First report on the presence of the huanglongbing vectors in Ghana

doi:10.21203/rs.3.rs-2399317/v1

Download PDF

Article

First report on the presence of the huanglongbing vectors in Ghana

https://doi.org/10.21203/rs.3.rs-2399317/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 12 Jul, 2023

Read the published version in Scientific Reports →

You are reading this latest preprint version

As significant threats to global citrus production, Diaphorina citri (Kuwayama; Hemiptera: Liviidae) and Trioza erytreae (Del Guercio; Hemiptera: Triozidae) have caused considerable losses to citrus trees globally. Diaphorina citri vectors “Candidatus Liberibacter asiaticus” and “Ca. L. americanus”, the causative agents implicated in Asian Huanglongbing (HLB), whereas T. erytreae transmits “Ca. L. africanus”, the pathogen responsible for the African form of the disease. Though HLB is the deadliest disease of citrus wherever it occurs, information on the occurrence and geographical distribution of its vectors in Africa is limited. In recent surveys to determine if HLB vectors are present in Ghana, we observed eggs, nymphs, and adults of insects suspected to be D. citri and T. erytreae. Using morphological traits and DNA analyses, the identity of the adult and nymphal stages of the suspected insects was confirmed to be D. citri and T. erytreae, respectively. Individuals of D. citri and T. erytreae were examined using qPCR for CLaf, CLam, and CLas, but none of them tested appositive for any of the Liberibacter species. Herein we report, for the first time, the presence of D. citri and T. erytreae in Ghana (West Africa). We discuss the implications of this new threat to the citrus industry to formulate appropriate management strategies.

Biological sciences/Biological techniques

Biological sciences/Ecology

Biological sciences/Evolution

Biological sciences/Genetics

Biological sciences/Molecular biology

Biological sciences/Zoology

DNA barcoding

Diaphorina citri

Trioza erytreae

invasive pest

citrus greening disease

citrus

The Asian citrus psyllid Diaphorina citri (Kuwayama, 1908) (Hempitera: Liviidae) and African citrus triozid Trioza erytreae (Del Guercio, 1918) (Hemiptera: Triozidae) are the most devastating pests of citrus. Their potential for significant impacts on citrus production and productivity is high due to international trade and movement of host plant materials across borders.^1,2 Diaphorina citri and T. erytreae are native to southern Asia and Africa, respectively.^3,4 However, as of November 2022, each of them has been reported from at least 30 countries worldwide.^5,6,7 In Africa, D. citri occurs in Kenya and Zanzibar,⁸ and more recently, in Nigeria, Ethiopia and Benin^9,10,11. Outside Africa, T. erytreae has been reported from Spain and Portugal.¹² Maximum Entropy and CLIMXEX modelling of the potential global distribution of D. citri and T. erytreae in the world suggest that parts of Africa have climate suitable areas for the proliferation of both psyllids. ^5,7

Diaphorina citri and T. erytreae feed on citrus and non-citrus species. Specifically, a wide variety of plants, especially those in the family Rutaceae, serves as hosts for the psyllids. The psyllids are highly polyphagous, with each having at least 23 non-citrus host plants. ^13,14 The psyllids attack many economically important citrus species,, including grapefruit, lemon, lime and sweet oranges. However, the most preferred host plants for D. citri are the orange jasmine Murraya paniculata (L.) Jack., and the curry leaf plant Bergera koenigii (L.). ¹⁵ Orange jasmine is a commonly grown ornamental plant in residential areas for beautification and hedging, and has therapeutic properties.¹⁶ In contrast, T. erytreae prefers Citrus limon (L.) to other host plants. ^17,18

The adults of D. citri have speckled brown wings and measure between 2.7 and 3.3 mm in length, ¹⁹ while T. erytreae is about 4mm long, with females being slightly larger than males.¹⁸ D. citri adults can be gray/brown, blue/green, and orange/yellow, with three generally distinct abdominal colours in adults. In contrast, T. erytreae adults start pale but gradually darken afterwards to a light brown. Both psyllids lay eggs along the margin of the leaves of their host plants. The females of D. citri may lay 40 eggs per flush shoot per day.²⁰ The average number of eggs laid by T. erytreae females per day ranges from 17 in the winter to 39 in the summer, respectively.²¹ The freshly laid eggs of D. citri are pale but change into yellow and orange with two unique red eye spots at maturity.¹⁹ The development of the psyllids goes through five nymphal instars. When feeding on leaves, adults rest at a body angle of about 45 and 35 ^o for D. citri and T. erytreae, respectively.^12,19

Both citrus psyllids cause direct and indirect damage to citrus. Feeding activities of D. citri nymphs and adults lead to substantial uptake of plant sap and may induce sooty mold development due to honeydew production on infested flush shoots. Sooty mold affects the photosynthetic activities of the citrus trees, thereby reducing their productivity.²² Direct foliage feeding by T. erytreae results in stunted and seriously deformed leaves showing signs of pit-like galls. ²³ Although direct feeding damage of psyllids may result in a loss of plant vigor, indirect damage via vectoring of HLB pathogens is the most economically important. All over the world, HLB is caused by the phloem-limited bacterium “Candidatus Liberibacter asiaticus” (CLas), transmitted by D. citri²⁴. Diaphorina citri can also transmit Ca. Liberibacter americanus (CLam), the causal pathogen responsible for the American form of HLB. In contrast, in Africa, especially East and South Africa, T. erytreae represents an economically significant threat to the citrus industry because of its ability to vector "Ca. Liberibacter africanus" (CLaf), the causal agent of the African HLB. However, a recent study by Ajene et al.²⁵ showed field populations of T. erytreae carrying CLas. Unlike the African HLB, the Asian HLB is the most destructive disease of all citrus in the world.²⁶

D. citri has weak muscles compared to the size of its wings, which prevent it from flying very far or maintaining a long flight.²⁷ According to Arakawa & Mivamolo,²⁸ the most extended flight duration for females and males are 978 mins and 1,241 mins, respectively. The authors also investigated extrapolation data and found that the mean flight speed of the psyllid in the absence of wind is 1.4 km h − ¹ and can fly for about 25 mins in a single flight. Additionally, the Asian citrus psyllid routinely migrates between managed and unmanaged groves, flying 60–100 m with a net migration toward managed groves.²⁹ Because ACP eggs are laid solely on young flush and nymphs develop primarily on young plant parts, population variations of this pest are highly correlated with the growth of new and young flush of the host plant¹⁹.³⁰ According to Catling,²¹Trioza erytreae has weak dispersal powers and are incapable of sustaining flight for long hours. In contrast, Samways and Manicom,³¹ showed that T. erytreae had a good dispersal ability and could invade orchards as far as hundreds of meters away to locate new flush shoots.

Citrus is one of the most widely grown fruits worldwide due to its high demand and positive impact on food and nutritional security.³² In terms of global trade value, it is one of the most valuable fruits.³³ The commonly known species of commercial importance are sweet oranges (Citrus sinensis), lemons (C. limon), limes (C. aurantifolia), grapefruit (C. paradisi), and tangerines (C. reticulata). Sweet oranges are the major species grown globally and represent more than half of the global citrus output. Annual global production of citrus was estimated at 158 million tonnes in 2020, with sweet oranges contributing to more than half of the world's total.³⁴Africa produced 975, 6176 metric tons of sweet oranges from an estimated 514,573 ha in 2020, while production in Ghana was at 697,637 metric tons from an estimated 17,983 ha.³⁴ The health benefits of sweet oranges and other citrus fruits are well documented, especially in providing vitamin C, carotenoids, and polyphenols. Most citrus fruits in many countries, including Ghana are consumed locally as fresh products.³⁵

Early detection of D. citri and T. erytreae would help develop strategies and manage the pests and diseases they transmit, slowing down their spread and preventing them from becoming established. Despite reports of the presence of the invasive and deadly D. citri in neighboring Nigeria and Benin ^{10, 11}, there have been no previous investigations to determine the existence of D. citri in Ghana. Given the economic importance of citrus production in Ghana, we conducted surveys for citrus commodity pests in the Volta region of Ghana to determine the presence of D. citri and T. erytreae and, if found, to test the samples for Liberibacter species.

Sample collection

To establish the presence of D. citri and T. erytreae in Ghana, surveys of residential areas and citrus orchards in the Volta Region, Ghana (Table 1), were conducted from April to November 2022. The main roads in each town were chosen for sampling. All encountered Citrus and Murraya species were visually inspected for the presence of D. citri and T. erytreae.

Table 1

Field characteristics of Asian citrus psyllid (*D. citri* Kuwayama) and African citrus triozid (*T. erytreae* Del Guercio) individuals suspected of being present in samples taken from different sites in Volta Region, Ghana.
Locality	Host plant	Purpose	Latitude	Longitude	Elevation	Adults	Nymphs	Eggs	Galls
Ahoe	Murraya paniculata	Ornamental	6.60147	0.46882	173	33	0	0	-
Dzavieme	Citrus	Backyard garden	6.60316	0.46894	174	0	0	0	-
Hevi	Murraya paniculata	Ornamental	6.60176	0.47119	172	36	86	101	-
Power house	Murraya paniculata	Ornamental	6.58339	0.48081	112	11	55	0	-
Mawuli Estate	Citrus	Backyard garden	6.59262	0.4725	142	0	0	0	-
Dome	Murraya paniculata	Ornamental	6.60838	0.47892	147	23	33	55	-
Awate-Todzi	Triclisia patens (Oliv.)	Backyard garden	6.86823	0.24543	227	152	233	355	yes

Each backyard hedge (Fig. S1) with a host plant was visually examined for D. citri adults and symptomatic leaves (Fig. S2). Expanding flush shoots and at high densities on the stems are where D. citri nymphs are attached (Fig. S3). In contrast, T. erytreae nymphs are usually found on the underside of the leaves (Fig. S4). To collect the nymphal stages from the plants, we thoroughly searched for the immature stages on the stems and new tender shoots. Inspection of host plant was further aided by feeding damage, such as 'epinasty', and distortion of young and fragile leaves due to the sap-feeding of D. citri nymphs and adults, and the presence of the white waxy excretions from the nymphs (D. citri).^{10, 19} In addition, T. erytreae pit-like galls were used to detect the presence of the triozid.¹⁸ In case adult insects were found, they were aspirated into plastic vials containing 95% ethanol, and nymphs were brushed into similar vials using a fine camel brush. The host plant observed was recorded for each location. Moreover, the coordinates of each sample location were recorded using a handheld Garmin eTrex® 32x device.

Identification of the suspected D. citri and T. erytreae.

Morphological identification. The insects were first identified visually using morphological characteristics⁴, and then a subset of samples was sent to the Texas A&M University Kingsville Citrus Center (TAMUK-CC) in Weslaco, Texas, USA for additional morphological and molecular analyses. The suspected insects underwent a thorough morphological characterization at TAMUK-Entomology CC's laboratory, where they were compared to preserved reference voucher specimens. We used the morphological characteristics reported by Mead⁴, Yang³⁶, and OEPP/EPPO³⁷ to positively identify D. citri nymphs and adults. Moreover, Aidoo et al.¹⁸ and Cocuzza et al.¹², reports on T. erytreae morphometry were used for their identification. The voucher specimens were kept at TAMUK-CC and the Central Laboratory of the University of Environment and Sustainable Development, Somanya, Ghana.

Nucleic acid isolation and PCR. In this study, we used the method described by Dellaporta et al.³⁸ to extract total nucleic acids (TNA) from both adult and nymphs of the psyllids. NanoDrop 2000 series spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) was used to measure the concentration and purity of the TNA extracts before they were frozen at 20°C for later use. Two microliters (uL) of each sample was utilised as template in a 25 uL polymerase chain reaction (PCR) using the PrimeSTAR GXLDNA Polymerase, its recommended reagents, and the Rapid Protocol (Takara Bio USA, Inc., Mountain View, CA). We targeted 821-bp and 708 -bp segments of the mtCOI coding region in the D. citri³⁹ and T. erytreae ⁴⁰ using the primer pair DCITRI COI-L and DCITRI COI-R and Te-6U30 and Te-720L26, respectively. Positive controls consisted of DNA samples taken from TAMUK-lab-reared CC's ACPs. The 100-2,000 bp Wide-Range DNA Ladder (Takara Bio USA, Inc.) and the amplified products were run on ethidium bromide-stained 1% agarose gels and then visualised using a UV-transilluminator.

Cloning and sequencing. Zymoclean Gel DNA Recovery Kit was used to cut out and gel-elute the appropriate size DNA bands from the sample and the target (Zymo Research, Irvine, CA). After purification, the recovered DNA was cloned into the pJET1.2/blunt vector one at a time using the CloningJET PCR Kit (Thermo Fisher Scientific). Transforming chemically competent DH5 Escherichia coli cells with the ligation products yielded two to three plasmids per cloned DNA amplicon that were PCR-verified to be the correct size (Sigma-Aldrich, St. Louis, MO). By using the Sanger sequencing technique and primers designated as pJET1.2 F and pJET1.2 R, each plasmid sample was sequenced in both directions (ELIM BIOPHARM, Hayward, CA, USA).

Bioinformatic analysis. The pJET1.2 contamination was removed from the raw sequences using VecScreen (https://www.ncbi.nlm.nih.gov/tools/vecscreen/). Each sample's forward and reverse sequences were entered into the CAP contig assembly function of the BioEdit software⁴¹ to generate a consensus sequence. As a means of determining which species each consensus sequence belonged to, BLASTn analysis⁴² was performed on all the sequences of the psyllids. Multiple sequence alignments were generated between the sequences derived in this study and those obtained from GenBank using the MUltiple Sequence Comparison by Log-Expectation alignment program (http://www.ebi.ac.uk/Tools/msa/muscle/). The sequences were chosen because they are representative of the diversity of the taxonomic groups studied. The sequence identity matrices and phylogenetic analyses were calculated using the maximum likelihood approach in MEGA version 7.0⁴³, which was applied to the gene-specific alignment data. Instead of using tables of pairwise sequence identity scores, which are commonly used for this purpose, it is recommended to use the Sequence Demarcation Tool (SDT), which displays pairwise identity scores using a color-coded matrix⁴⁴. This makes it easier to gain insights into the overall relationships between sequences in a dataset. Moreover, we calculated the pairwise using SDT in this study. Trioza species considered in this study included those from Percy et al.⁴⁵ and Khamis et al.⁴⁶

Tests for Ca. Liberibacter spp. Taqman Multiplex Real-Time PCR tests were done on an ABI 7500 Fast Thermocycler (Thermo Fisher Scientific Inc., Waltham, MA) or a SmartCycler II (Cepheid, Sunnyvale, CA) and the DNA extracts were assayed for CLaf, CLam and CLas as described ^47–49. All reactions included a standard set of positive and negative DNA controls, as well as a non-template water control. At a cycle threshold (Ct) of ≤ 37, it was determined that a sample was positive for the presence of a given bacterium.

Field detection and morphological identification. The altitudes of all locations investigated ranged from 112 to 174 meters above sea level (m.a.s.l). The field-collected insects were morphologically identified as D. citri and T. erytreae using previously published features,^{4, 12, 18, 36, 37} and by comparison with voucher specimens (Fig. 1).

Both the TAMUK-CC Entomology Laboratory in Weslaco, Texas, and the University of Environment and Sustainable Development in Somanya, Ghana, now hold voucher specimens of these samples. Four of seven locations had adult D. citri feeding on mature and/or young growing oranges jasmine leaves during the study. Only two of the seven surveyed areas had eggs of D. citri. From the six hotspots, we were able to collect a total of 433 specimens of D. citri (103 adults, 174 nymphs and 156 eggs) (Table 1). We also found pit-like open galls, indicative of T. erytreae infestation, ²³ on T. patens during the survey. As a result, we collected 740 specimens (152 adults, 233 nymphs and 355 eggs) from only one location. This, however, suggests that D. citri is more established and reasonably widespread in Volta region than T. erytreae, given the vast dispersion of the positive detection in different locations and the observation of developing nymphs and eggs at three different sites.

Molecular detection. A subset of six adults each of D. citri and T. erytreae were chosen at random to represent the geographical diversity of the sampled insects, and their gene-specific DNA amplicons were found to be of the predicted sizes (Table 2).

Table 2

Primers used for the amplification of gene segments of the Asian citrus psyllid (*D. citri*) and African citrus triozid (*T. erytreae*).
Primer name	Sequence (5′ – 3′)	(bp)	Host/Gene Target	Source
DCITIR COI-L	AGGAGGTGGAGACCCAATCT	834	D. citri/mtCOI	Boykin et al. ³⁹
DCITRI COI-R	TCAATTGGGGGAGAGTTTTG
Te-6U30	ATTTTTAAGCACTAATCATAAAATTATTGG	708	T. erytreae /mtCOI	Pérez-Rodríguez et al. ⁴⁰
Te-720L26	TATACTTCAGGATGTCCAAAAAATCA

There were a total of six sequences for D. citri COI; four using DCITRI COI-L/DCITRI COI-R and two using Te-6U30/Te-720L26. The T. erytreae samples had six sequences. D. citri sequences obtained with primers DCITRI COI-L/DCITRI COI-R showed a significant (100.0% nt identical; 100% query coverage; E-value 0.0) matches using BLASTn between these sequences and corresponding gene-specific sequences of D. citri that are deposited in GenBank from different countries. When T. erytreae primers Te-6U30/Te-720L26 were used to amplify the COI gene of D. citri, the results also revealed a significant (99.30–99.58% nt identical; 100% query coverage; E-value 0.0) matches with sequences of D. citri from other countries. T. erytreae sequences obtained with primers Te-6U30/Te-720L26 showed a significant (100% nt identical; 100% query coverage; E-value 0.0) matches using BLASTn between these sequences and corresponding gene-specific sequences of T. erytreae that are deposited in GenBank from different countries. However, the COI sequences from D. citri were significantly different from corresponding sequences of GenBank isolates of T. erytreae, showing only 42–43% nt identities.

Phylogenetic analysis. Maximum likelihood (ML) phylogenetic analysis of each gene-specific sequence was performed, and the Tamura 3-parameter model was shown to have the lowest Bayesian Information Criterion (BIC) scores. As expected, it was predicted that the Ghana mtCOI sequences of T. erytreae and D. citri fall inside the T. erytreae and D. citri clade of the psyllid ML trees (Fig. 2). Our analysis revealed that T. erytreae samples from Ghana clustered separately from other samples collected from other countries. It is worth mentioning that D. citri was also amplified by the so-called T. erytreae-specific primer. After further analysis, it was shown that the mtCOI sequences unique to D. citri clustered strongly into the Western clade. In addition, the D. citri samples from Ghana may likely represent a separate introduction event into Africa considering how distant they are from the other samples from Benin and Nigeria. Our results showed that all the Ghanaian D. citri mtCOI sequences from Volta Region clustered in the Western clade.

Color-coded pairwise identity

Possible demarcation criteria for the T. erytreae is assigned and compared to those of another other Trioza species. Based on the analyzed partial COI sequences, the African triozid samples from Ghana appear to be distant relatives of the species T. erytreae based on the combination of sequence variation and geographical segregation (Fig. 3). Trioza erytreae collected from Ghana belong to the same demarcation as T. erytreae from other countries when analyzed using the SDT.

For the first time, we report the presence of D. citri and T. erytreae in Ghana using both morphological and molecular studies. However, there have been recent reports of D. citri in Nigeria (West Africa)¹⁰ and other African countries, such as Ethiopia,⁹ Tanzania⁵⁰ and Kenya.⁸ In response, many citrus-producing areas in eastern and southern African countries have increased the intensity of their pest surveillance and monitoring.¹⁰ Herein, we initiated this study to ascertain the status of D. citri in Ghana to make early detection (if present) to inform concerted management efforts in Ghana and across sub-Saharan Africa. In addition, preventing an invasion is almost always cheaper than managing an invasive species once it has already entered an area.⁵¹ Moreover, this was done due to the dangers of transporting plants around the world and the fact that citrus has been grown in Ghana for centuries.

D. citri in Ghana was confirmed at elevations of less than 200 m.a.s.l. According to Holford et al.⁵² in Indonesia and Bhutan, high altitudes above 1000 m.a.s.l limit the incidence and occurrence of HLB and D. citri, respectively. Given that the entire country (i.e. Ghana) has an elevation of less than 1000 m.a.s.l, it is possible that the pest is widely distributed or can spread to other citrus-growing regions in the country. D. citri prefers warm and dry climates and suitable temperatures for development range between 25 and 28 ^oC.⁵³ However, it can also tolerate temperatures as low as 4 ^oC and as high as 41 ^oC due to its high degree of temperature plasticity.¹⁹ However, high temperatures may decrease the flight capacity of the pest.⁵⁴

A recent study, which used a species distribution model of suitability, concluded that most tropical Africa has a suitable climate for spreading D. citri and T. erytreae ^5,6,7. As a result of their research, they created a predictive niche map showing that many West, East, and Central African countries, including Ghana, are at high risk for D. citri establishment. In light of this, the presence of D. citri in Ghana demonstrates the severe threat posed by this invasive species to Ghana and other African countries where the pest is absent. The mtCOI mitochondrial COI gene of D. citri has been widely used in genetic variation and population structure studies ^55–57 because of its adaptability in diversifying insect populations across different geographical areas..

The presence of D. citri is of particular concern in Ghana, where agriculture is the backbone of the economy. Moreover, D. citri has risen to become a global threat to the viability of citrus businesses wherever the pest and the disease it transmits occur.²⁴ Agriculture remains a critical tool for sustainable development in many countries across sub-Saharan Africa, providing hundreds of millions of rural poor with new avenues out of poverty through smallholder farming, work in high-value crop production, entrepreneurial endeavors, and employment in rural and non-farming sectors. However, pests and diseases continue to threaten the sustainable production of crops in the continent. Among the pests is the T. erytreae, which is confined to Africa, the Middle East and Europe.^5,6 The presence of D. citri, which has a wide distribution in Asia, North America, and Brazil, demonstrates that the combined effects of the psyllid vectors could worsen the present losses associated with citrus pests. The African citrus triozidis heat-sensitive and develops best in the cooler highlands, while the Asiatic strain is believed to be more virulent and damaging overall.⁵⁸ This, however, suggests that the presence of Asian HLB could threaten the sustainable production of citrus in Ghana due to the suitable climate suitable areas in the country⁷.

Asian huanglongbing causal agents can be disseminated via grafting and vegetative propagation. However, D. citri is implicated in much of their long-distance and within orchard distribution. Diaphorina citri can be transported over long distances by moving citrus materials like citrus seedlings and alternate host plants. However, the psyllid may also move over long distances, and the prevailing wind direction and intensity can facilitate distance movement.^59–61 Diaphorina citri is primarily responsible for the introduction and subsequent spread of the Asian type of HLB in various parts of the world, including Brazil,⁶² Texas,⁶³ China,⁶⁴ and California⁶⁵.

In this study, D. citri was obtained from an alternate host plant (M. paniculata). Alternate hosts play a critical role in the dispersal and management of invasive pests.^66–67 M. paniculata is grown as an ornamental tree or hedge due to its durability, adaptability to a wide variety of soil, and suitability for larger hedges. In addition, the plant has antimicrobial, antioxidant, red blood cell membrane stabilization, and anti-inflammatory properties and is used to treat many diseases.⁶⁸ As a result, it has been used in many parts of the world to symptoms such as nausea, vomiting, constipation, diarrhoea, stomach discomfort, headache, fluid retention, and clot formation.¹⁶ In Ghana, the plant is mainly grown for its therapeutic uses, beautification and as a hedge.

Implication for management

Although the psyllids were collected from non-citrus host plants in Volta Region, Ghana nationwide surveys targeting citrus and non-citrus host plants are urgently needed to define the extent of the spread in Ghana. Effective management of psyllids and HLB can only be achieved through a thorough assessment of the distribution of the pest and the disease it transmits. In addition, identifying localities that are free of infection and where clean nursery programs can be established would offer some level of management against the psyllids. The removal of alternate host plants can be facilitated by a better understanding of areas where these plants are planted, which may also reveal the presence of previously unknown reservoirs of Ca. Liberibacter species. The majority of farmers in Ghana farm on subsistence basis, which is antithetical to effective implementation of the recommended practices for HLB management, such as the establishment of clean nurseries, area-wide intensive psyllids management, and larger contiguous blocks, etc. To effectively manage the psyllids, there is a need for regular inspection of citrus and non-citrus host plants at the Ghanaian ports of entry, and intercepted psyllids should be tested for HLB.^5,69 In light of our D. citri and T. erytreae confirmation, there is a need to assess the current distribution of D. citri, even beyond Ghana and to launch coordinated regional management initiatives to eradicate this destructive pest before it becomes endemic and spread CLas, CLam and CLaf throughout the region. Furthermore, stakeholders, researchers, and extension workers should all work together to establish reliable monitoring programs and comprehensive pest control in the region. If found in citrus, efforts will be required to identify optimal crop management, such as crop rotation, intercropping and planting time. Also, developing resistance varieties, such as genetically engineered insecticidal types, could help control the psyllid populations in an environmentally friendly manner because resistance in field populations of D. citri has been reported in citrus groves.^70,71 In this study, it is worth mentioning that D. citri was also sequenced by the T. erytreae-specific primer, which can be useful in detecting the psyllids at entry points.

Acknowledgement

We thank the Texas A & A University Kingsville, Citrus Center, The Texas AgriLife Extension Center, the University of Environment and Sustainable Development (UESD) for access to instruments, Dr. Gertrude L. A. Dali, University of Cape Coast, and Mr. Jonathan Dabo of Forest Research Institute of Ghana for the assisting us with the identification of the host plant species.

Author contribution statement

OFA wrote the first draft. OFA and MS conceived and designed the study. OFA, FKA, AKAA, KDN, JOO, WKH, AKD, GE, AFO and FLS collected data. OJA, OFA, MS, COA and YLS conducted analyses. All authors read the final manuscript.

Data Availability

The datasets generated and/or analyzed during this study are available upon request from the corresponding author.

Declaration of competing Interest

The authors declare that they have no known conflict of interests.

Compliance with ethical standard

This article does not contain any studies with human participants or animals performed by any of the authors.

Urbaneja, A., et al. Citrus pests in a global world. In The Genus Citrus (pp. 333–348). Woodhead Publishing (2020).
Halbert, S. E. et al. Trailers transporting oranges to processing plants move Asian citrus psyllids. Fla. Entomol. 93, 33–38 (2010).
Van den Berg, M. A., Deacon, V. E., & Steenekamp, P. J. Dispersal within and between citrus orchards and native hosts, and nymphal mortality of citrus psylla, Trioza erytreae (Hemiptera: Triozidae). Agric. Ecosyst. Environ. 35, 297–309 (1991).
Mead, F. W. The Asiatic citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae). Florida Department of Agriculture and Consumer Services, Division of Plant Industry, Entomology Circular. 180, 1– 4 (1977).
Aidoo, O. F. et al. Predicting the potential global distribution of an invasive alien pest Trioza erytreae (Del Guercio) (Hemiptera: Triozidae). Sci. Rep. 12, 20312 (2022a). https://doi.org/10.1038/s41598-022-23213-w.
Aidoo, O. F. et al. A machine learning algorithm-based approach (MaxEnt) for predicting invasive potential of Trioza erytreae on a global scale. Ecol. Inform. 1, 71:101792 (2022b).
Aidoo, O. F. et al. Climate-induced range shifts of invasive species (Diaphorina citri Kuwayama). Pest Manag. Sci. 78, 2534–2549 (2022c).
Rwomushana, I. et al. Detection of Diaphorina citri Kuwayama (Hemiptera: Liviidae) in Kenya and potential implication for the spread of Huanglongbing disease in East Africa. Biol. Invasions. 19, 2777–2787 (2017).
Ajene, I. J. et al. Detection of Asian citrus psyllid (Hemiptera: Psyllidae) in Ethiopia: a new haplotype and its implication to the proliferation of Huanglongbing. J. Econ. Entomol. 113, 1640–1647 (2020).
Oke, A. O., Oladigbolu, A. A., Kunta, M., Alabi, O. J. & Sétamou, M. First report of the occurrence of Asian citrus psyllid Diaphorina citri (Hemiptera: Liviidae), an invasive species in Nigeria, West Africa. Sci. Rep., 10, 1–8 (2020).
Sétamou, M., Soto, L.Y., Tachin, M., Alabi, O.J. Report on the first detection of Asian citrus psyllid Diaphorina citri Kuwayama (Hemiptera: Liviidae) in the Republic of Benin, West Africa. Scientific Reports (in press)
Cocuzza, G. E. M. et al. A review on Trioza erytreae (African citrus psyllid), now in mainland Europe, and its potential risk as vector of huanglongbing (HLB) in citrus. J. Pest Sci. 90, 1–17 (2017).
Arengo, E. Trioza erytreae (African citrus psyllid). CABI Compendium (2013). https://doi.org/10.1079/cabicompendium.5491.
Halbert, S. E., & Manjunath, K. L. Asian citrus psyllids (Sternorrhyncha: Psyllidae) and greening disease of citrus: a literature review and assessment of risk in Florida. Fla. Entomol. 87, 330–353 (2004).
Subandiyah, S., Himawan, A., Joko, T., Astuti, I. P., Holford, P., Beattie, G. A. C. & Krugger, R. Colonization of Asiatic citrus psyllid and Huanglongbing development on Citrus and Citrus relatives in Indonesia. In Proc Int Res Conf. 1, 393 (2008).
Dosoky, N. S., Satyal, P., Gautam, T. P. & Setzer, W. N. Composition and biological activities of Murraya paniculata (L.) Jack essential oil from Nepal. Medicines. 3, 7 (2016).
Benhadi-Marín, J., Garzo, E., Moreno, A., Pereira, J. A. & Fereres, A. Host plant preference of Trioza erytreae on lemon and bitter orange plants. Arthropod-Plant Interact. 15, 887–896 (2021). https://doi.org/10.1007/s11829-021-09862-0. Benhadi-Marín, J., Garzo, E., Moreno, A., 2021. Host plant preference of Trioza erytreae on lemon and bitter orange plants. Arthropod-Plant Interactions, 15(6), pp.887–896.
Aidoo, O. F. et al. Size and shape analysis of Trioza erytreae Del Guercio (Hemiptera: Triozidae), vector of citrus huanglongbing disease. Pest Manag. Sci. 75, 760–71 (2019a).
Hall, D. G., Richardson, M. L., Ammar, E. D., & Halbert, S. E. Asian citrus psyllid, Diaphorina citri, vector of citrus huanglongbing disease. Entomol. Exp. Appl. 146, 207–223 (2013).
Hall, D. G., & Hentz, M. G. Influence of light on reproductive rates of Asian citrus psyllid (Hemiptera: Liviidae). J. Insect Sci. 19, 9 (2019).
Catling, H. D. Notes on the biology of the South African citrus psylla, Trioza erytreae (Del Guercio) (Homoptera: Psyllidae). J. Entomol. Soc. South. Afr. 36, 299–306 (1973).
Insausti PEL, Ploschuk M, Izaguirre M, Podworny M) The effect of sunlight interception by sooty mold on chlorophyll content and photosynthesis in orange leaves (Citrus sinensis L.). Eur. J. Plant Pathol. 143:559–565 (2015.
Aidoo OF, Tanga CM, Mohamed SA, Rasowo BA, Khamis FM, Rwomushana I, Kimani J, Agyakwa AK, Daisy S, Sétamou M, Ekesi S. Distribution, degree of damage and risk of spread of Trioza erytreae (Hemiptera: Triozidae) in Kenya. J. Appl. Entomol. 143:822–33 (2019b).
Bové, J. M. Huanglongbing: a destructive, newly-emerging, century-old disease of citrus. J. Plant Pathol. 7–37 (2006).
Ajene, I. J. et al. First report of field population of Trioza erytreae carrying the huanglongbing-associated pathogen,‘Candidatus Liberibacter asiaticus’, in Ethiopia. Plant Dis. 103, 1766 (2019).
Chung, K. R. & Brlansky, R. H. Citrus diseases exotic to Florida: Huanglongbing (citrus greening). Plant Pathology Department Fact Sheet PP-210, Florida Cooperative Extension Service, Institute of Food and Agricultural Sciences, University of Florida. http://edis.ifas.ufl.edu/PP133 (2005).
Sakamaki, Y. Possible migration of the Asian citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae) between and within islands. Occas. Pap. Kagoshima Univ. Res. Cent. 42, 121–125 (2005).
Arakawa, K. & Mivamolo, K. Flight ability of Asiatic citrus psyllid, Diaphorina citri Kuwayama (Homoptera; Psyllidae), measured by a flight mill. Research Bulletin of the Plant Protection Service of Japan. 43, 23–26 (2007).
Cifuentes-Arenas JC, de Goes A, de Miranda MP, Beattie GA, Lopes SA. Citrus flush shoot ontogeny modulates biotic potential of Diaphorina citri. PLoS One. 2018 Jan 5;13(1):e0190563.
Boina, D. R., Meyer, W. L., Onagbola, E. O. & Stelinski, L. L. Quantifying dispersal of Diaphorina citri (Hemiptera: Psyllidae) by immunomarking and potential impact of unmanaged groves on commercial citrus management. Environ. Entomol. 38, 1250–1258 (2009).
Samways, M. J. & Manicom, B. Q. Immigration, frequency distributions and dispersion patterns of the psyllid Trioza erytreae (Del Guercio) in a citrus orchard. J. Appl. Ecol. 1:463–72 (1983).
USAID (U.S. Agency for International Development). 2005. "Citrus 2005." USAID, Washington, DC.
Liu, Y., Heying, E. & Tanumihardjo, S. A. History, global distribution, and nutritional importance of citrus fruits. Comprehensive reviews in Food Science and Food safety. 11:530–45 (2012).
FAOSTAT. FAO Statistics, Food and Agriculture Organization of the United Nations, Rome (Accessed 23- November-2022). http://faostat.fao.org/ (2022).
Brentu, F. C., Oduro, K. A., Offei, S. K., Odamtten, G. T., Vicent, A., Peres, N. A. & Timmer, L. W. Crop loss, aetiology, and epidemiology of citrus black spot in Ghana. Eur. J. Plant Pathol. 133, 657–670 (2012).
Yang, C. T. Psyllidae of Taiwan. Taiwan Mus. Spec. Publ. Ser. 3, 37–41 (1984).
OEPP/EPPO. EPPO Standards PM 7/52(1). Diagnostic protocol for Diaphorina citri. OEPP/EPPO Bull. 35, 331–333, https://doi.org/10.1111/j.1365-2338.2005.00839.x (2005).
Dellaporta, S. L., Wood, J. & Hicks, J. B. A plant DNA mini preparation: Version II. Plant Mol. Biol. Rep. 1, 19–21 (1983).
Boykin, L. M. et al. Overview of worldwide diversity of Diaphorina citri Kuwayama mitochondrial cytochrome oxidase 1 haplotypes: two old world lineages and a new world invasion. Bull. Entomol. Res. 102, 573–582 (2012).
Pérez-Rodríguez, J. et al. Classical biological control of the African citrus psyllid Trioza erytreae, a major threat to the European citrus industry. Sci. Rep. 9, 9440 (2019). https://doi.org/10.1038/s41598-019-45294-w.
Hall, T. A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acid Symp. 41, 95–98 (1999).
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403–410 (1990).
Kumar, S., Stecher, G. & Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 33, 1870–1874 (2016).
Muhire, B.M., Varsani, A., Martin, D.P. SDT: A virus classification tool based on pairwise sequence alignment and identity calculation. PloS one. 26 (9),:e1 08277 (2014).
Percy, D.M. Making the most of your host: the Metrosideros-feeding psyllids (Hemiptera, Psylloidea) of the Hawaiian Islands. ZooKeys. (649):1 (2017).
Khamis FM et al. DNA barcode reference library for the African citrus triozid, Trioza erytreae (Hemiptera: Triozidae): vector of African citrus greening. J. Econ. Entomol. 110(6): 2637–46 (2017).
Li, W., Hartung, J. S. & Levy, L. Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J. Microbiol. Meth. 66, 104–115 (2006).
Li, W., Duan, Y., Brlansky, R., Twieg, E. & Levy, L. Incidences and population of ‘Candidatus Liberibacter asiaticus’ in Asian citrus psyllid (Diaphorina citri) on citrus plants affected by huanglongbing in Florida. Int. Res. Conf. HLB, Dec. 1–5, 2008, Orlando, Florida. (2008a).
Li, W., Li, D., Twieg, E., Hartung, J. S. & Levy, L. Optimized quantification of unculturable Candidatus Liberibacter spp. in host plants using real-time PCR. Plant Dis. 92, 854–861 (2008b).
Shimwela, M. M., et al. (2016). First occurrence of Diaphorina citri in East Africa, characterization of the Ca. Liberibacter species causing huanglongbing (HLB) in Tanzania, and potential further spread of D. citri and HLB in Africa and Europe. Eur. J. Plant Pathol. 146(2), 349–368.
Mack, R. N., Simberloff, D., Mark Lonsdale, W., Evans, H., Clout, M. & Bazzaz, F.A. Biotic invasions: causes, epidemiology, global consequences, and control. Ecol. Appl. 10, 689–710 (2000).
Holford, P., Om, N., Donovan, N. J., Beattie, G. A. C., Subandiyah, S., Gunadi, R. & Poerwanto, M. E. High Altitudes Limit The Incidence of Huanglongbing and Its Vector, Diaphorina citri, in Citrus Orchards. In IOP Conference Series: Earth and Environmental Science (Vol. 1018, No. 1, p. 012019). IOP Publishing (2022).
Liu, Y. H., & Tsai, J. H. Effects of temperature on biology and life table parameters of the Asian citrus psyllid, Diaphorina citri Kuwayama (Homoptera: Psyllidae). Ann. Appl. Biol. 137(3), 201–206 (2000).
Antolinez, C. A., Moyneur, T., Martini, X., & Rivera, M. J. High temperatures decrease the flight capacity of Diaphorina citri Kuwayama (Hemiptera: Liviidae). Insects. 12(5), 394 (2021).
Ajene, I. J. et al. Genetic diversity of Diaphorina citri (Hemiptera: Liviidae) unravels phylogeographic structure and invasion history of eastern African populations. Ecol. Evol. 12(7), e9090 (2022).
Das, A. K., Rao, C. N., George, A., & Chichghare, S. A. Molecular identification and characterization of the Asian citrus psyllid vector, Diaphorina citri (Hemiptera: Psyllidae) and the transmitted Huanglongbing-associated bacterium, Candidatus Liberibacter asiaticus in India. J. Plant Pathol. 104,1–14 (2022).
Meng, L., Wang, Y., Wei, W. H., & Zhang, H. Population genetic structure of Diaphorina citri Kuwayama (Hemiptera: Liviidae): host-driven genetic differentiation in China. Sci. Rep. 8(1), 1–15 (2018).
Gottwald, T. R., Graça, J. V. D., & Bassanezi, R. B. Citrus huanglongbing: the pathogen and its impact. Plant Health Prog. 8(1), 31 (2007).
Alquézar, B., Carmona, L., Bennici, S., Miranda, M. P., Bassanezi, R. B., & Peña, L.. Cultural management of huanglongbing: Current status and ongoing research. Phytopathology. 112(1), 11–25 (2022).
Antolínez, C. A., Martini, X., Stelinski, L. L. & Rivera, M. J. Wind Speed and Direction Drive Assisted Dispersal of Asian Citrus Psyllid. Environ. Entomol. 51, 305–312 (2022).
Tomaseto, A. F., Krugner, R. & Lopes, J. R. S. Effect of plant barriers and citrus leaf age on dispersal of Diaphorina citri (Hemiptera: Liviidae). J. Appl. Entomol. 140, 91–102 (2016).
Merfa, M. V. et al. Probing the application of OmpA-derived peptides to disrupt the acquisition of ‘Candidatus Liberibacter asiaticus’ by Diaphorina citri. Phytopathology. 112(1), 163–172 (2022).
Chow, A. & Sétamou, M. Parasitism of Diaphorina citri (Hemiptera: Liviidae) by Tamarixia radiata (Hymenoptera: Eulophidae) on residential citrus in Texas: Importance of colony size and instar composition. Biol. Control. 1,165:104796 (2022).
Cui, X. et al. Population Diversity of ‘Candidatus Liberibacter asiaticus’ and Diaphorina citri in Sichuan: A Case Study for Huanglongbing Monitoring and Interception. Plant Dis. 106: 1632–1638 (2022).
Padhi, E. M., Araujo, K. J., Mitrovic, E., Polek, M., Godfrey, K. E., & Slupsky, C. M. The impact of Diaphorina citri-vectored ‘Candidatus Liberibacter asiaticus’ on citrus metabolism. Phytopathology. 112(1), 197–204 (2022).
Sawadogo, M. W., Ahissou, R. B., Somda, I., Nacro, S., Legrève, A., & Verheggen, F. Identification of alternative hosts of the tomato leafminer Tuta absoluta (Meyrick, 1917)(Lepidoptera: Gelechiidae) in West Africa. Afr. Entomol. 30 (2022). https://doi.org/10.17159/2254-8854/2022/a12056
Zhou, S., Qin, Y., Wang, X., Zheng, X., & Lu, W. Fitness of the fall armyworm Spodoptera frugiperda to a new host plant, banana (Musa nana Lour.). Chem. Biol. Technol. Agric. 9(1), 1–9 (2022).
Sonter, S., Mishra, S., Dwivedi, M. K., & Singh, P. K. (2021). Chemical profiling, in vitro antioxidant, membrane stabilizing and antimicrobial properties of wild growing Murraya paniculata from Amarkantak (MP). Sci. Rep. 11(1), 1–15.
Manjunath, K. Á., Halbert, S. E., Ramadugu, C. H., Webb, S. U. & Lee, R. F. Detection of ‘Candidatus Liberibacter asiaticus’ in Diaphorina citri and its importance in the management of citrus huanglongbing in Florida. Phytopathology. 98, 387–396 (2008).
Rao, C. N., Shivankar, V. J., Deole, S., David, K. J., & Dhengre, V. N. Insecticide resistance in field populations of Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Psyllidae). Pestic. Res. J. 26(1), 42–47 (2014).
Tiwari, S., Mann, R. S., Rogers, M. E., & Stelinski, L. L. Insecticide resistance in field populations of Asian citrus psyllid in Florida. Pest Manag. Sci. 67(10), 1258–1268 (2011).

No competing interests reported.

Aidooetal2022Supplementalinformation.docx

Download PDF

Journal Publication

published 12 Jul, 2023

Read the published version in Scientific Reports →

Editorial decision: Major revision
24 Apr, 2023
Reviews received at journal
06 Apr, 2023
Reviewers agreed at journal
28 Mar, 2023
Reviewers agreed at journal
27 Mar, 2023
Reviewers invited by journal
24 Mar, 2023
Editor assigned by journal
20 Mar, 2023
Editor invited by journal
22 Dec, 2022
Submission checks completed at journal
22 Dec, 2022
First submitted to journal
20 Dec, 2022

You are reading this latest preprint version

First report on the presence of the huanglongbing vectors in Ghana

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials and Methods

Results

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1