Clinical specimens
Human HCC specimens and the adjacent noncancerous tissues were collected from Southwest Hospital of Army Medical University (Third Military Medical University) (Chongqing, China).
TCGA(The Cancer Genome Atlas) data
HCC RNA-Seq data and the related clinical data were from TCGA database (http://cancergenome.nih.gov/).
Cell culture
Human HCC cell lines PLC, HepG2 and Hep3B were purchased from the American Type Culture Collection (Manassas, VA, USA). Huh7, SMMC7721 cell lines and hepatic cell line THLE-3 were from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). The cells were cultured in high-glucose DMEM (Gibco, Carlsbad, CA, USA) containing 10% FBS at 37 ℃ in a humid incubator with 5% CO2.
Quantitative real-time PCR (qPCR)
Total RNA from HCC cells or tissues was extracted using the total RNA extraction kit (BioFlux, Hangzhou, China) according to the manufacturer’s instructions. For nuclear/cytoplasmic separation assay, cytoplasmic and nuclear RNA were separately isolated using PARIS kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. The RNA was reversely transcribed to first-strand cDNA using PrimeScript RT reagent kit (Takara, Dalian, China). qPCR was performed with SYBR qPCR master mix (Takara), taking GAPDH as the internal reference. Reverse transcription and qPCR of miRNAs were conducted with All-in-One miRNA qRT-PCR detection kit (GeneCopoeia, Guangzhou, China), taking U6 RNA as the internal reference. The primers were listed in Supplementary Table 1.
Western blot
Total proteins from HCC cells or tissues were extracted with RIPA lysis buffer (Beyotime, Shanghai, China) and the concentrations were detected using BCA protein assay kit (Beyotime). Then Western blot was performed as previously described [6]. The primary antibodies anti-ATG4B and anti-GAPDH were from Proteintech (Chicago, IL, USA), anti-PARP and anti-SQSTM1/p62 were from Cell Signaling Technology (CST, Beverly, MA, USA), and anti-LC3 was from Sigma-Aldrich (St Louis, MO, USA).
Construction of plasmids
The DNA fragments encoding the wild type and the mutant human CRNDE containing mutations of the predicted miR-543 binding site (1008 CTTTATTGGATTGAATGAATGTTT 1031, the underlined nucleotides were mutated) were chemically synthesized by Sangon Biotech (Shanghai, China), and separately inserted into pcDNA3.1(+) (pcDNA3.1) expression vector (Invitrogen, Carlsbad, CA, USA) after digestion with EcoRⅠ (Takara) and BamHⅠ (Takara). The reconstructed plasmids were named as pcDNA-CRNDE and pcDNA-CRNDE-mut, respectively. The DNA fragments encoding the wild type and the mutant 3ʹ-UTR of human ATG4B mRNA containing mutations of the putative miR-543 binding site (1565 TGTCAGACACAGACATGAATTTCT 1588, the underlined nucleotides were mutated) were separately synthesized by Sangon Biotech, digested with SacⅠ(Takara) and SalⅠ (Takara), and then cloned into pmir-GLO reporter vector (Thermo Scientific, Waltham, MA, USA). The reconstructed plasmids were named as pmir-ATG4B and pmir-ATG4B-mut, respectively. The overexpression plasmid pCMV-ATG4B was bought from Lab Cell Biotechnology (Chongqing, China).
Transfection assay
The siRNAs targeting human CRNDE, ATG4B and control siRNA were synthesized by Lab Cell Biotechnology. Mimics and inhibitor of miRNAs, and the corresponding negative controls were purchased from GeneCopoeia. The cells were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. The sequences of siRNA were presented in Supplementary Table 2, and the sequences of miRNA mimics and inhibitor were listed in Supplementary Table 3.
GFP-LC3 analysis
The HCC cells were co-transfected with the GFP-LC3 plasmid and pcDNA-CRNDE (or pcDNA3.1) or ATG4B siRNA (or control siRNA) with Lipofectamine 3000 for 24 h, and then fixed with 4% formaldehyde for 10 min. The cells were observed using a laser confocal immunofluorescence microscope (Carl Zeiss AG, Oberkochen, Germany). GFP-LC3 plasmid was kindly offered by Dr. N. Mizushima and Dr. T. Yoshimori (Osaka University, Japan).
Fluorescent assay of autophagy
Autophagy in live cells was analyzed using the Cyto-ID autophagy detection kit (Enzo, NY, USA) with proprietary probes specifically staining autophagosomes according to the manufacturer’s protocol. Briefly, the cells were harvested, resuspended in 500 μL of freshly diluted Cyto-ID green detection reagent and incubated at room temperature for 30 min in dark. Then fluorescence intensity was analyzed using a flow cytometer (Beckman, CA, USA).
RNA FISH (fluorescence in situ hybridization)
The Cy3-labelled probes for RNA FISH of CRNDE, 18S RNA and U6 RNA were synthesized by RiboBio (Guangzhou, China). RNA FISH was performed using the fluorescent in situ hybridization kit (RiboBio) according to the manufacturer’s instructions. DAPI was used for counterstaining of nuclei. The cells were photographed under a fluorescence microscope (OlympusIX81, Tokyo, Japan).
RIP (RNA immunoprecipitation) assay
RIP assay was performed using the EZ-Magna RIP kit (Millipore/Merck, Darmstadt, German) according to the manufacturer’s protocol. Briefly, cells were lysed and incubated with antibody-coated beads at 4 ℃ overnight. Subsequently, the co-immunoprecipitates were treated with proteinase K at 55 ℃ for 30 min. RNA was purified with phenol:chloroform:isoamyl alcohol (125:24:1), followed by precipitation with ethanol overnight, and reversely transcribed into cDNA using PrimeScript RT reagent kit (Takara). Then qPCR was performed with SYBR qPCR master mix (Takara).
Dual-luciferase reporter assay
HCC cells were seeded into 24-well plates and co-transfected with the indicated luciferase reporter plasmids and miRNA mimics, siRNA, expression plasmid, or the corresponding control using Lipofectamine 3000 (Invitrogen) for 24 h. Then the cells were lysed, and the reporter assay was performed using the dual-luciferase reporter assay kit (GeneCopoeia) according to the manufacturer’s instructions.
Cell viability assay
The cell viability assay was performed using cell counting kit-8 (CCK-8; Beyotime) according to the manufacture’s protocol. Briefly, the cells were seeded into 48-well plates, followed by different treatments. 20 μL CCK-8 reagent was added to each well and incubated at 37 ℃ for 1 h. Then the OD values at 450 nm were examined using a microplate reader (Molecular Devices, Sunnyvale, CA, USA).
Cell apoptosis detection
Cell apoptosis was detected using the following methods: (1) The cells were fixed with 4% paraformaldehyde for 10 min and stained with Hoechst 33258 (Beyotime) for 10 min in dark. Then the cells were photographed under a fluorescence microscope (OlympusIX81) and the apoptotic cells were characterized by the nuclear morphology changes. (2) The cells were harvested and stained with Annexin-Ⅴ/FITC and PI (BD, California, USA) at room temperature for 15 min in dark. The apoptotic cells were analyzed under a flow cytometer (Beckman).
Animal experiments
Male nude mice (six weeks old) were obtained from Beijing Huafukang Bioscience (Beijing, China). Lentivirus system was used to construct the HepG2 cell lines with (or without) stable knockdown of CRNDE (LV-shCRNDE or LV-NC) as previously described [6]. 5×106 cells in 0.1 mL PBS (for each mouse) were subcutaneously injected into the right flank of each mouse (n = 10 per group). One week after inoculation, the mice in each group were randomized into two subgroups (n=5 per subgroup) and given daily administration of sorafenib (Selleckchem, Houston, USA, 30 mg/kg) or vehicle control by gavage. The size of xenograft tumors was measured every three days and the volume was calculated with the following formula: volume = width2 × length × 1/2. Twenty-five days after inoculation, the mice were sacrificed and the tumors were excised for photographing and weighting. The cell apoptosis in the xenograft tumors was determined using TUNEL staining, and the levels of corresponding RNAs and proteins were analysed by immunohistochemical (IHC) staining, qPCR and Western blot, respectively.
IHC staining and TUNEL assay
The xenograft tumor tissues were fixed with 4% paraformaldehyde, and then embedded in paraffin and sectioned. Next, the tumor sections were immunostained using histostain-plus kit (Zhongshan Biotechnologies) according to the manufacturer’s instructions, counterstained with hematoxylin and photographed under a microscope (OlympusIX81). For apoptosis analysis of the xenograft tumors, TUNEL assays were conducted according to the manufacturer’s protocol (Zhongshan Biotechnologies) and the tumor sections were visualized using a laser confocal microscope (Carl Zeiss AG).
Statistical analysis
The data were presented as means ± SD. Two-tailed unpaired t-test was used for the comparisons between two independent groups and one-way analysis of variance (ANOVA) was for the comparisons among three or more groups. Pearson’s test was employed for the analysis of the correlation between CRNDE and ATG4B levels. P<0.05 was considered statistically significant.