by increasing of PDK1, MCT1 and LDHA (Fig. 4 C, D, E, F ). The expression of β-catenin, PDK1, MCT1 and LDHA mRNA gradually increased with the increase in nickel refining soot concentration. The mRNAs in the highest concentration group were two times higher than those in the lowest concentration group. ( Fig. 4 G, H) (P<0.05). Experiments have shown that Ni-refining fumes can be expressed by activating the Wnt/β-catenin pathway and the Warburg effect.

3.6 XAV-939 inhibited the Warburg effect caused by Ni-refining fumes

The expression of β-catenin protein in the Wnt/β-catenin signaling pathway in the inhibitor group was significantly lower than that in the DMSO control group, indicating that XAV-939 could effectively inhibit the Wnt/β-catenin signaling pathway (Fig. 5 A, B). When treated with 25 μg/mL Ni-refining fumes, the expression of β-catenin protein was significantly decreased in the XAV-939 group compared with the Ni+DMSO group(Fig. 5 C, D). With the inhibition of the Wnt/β-catenin pathway, the expression of Warburg effect-related proteins, including PDK1, MCT1 and LDHA, also showed a downward trend, indicating that the Wnt/β-catenin pathway can regulate the downstream Warburg effect (Fig. 5E-H) (P<0.05).

3.7 Effect of aspirin on cell activity after exposure to Ni-refining fumes

Nickel refining soot had an inhibitory effect on cell survival compared to the blank control group (Fig. 6). The survival of Beas-2B cells were higher in the 0.625 mmol/L, 1.25 mmol/L, 2.5 mmol/L, 5 mmol/L, and 10 mmol/L aspirin-treated groups than in the nickel powder alone group. The cells survival rate were highest in the 2.5 mmol/L aspirin group compared with the nickel powder group in the aspirin-treated group (P<0.05).

3.7 Aspirin inhibited the Warburg effect by inhibiting the Wnt/β-catenin pathway

The addition of 25 μg/mL nickel refining soot significantly increased the expression of the cellular pathway β-catenin protein as well as the Warburg effect-related proteins PDK1, MCT1, and LDHA (P<0.05). Compared with the 2.5 μg/mL nickel-dyed dust group, the expression of β-catenin protein as well as Warburg effect-related proteins PDK1, MCT1 and LDHA in Beas-2B cells were significantly reduced after aspirin intervention (Fig. 7A-F) (P<0.05). In contrast, there was no significant difference in the aspirin-only group compared with the control group. When aspirin was given to Beas-2B cells, it inhibited the Wnt/β-catenin pathway (Fig. 7A, B). Warburg effect-related proteins PDK1, MCT1, and LDHA were also suppressed (Fig. 7C-F) (P<0.05). The experimental results showed that aspirin suppressed the Warburg effect by inhibiting the pathway.

3.8 Aspirin inhibited the production of ROS

In the high magnification microscopic field, the fluorescence intensity of ROS was significantly increased in the Ni group compared with the blank control group and significantly decreased compared with the aspirin intervention group (Fig. 8). The results indicated that aspirin had a significant inhibitory effect on the production of ROS in Beas-2B cells stimulated by Ni-refining fumes.

Nickel accumulates in human tissues and organs, such as liver, blood, lung, kidney, and immune system, ect [16]. Nickel and its compounds have been proved to have a clear risk of cancer. Long term exposure will cause pulmonary respiratory inflammation, even lung cancer. Previous studies of the research group have shown that Ni-refining fumes had a variety of toxic effects on cells, such as inhibiting cell growth, inducing oxidative stress, causing DNA and mitochondrial damage, triggering inflammatory reactions, etc [17, 18].

According to studies, glycolysis is involved in lung injury caused by a variety of exogenous chemicals [19, 20]. It mainly works through some key proteases, including PDK1, MCT1 and LDHA. PDK1 is a key enzyme in glucose metabolism pathway, which can promote gluconeogenesis of pyruvate, lactic acid and alanine. PDK1 phosphorylates PDH to inactivate it and inhibit the conversion of pyruvate to acetyl coenzyme A, thus preventing pyruvate from entering the tricarboxylic acid cycle [21, 22]. Studies have shown that arsenic exposure can activate PDK1 and induce the Warburg effect [23]. The malignant transformation of Beas-2B cells induced by aflatoxin B1 was completed by miR-138-1 regulating PDK1 [24]. LDHA is an important oxidoreductase in the glycolysis pathway in vivo. LDHA mediated glycolysis which was involved in pulmonary branch morphogenesis [25]. The expression of LDHA was up-regulated during the abnormal transformation of human bronchial epithelial cells induced by hexavalent chromium [26]. Lactic acid is the final product of the Warburg effect. MCT1 played a vital role in lactic acid circulation, energy metabolism and cell pH regulation [27], and participates in the lactic acid metabolism of lung tumors [28]. Hypoxic cells under hypoxic conditions were converted to the Warburg metabolism due to NOX and mitochondrial production of ROS. Both HIF-1 and ERK1/2 can facilitate the conversion of glycolytic metabolism to ROS. It has been shown that ROS can affect cellular metabolism and mitochondrial function, thus directly or indirectly affecting the Warburg effect [29]. Our study found that Ni-refining fumes stimulated Beas-2B cells to express high levels of PDK1, MCT1 and LDHA, which was accompanied by increased lactate secretion, a decrease in intracellular PDH activity and high production of ROS. It indicated that the Warburg effect was involved in the pulmonary toxicity of nickel refining fume, which is exacerbated by the production of large amounts of ROS.

β-catenin is a key component of the Wnt/β-catenin pathway and activation of this pathway can promote the occurrence and progression of multiple malignancies [30]. According to statistics, about 50% of patients with non-small cell lung cancer (NSCLC) have the phenomenon of over activation of the Wnt/β-catenin pathway [31]. By interfering with the Wnt/β-catenin signal transduction in colon cancer cells, it can inhibit the process of cell glycolysis and then inhibit tumor development [32]. Through in vitro cells experiments, it was found that with the increase of Ni-refining fumes concentration, the expression of β-catenin aslo increased. It indicated that the Wnt/β-catenin pathway was activated. The activation of this pathway increased the expression of Warburg effect-related proteins PDK1, MCT1, and LDHA.

Aspirin is a classic non steroidal anti-inflammatory drug. Aspirin has been reported to attenuate tumour glycolysis and cell proliferation [33]. Aspirin can play an anti-proliferative role by upregulating SIRT3 through deacetylating CypD, promoting the release of HK-II from the outer mitochondrial membrane to the cytoplasm, and then blocking cellular glycolysis. Aspirin not only inhibited the proliferation of NSCLC cells in vitro but also inhibited tumour growth in vivo via AMPK/SIRT3/HK-II-mediated glycolysis [34]. Aspirin also reduced the expression of aerobic glycolysis-associated GLUT1 and PKM2, as well as the proliferative factors cyclin D1, β-catenin, phosphorylated Src, Akt and Smad, and slowed tumour growth in hormonal HFD-fed mice, accompanied by downregulation of GLUT1 and PKM2 in mouse Lewis lung cancer cells [35]. In our study, after the cells were pre-treated with aspirin, the results showed that β-catenin expression was low and the expression of proteins PDK1, MCT1 and LDHA decreased, corresponding to the Warburg effect. At the same time, the level of the ROS production was suppressed. This phenomenon indicated that aspirin inhibited the Wnt/β-catenin pathway to regulate the Warburg effect. Aspirin can alleviate, to some extent, the oxidative stress in cells caused by nickel refining fumes.

Our findings showed that Nickel refining fumes induced Beas-2B cells cytotoxicity and oxidative stress and increased the expression of the Warburg effect via the Wnt/β-catenin pathway. Aspirin effectively inhibited the Wnt/β-catenin pathway and alleviated the Warburg effect. It inhibitd the production of reactive oxygen species to a certain extent. We used in vitro experiments to simulate professional workers' exposure to Ni-refining fumes. It investigated the specific molecular mechanism of causing lung injury in occupational populations from the standpoint of energy metabolism. To propose a novel method for preventing and treating lung cancer in workers exposed to Ni-refining fumes.

Acknowledgements

The authors wish to thank all those who have contributed to this study and the projects from the National Natural Science Foundation of China (81973010, 82273601).

Funding

This work was supported by the projects from the National Natural Science Foundation of China (81973010, 82273601).

Competing Interests

Conflict of interest The authors declare no competing interests, or other interests that might be perceived to influence the results and/or discussion reported in this paper.

Author contributions

GY, ZT, WSY and WYH conceived the idea of the study. GY conducted the data analysis and drafted and revised the article. ZD, WY, WR, YCP, YSK, LLN and YWX participated in the experiments and revised the article. All authors contributed to the article and approved the submitted version.

Data availability

Enquiries about data availability should be directed to the authors.

Ethics approval

The animal experiments were approved by the Laboratory Animal Center of Nantong University.

Open Access

This article is licensed under a Creative Commons Attri-bution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are

included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Zdrojewicz Z, Popowicz E, Winiarski J. (2016) [Nickel - role in human organism and toxic effects]. Pol Merkur Lekarski, 41, 115–8.
Kasprzak K S, Sunderman F W, Jrsalnikow K. (2003) Nickel carcinogenesis. Mutat Res, 533, 67–97. DOI:10.1016/j.mrfmmm.2003.08.021
Chen H. Costa M. (2006) Effect of soluble nickel on cellular energy metabolism in A549 cells. Exp Biol Med (Maywood), 231, 1474–80. DOI:10.1177/153537020623100905
Manzi L, Costantini L, Molinari, et al. (2015) Effect of Dietary ω-3 Polyunsaturated Fatty Acid DHA on Glycolytic Enzymes and Warburg Phenotypes in Cancer. Biomed Res Int, 2015, 137097. DOI:10.1155/2015/137097
Vallée A, Guillevin R, Vallée J N. (2018) Vasculogenesis and angiogenesis initiation under normoxic conditions through Wnt/β-catenin pathway in gliomas. Rev Neurosci, 29, 71–91. DOI:10.1515/revneuro-2017-0032
Thompson C B. (2014) Wnt meets Warburg: another piece in the puzzle? EMBO J, 33, 1420–2. DOI:10.1016/j.bcp.2008.09.020
Cates M J, Beverly A. (2013) AB0355High dose aspirin versus ibuprofen for pain relief in rheumatoid arthritis: a systematic review. Annals of the Rheumatic Diseases, 72, A895-A896. http://dx.doi.org/10.1136/annrheumdis-2013-eular.2677
Hybiak J, Broniarek I, KiryczyŃski G, et al. (2020) Aspirin and its pleiotropic application. Eur J Pharmacol, 866, 172762. DOI:10.1016/j.ejphar.2019.172762
Sanyal S N, Kaushal N. (2005) Effect of two non-steroidal anti-inflammatory drugs, aspirin and nimesulide on the D-glucose transport and disaccharide hydrolases in the intestinal brush border membrane. Pharmacol Rep, 57, 833–9.
Li S, Dai W, Mo W, et al. (2017) By inhibiting PFKFB3, aspirin overcomes sorafenib resistance in hepatocellular carcinoma. Int J Cancer, 141, 2571–2584. DOI:10.1002/ijc.31022
Spitz G A, Furtado C M, Sola-Penna M, et al. (2009) Acetylsalicylic acid and salicylic acid decrease tumor cell viability and glucose metabolism modulating 6-phosphofructo-1-kinase structure and activity. Biochem Pharmacol, 77, 46–53. DOI:10.1016/j.bcp.2008.09.020
Ai G, Dachineni R, Kumar D. R, et al. (2016) Aspirin inhibits glucose–6–phosphate dehydrogenase activity in HCT 116 cells through acetylation: Identification of aspirin-acetylated sites. Mol Med Rep, 14, 1726-32.DOI:10.3892/mmr. 2016.5449
Choi H W, Tian M, Manohar M, et al. (2015) Human GAPDH Is a Target of Aspirin's Primary Metabolite Salicylic Acid and Its Derivatives. PLoS One, 10, e0143447. DOI:10.1371/journal.pone.0143447
Wang L, Shen S, Wang M, et al. (2019) Rho GTPase Activating Protein 24 (ARHGAP24) Silencing Promotes Lung Cancer Cell Migration and Invasion by Activating β-Catenin Signaling. Med Sci Monit, 25, 21–31. DOI:10.12659/MSM.911503
Lin S, Chen Q, Zhang L, et al. (2021) Overexpression of HOXB4 Promotes Protection of Bone Marrow Mesenchymal Stem Cells Against Lipopolysaccharide-Induced Acute Lung Injury Partially Through the Activation of Wnt/β-Catenin Signaling. J Inflamm Res, 14, 3637–3649. DOI:10.2147/JIR.S319416
Zhang J, Zhang J, Li M, et al. (2011) Methylation of RAR-β2, RASSF1A, and CDKN2A genes induced by nickel subsulfide and nickel-carcinogenesis in rats. Biomed Environ Sci, 24, 163–71. DOI:10.3967/0895-3988.2011.02.011
Wang Y, Wang S Y, Jia L, et al. (2016a) Nickel-Refining Fumes Induced DNA Damage and Apoptosis of NIH/3T3 Cells via Oxidative Stress. Int J Environ Res Public Health, 13. DOI:10.3390/ijerph13070629
Pan Y L, Xin R, Wang S Y, et al. (2018) Nickel-smelting fumes induce mitochondrial damage and apoptosis, accompanied by decreases in viability, in NIH/3T3 cells. Arch Biochem Biophys, 660, 20–28. DOI:10.1016/j.abb.2018.10.008
Zhang Y, Yuan D, Li Y, et al. (2021) Paraquat promotes acute lung injury in rats by regulating alveolar macrophage polarization through glycolysis. Ecotoxicol Environ Saf, 223, 112571. DOI:10.1016/j.ecoenv.2021.112571
Mao N, Yang H, Yin J, et al. (2021) Glycolytic Reprogramming in Silica-Induced Lung Macrophages and Silicosis Reversed by Ac-SDKP Treatment. Int J Mol Sci, 22. DOI:10.3390/ijms221810063
Kaplon J, Zheng L, Meiss K, et al. (2013) A key role for mitochondrial gatekeeper pyruvate dehydrogenase in oncogene-induced senescence. Nature, 498, 109–12. DOI:10.1038/nature12154
Sutendra G, Kinnaird A, Dromparis P, et al. (2014) A nuclear pyruvate dehydrogenase complex is important for the generation of acetyl-CoA and histone acetylation. Cell, 158, 84–97. DOI:10.1016/j.cell.2014.04.046
Zhao F, Severson P, Pacheco S, et al. (2013) Arsenic exposure induces the Warburg effect in cultured human cells. Toxicol Appl Pharmacol, 271, 72–7. DOI:10.1016/j.taap.2013.04.020
Wang Y, Zhang Z, Wang H, et al. (2016b) miR-138-1* regulates aflatoxin B1-induced malignant transformation of BEAS-2B cells by targeting PDK1. Arch Toxicol, 90, 1239–49. DOI:10.1007/s00204-015-1551-4
Fernandes-Silva H, Alves M G, Araújo-Silva H, et al. (2021) Lung branching morphogenesis is accompanied by temporal metabolic changes towards a glycolytic preference. Cell Biosci, 11, 134. DOI:10.1186/s13578-021-00654-w
Rodrigues C F, Urbano A M, Matoso E, et al. (2009) Human bronchial epithelial cells malignantly transformed by hexavalent chromium exhibit an aneuploid phenotype but no microsatellite instability. Mutat Res, 670, 42–52. DOI:10.1016/j.mrfmmm.2009.07.004
Halestrap A P. (2012) The monocarboxylate transporter family–Structure and functional characterization. IUBMB Life, 64, 1–9. DOI:10.1002/iub.573
Faubert B, Li, K Y, Cai L, et al. (2017) Lactate Metabolism in Human Lung Tumors. Cell, 171, 358–371 e9. DOI:10.1016/j.cell.2017.09.019
Rodic S, Vincent M D. (2018) Reactive oxygen species (ROS) are a key determinant of cancer's metabolic phenotype. Int J Cancer, 142, 440–448. DOI:10.1002/ijc.31069
Zhan T, Rindtorff N, Boutros M. (2017) Wnt signaling in cancer. Oncogene, 36, 1461–1473. DOI:10.1038/onc.2016.304
Akiri G, Cherian M M, Vijayakumar S, et al. (2009) Wnt pathway aberrations including autocrine Wnt activation occur at high frequency in human non-small-cell lung carcinoma. Oncogene, 28, 2163–72. DOI:10.1038/onc.2009.82
Pate K T, Stringari C, Sprowl-Tanio S, et al. (2014) Wnt signaling directs a metabolic program of glycolysis and angiogenesis in colon cancer. EMBO J, 33, 1454–73. DOI:10.15252/embj.201488598
Huang H, Tang S, Ji M, et al. (2018) p300-Mediated Lysine 2-Hydroxyisobutyrylation Regulates Glycolysis. Mol Cell, 70, 663–678.e6. DOI:10.1016/j.molcel.2018.04.011
Ren G, Ma Y, Wang X, et al. (2022) Aspirin blocks AMPK/SIRT3-mediated glycolysis to inhibit NSCLC cell proliferation. Eur J Pharmacol, 932, 175208. DOI:10.1016/j.ejphar.2022.175208
Wang J D, Chen W Y, Li J R, et al. (2020) Aspirin Mitigated Tumor Growth in Obese Mice Involving Metabolic Inhibition. Cells, 9. DOI:10.3390/cells9030569

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Aspirin inhibited the Warburg effect induced by Ni-refining fumes via the Wnt/β-catenin pathway in Beas-2B cells

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Cell culture

2.2. Preparation of Ni-refining fumes

2.3. Cell viability assay

2.4. Lactate production assay

2.5. ROS generation level

2.6. PDH activity assay

2.7. Western blot analysis

2.8. XAV-939 inhibited the Wnt/β-catenin pathway

2.9. RT-PCR analysis

2.10. Effect of aspirin on cell activity

3. Results

4. Discussion

5. Conclusions

Declarations

References

Additional Declarations

Status:

Version 1