bHLH transcription factors Hes1, Ascl1 and Oligo2 exhibit different expression patterns in the process of physiological electric fields-induced neuronal differentiation

doi:10.21203/rs.3.rs-2430187/v1

Download PDF

Research Article

bHLH transcription factors Hes1, Ascl1 and Oligo2 exhibit different expression patterns in the process of physiological electric fields-induced neuronal differentiation

https://doi.org/10.21203/rs.3.rs-2430187/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 16 Jan, 2024

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Background

Recent studies have shown that the expression of bHLH transcription factors Hes1, Ascl1, and Oligo2 has an oscillating balance in neural stem cells (NSCs) to maintain their self-proliferation and multidirectional differentiation potential. This balance can be disrupted by exogenous stimulation. Our previous work has identified that electrical stimulation could induce neuronal differentiation of mouse NSCs.

Methods

To further evaluate if physiological electric fields (EFs)-induced neuronal differentiation is related to the expression patterns of bHLH transcription factors Hes1, Ascl1, and Oligo2, mouse embryonic brain NSCs were used to investigate the expression changes of Ascl1, Hes1 and Oligo2 in mRNA and protein levels during EF-induced neuronal differentiation.

Results

Our results showed that NSCs expressed high level of Hes1, while expression of Ascl1 and Oligo2 stayed at very low levels. When NSCs exited proliferation, the expression of Hes1 in differentiated cells began to decrease and oscillated at the low expression level. Oligo2 showed irregular changes in low expression level. EF-stimulation significantly increased the expression of Ascl1 at mRNA and protein levels accompanied by an increased percentage of neuronal differentiation. What’s more, this tendency was increased with the extension of EF-stimulation time and reached the peak at 24h of EF-treatment.

Conclusions

We conclude here, EF-stimulation directed neuronal differentiation of NSCs by promoting the continuous accumulation of Ascl1 expression and decreasing the expression of Hes1.

Neural stem cells

Neuronal differentiation

Physiological electric fields

Ascl1

Hes1

Oligo2

Because of its self-renewal and multi-differentiation potential, the application prospect of neural stem cells (NSCs) in neural injury and neurodegenerative diseases has been widely recognized. But the application of NSCs in neural regenerative medicine still faces the challenge of neuronal differentiation induction (Reynolds and Weiss 1992, Malatesta et al. 2008). Recent studies have shown that as a bioelectrical signal, physiological Electric Field (EF) plays an important role in embryonic development and neurogenesis (McCaig et al. 2005, Yu et al. 2022). EFs can not only induced directional migration of mouse NSCs toward the negative pole (Meng et al. 2011), but also can stimulated them differentiating into neurons under certain condition (Dong et al. 2017). The EF-induced neuronal differentiation provides a new idea for neural regeneration medicine, but the mechanism of EF-induced neuronal differentiation is still not well elucidated.

Our previous study found that the voltage sensitive gene phosphatidylinositol-3-kinase (PI3K) participated in mediating the process of EF-induced neuronal differentiation: EF-activated PI3K/AKT has crosstalk with Wnt/GSK-3β/β-catenin signaling pathway by activation of GSK-3β, promoting the accumulation of β-catenin in cells and inducing neuronal differentiation (Dong et al. 2019). Wnt/β-catenin is an important signaling pathway that determines the fate of NSCs by regulating the expression of basic helix-loop-helix (bHLH) transcription genes (Dong et al. 2019, Zhu et al. 2020). Recent studies have shown that the expression of bHLH transcription factors Hes1, Ascl1, and Oligo2 has an oscillating balance in NSCs to maintain their self-proliferation and this balance can be disrupted by exogenous stimulation, thus initiated cell differentiation. When cells decide to differentiate, cell fate determine is related to the stable and sustained expression of one transcription factor (Dennis et al. 2019, Imayoshi et al. 2013, Imayoshi and Kageyama 2014, Imayoshi et al. 2010).

In this study, we investigated that if EF-stimulation could change the expression patterns of bHLH transcription factors Hes1, Ascl1 and Oligo2 in NSCs, thus exit cell proliferation and initiate the process of neuronal differentiation. We used mouse embryonic brain NSCs as cell model, and applied RT-PCR, Western-blot and immunofluorescence chemical staining to detect bHLH transcription factors in the process of EF-induced neuronal differentiation. We conclude here, EF-stimulation influence the expression patterns of bHLH transcription factors Hes1, Ascl1, and Oligo2 in NSCs and directed neuronal differentiation of NSCs by promoting the continuous accumulation of Ascl1 expression and decreasing the expression of Hes1.

2.1 Primary culture of neural stem cells

Animal experiments were following the protocol which approved by the Ethics Committee of Experimental Animals in Basic Medical College of Jilin University ((2021) Study No. 003).

The primary mouse NSCs were derived from C57 BL6 mice purchased from Cyagen Biotechnology Co., LTD, Suzhou, China) and cultured as described previously (Dong et al. 2019). 14-day-old embryonic mice were sacrificed and after removing the meninges under the anatomical microscope, the fetal brain was placed in a 35 mm plate. The brain tissue was mechanically cut into fragments with ophthalmic forceps and transferred the fragments into a 15 ml centrifuge tube. The supernatant was removed by centrifugation at 800rpm for 3 min to remove meningeal fragments. 2ml growth medium (DMEM/F12 containing 20ng/ ml bFGF, 20ng/ mL EGF, 1/100 N2 neural supplement) was added to the remaining tissue fragments and followed with mechanically separation. After 1 minute of rest, the supernatant was passed through a Cell Strainer to obtain single cell suspension, and the cell concentration was adjusted to 2–5 × 104 cells/ml. The cells were plated into a 25 ml culture flask and change medium every 3 days.

The method by which the cells were tested:

After at least 5 passages, neurospheres were characterized before using them for experiments. The NSCs were characterized by assessing the expression of NSC markers Nestin and Musashi1 and lineage-specific markers-Tuj1, GFAP and CNpase by immunocytochemistry (Date: 28/03/2021, Jilin University).

All experiments were performed with mycoplasma-free cells.

2.2 In vitro application of EF-stimulation

Electrotactic chambers and EF-stimulation protocol were established as described previously (Meng et al. 2011, Dong et al. 2017, Meng et al. 2020). Briefly, after at least 5 passages, NSCs were plated in poly-lysine coated electrotactic chamber. EFs were applied to the NSCs in the electrotactic chamber via 5% FBS agar bridges, and the cultures were treated with a physiological strength 150 mV mm − 1 DC in the medium. The NSCs were exposed to EFs for 2 hr per day for 7 consecutive days. Culture medium was changed every 2 to 3 days. Cells were analyzed at different timepoints by immunocytochemical staining, RT-PCR or western-blotting analysis.

2.3 Immunofluorescence cytochemical staining

Cells were washed with PBS and fixed with 4% paraformaldehyde at room temperature for 20 min. Following that, permeabilize solution (0.03% Triton X-100 and 0.1% BSA in PBS) was added to each sample to carry out a 10-min incubation. Samples were rinsed by PBS for 3 times to remove any excess permeabilize solution. 1 ml blocking buffer (5% BSA in PBS) per well was used before applying primary antibodies (Table 1). After overnight incubation, samples were washed thrice following by another 60 min of incubation for the secondary antibody (anti-rabbit/mouse FITC/Alex Fluo488/Alex Fluo546, 1:100; Life Technology, OR, USA). All samples were mounted in Vectashield mounting medium with DAPI.

Table 1

The list of Antibodies
Antibodies	Spaces	Company	Ratio
Ascl1	mouse	Abcam	1:300
Hes1	Rabbit	Abcam	1:100
Oligo2 Nestin Tuj1 GFAP(CY3-Conjugated) CNpase	mouse Rabbit Rabbit Mouse Mouse	Millipore R＆D R＆D Millipore Novus bio	1:500 1:200 1:200 1:200 1:500

2.4 Reverse transcriptase polymerase chain (RT-PCR) detection

NSCs were grown in 2 different conditions: 150mV/mm EFs-stimulation group (DMEM/F12 + 10%FCS + EFs) and noEFs- stimulation group (DMEM/F12 + 10%FCS, noEFs). Then, cells were collected at different time points: 0h, 4h, 8h, 12h, 24h and 3d. Using RNeasy Kit (Qiagen Sciences, USA), total RNA was extracted from collected cells. cDNA was synthesized at 42ºC with RNA as template. The primers and PCR conditions were shown in Table 2. A total of 3µl of final PCR product was separated in a 1% agrose gel, stained with ethidium bromide, and photographed. The experiment was repeated three times.

Table 2

Primers for RT-PCR
Gene	Up-Stream (5’-3’)	Down-Stream (5’-3’)	Base	Annealir
			Pair(bp)	Temp. (°C)
Ascl1	GAAGATGAGCAAGGTGGAGACG	CGGAGAACCCGCCATAGAGT	169	65
Hes1	TGACGGCCAATTTGCCTTTC	TTCCGCCACGGTCTCCACA	165	60
Oligo2	GCGGCTTCACAGGAGGGACT	CTAGTTGTCGGCGCTTGCG	260	60

2.5 Image Analysis

Immunostained samples were observed and recorded with a fluorescence microscope (Olympus IX 71, Olympus, Japan). ImageJ software (National Institutes of Health, https://imagej.nih.gov/ij/) was used to analyze the fluorescence intensity or to count and calculate positive cells. For cell counting, data was presented as a percentage of total DAPI positive nuclei in 5 random visual fields of cells. The experiment was repeated three times.

2.6 Statistical Analysis

Origin software was used for statistical analysis, data were expressed as mean ± standard deviation, Student-T test was used for statistical analysis, P < 0.05 was considered statistically significant.

3.1 Identification of NSCs

In this study, primary cultured mouse brain NSCs were proliferated and suspended in medium to form neurospheres, as shown in Fig. 1-a. Immunofluorescence staining showed that these neurospheres expressed NSCs specific marker Nestin (Fig. 1-b).

After the removal of bFGF/EGF, NSCs stopped cell dividing and entered the process of cell differentiation. After 7–14 days of differentiation, immunocytochemical staining was used to identify the differentiated cell phenotypes. The cells could differentiate into neurons (Tuj1-positive cells), astrocytes (GFAP-positive cells) and oligodendrocytes (CNPase- positive cells) (Fig. 1-c). These results indicated that the primary mouse cells we obtained were NSCs which have multidirectional differentiation potential. EF-stimulation promoted the neuronal differentiation of NSCs.

After the removal of bFGF/EGF, NSCs stopped cell dividing and began to differentiate into neural-linage cells which including neurons, astrocytes and oligodendrocytes. The process of differentiation is somehow similar to that in vivo, with neuronal differentiation followed by astrocyte differentiation and oligodendrocyte differentiation (Fig. 2).

However, in the absence of particular conditions for neural differentiation, NSCs mostly differentiated into astrocytes (45.80 ± 2.88%) and rarely differentiated into neurons (11.75 ± 1.76%) (Fig. 3-a and b). Previous work showed that 150mV/mm EF-stimulation efficiently induced the neuronal differentiation of NSCs (Dong et al., 2019). After 7-day of cell differentiation, the expression of Tuj1, an early marker of neurons, was significantly increased. In this study, the expression of neuron-specific protein Tuj1 increased significantly (79.0 ± 3.35%) after EF-stimulation for 7 days. On the contrary, the expression of GFAP (specific maker of astrocyte) was significantly decreased (13.67 ± 1.44%) (Fig. 3-b), indicating that EF-stimulation enhanced the differentiation trend of NSCs towards neurons, while weakened the differentiation trend towards glial cells.

3.2 Expression changes of bHLH transcription factors Hes1, Ascl1 and Oligo2 in the process of EF-stimulation induced NSCs differentiation

The early neuronal marker Tuj1 started to express at 3-day of EF-stimulation.

Previous work identified that the expression of bHLH transcription factors Hes1, Ascl1and Oligo2 has an oscillating balance in NSCs to maintain their self-proliferation and this balance can be disrupted by exogenous stimulation, thus initiated cell differentiation (Imayoshi et al. 2013, Imayoshi and Kageyama 2014). We therefore reasoned that the NSCs might be initiated toward cell differentiation by EF-disrupted expression balance of bHLH genes. In the process of neural differentiation induced by EFs, we found that the early neuronal marker Tuj1 started to express at 3-day of EF-stimulation (the percentage of Tuj1-positive cells reached 20.7 ± 1.69%) (Fig. 4), indicating this process was initiated from an early stage of the culture. Therefore, NSCs with 3-day of EF-stimulation were selected to detect the expression of bHLH transcription factors.

By day 3 of differentiation, EF-stimulation promotes the expression of Ascl1 in differentiated cells while Hes1 decreased significantly.

To elucidate the effect of EF-stimulation on the expression patterns of bHLH transcription factors, we first evaluated if NSCs would express detectable endogenous levels of Hes1, which is one of the transcriptional repressor genes for maintaining stem progenitor cells (Kageyama et al. 2007). Results as shown in Fig. 5-a, NSCs formed neurospheres expressed Hes1 protein at a high level similar to the endogenous maximal level in a sustained manner (Kobayashi and Kageyama 2010).

We next examined the expression of Hes1 in NSCs under differentiation condition. After removal of both bFGF and EGF, cells stepped into differentiation. Hes1 expression was significantly decreased in both EFs and noEFs group at day 3 of differentiation, very few Hes1-positived cells upon differentiation (Fig. 5- a and b).

On the contrary, the expression of Ascl1 could not be detected visibly in the neurospheres but slightly increased on day 3 of differentiation. It is interesting to note that under the condition of 150 mV/mm EF-stimulation, the expression of Ascl1 was significantly increased (Fig. 5-a and c), indicating that Ascl1 gene was activated by EF-stimulation.

We next examined the expression of Oligo2 in both NSCs and differentiated cells under EF-stimulation or noEFs condition. The immunofluorescence results showed that Oligo2 was expressed at a low level in NSCs. By day 3 of differentiation, Oligo2 expression was slightly increased in both EFs group and noEFs group, but there was no obvious difference between theses 2 conditions (Fig. 5-a and d).

3.3 Hes1, Ascl1 and Oligo2 exhibit different expression patterns during the process of EF-induced neuronal differentiation

We quantified the mRNA levels of the bHLH genes Hes1, Ascl1 and Oligo2. Results as shown in Fig. 6-a and b. Ascl1 gene expression accumulated with the extension of EF-stimulation time. The expression of Ascl1 increased after 4h of EF-stimulation and reached the peak at 24h of EF-stimulation. It decreased slightly compared with that at 24h. However, the expression of Hes1 and Oligo2 did not show a cumulative increase trend under the action of EFs. Expression of Hes1 fluctuated slightly but showed a decreasing trend (Fig. 6-a and b).

The results showed that the expression of Ascl1 accumulated over time under 150mV/mm physiological EF-stimulation. In contrast, the expression of Hes1 and Oligo2 did not show a cumulative increase trend. The expression of Hes1 began to decrease in differentiated cells and showed oscillations at the low expression level. Oligo2 showed irregular changes in the level of low expression, as shown in Fig. 6-a and b.

During neurogenesis, the migration, differentiation, protuberance growth and myelination of nerve cells are not only regulated by chemical signals and intercellular contact, but also closely related to physiological EFs (Spitzer 2006). As a bioelectrical signal, physiological EFs can not only induce directional migration of NSCs (McCaig et al. 2005), but also can be induced to differentiate into neurons under certain conditions (Dong et al. 2017, Yamada et al. 2007, Park et al. 2012). However, the molecular regulation mechanism of neural differentiation induced by physiological EFs has not been clearly elucidated.

Our previous study found that voltage sensitivity gene PI3K participated in mediating EF-induced neuronal differentiation: EFs-activated PI3K/AKT has a crosstalk with Wnt/GSK-3β/β-catenin signaling pathways through GSK-3β signal, promoting the accumulation of β-catenin in cells, and inducing neuronal differentiation (Dong et al. 2019). Existing studies have proved that Wnt/β -catenin is an important signaling pathway that determines the fate of NSCs by regulating the expression of proneural gene bHLH (Leung et al. 2016, Toledo et al. 2008).

In this study, mouse brain NSCs were stimulated with 150mV/mm EFs at the beginning of differentiation. After 7 days of continuous stimulation, the expression of neuron-specific protein Tuj1 was significantly enhanced, while the expression of glial cell specific protein GFAP was significantly decreased. The results indicated that the stimulation of EFs enhanced the differentiation trend of NSCs into neurons but weakened the differentiation trend of glial cells. This is similar to the research results in inducing the differentiation of mouse embryonic cells and human stromal stem cells into neurons by electrical stimulation (Yamada et al. 2007, Park et al. 2012).

Protein interaction network analysis found that transcription factor Ascl1 may play a core role in regulating the EF-induced neuronal differentiation (Dong et al. 2019). Imayoshi et al also (Imayoshi et al. 2013) showed that during the differentiation of NSCs/NPCs into neurons, Hes1 expression was decreased while Ascl1 began to be continuously expressed in G1 phase, which was the decisive signal of neuronal differentiation.

Here, in the process of EFs-induced neuronal differentiation, we found that the fate of NSCs was already determined by the 3 days of EF-stimulation. Therefore, the time point for preliminary detection of bHLH transcription factors expression was selected as day 3 of EF-stimulation. NSCs showed stable and high expression of Hes1 in the undifferentiated state. Although the results have showed that either the expression of Ascl1 or Oligo2 were oscillated in NSCs (Dennis et al. 2019, Imayoshi et al. 2013), there were no significant positive expression in the undifferentiated NSCs in this study. After removal of both bFGF and EGF, cells stepped into differentiation. Hes1 expression was significantly decreased in both EFs and noEFs group at day 3 of differentiation, very few Hes1-positived cells upon differentiation. Oligo2 showed irregular changes in low expression level. It is interesting to note that the expression of Ascl1 was significantly activated by EF-stimulation. This suggests that the continuous cumulative expression of Ascl1 is a key signal during the EF-induced neuronal differentiation.

Recent studies have shown that Ascl1 is not only a key factor in determining the fate of neurons, but also interacts with different transcription factors to determine the subtypes of neurons during the maturation process (Dixit et al. 2014, Earley et al. 2021, Borrell 2021). In the follow-up study, we will continue to use the mouse brain-derived NSCs as the cell model to study the EF-induced terminal differentiation neuron subtypes of NSCs and its regulatory mechanism.

In summary, EF-stimulation changes the expression patterns of Hes1, Oligo2 and Ascl1 in the process of EF-induced neuronal differentiation, promotes the continuous expression of Ascl1, and determines the differentiation of cells into neurons. This study revealed the mode of bHLH transcriptional network that regulating EF-induced neuronal differentiation (Fig. 7), providing a new idea and theoretical basis for the application of physiological EFs in the treatment of neural injury and neurodegenerative diseases, and promoting its application in neural regeneration medicine.

Author Contributions: Conceptualization, Xiao-ting Meng and Zhi-yong Dong; experimental operation and analysis: Zhe-Li and Hai-Li; writing-original draft preparation, Zhe-Li and Hai-Li; computer graphics, Jia-ying Zhou; supervision, Xiao-ting Meng; funding acquisition, Xiao-ting Meng. Zhe-Li and Hai-Li contributed equally as first authors. All authors have read and agreed to the published version of the manuscript.

Funding: This research was funded by The National Science Foundation of China, grant number 31371004.

Conflicts of Interest: The authors declare no conflict of interest.

Borrell V (2021) Protomapped by the pros: Proneural factors pattern cortex folding. Neuron 109:2797-2799
Dennis DJ, Han S, Schuurmans C (2019) bHLH transcription factors in neural development, disease, and reprogramming. Brain Res 1705:48-65
Dixit R, Wilkinson G, Cancino GI, Shaker T, Adnani L, Li S, Dennis D, Kurrasch D, Chan JA, Olson EC, Kaplan DR, Zimmer C, Schuurmans C (2014) Neurog1 and Neurog2 control two waves of neuronal differentiation in the piriform cortex. J Neurosci 34:539-553
Dong ZY, Pei Z, Li Z, Wang YL, Khan A, Meng XT (2017) Electric field stimulation induced neuronal differentiation of filum terminale derived neural progenitor cells. Neurosci Lett 651:109-115
Dong ZY, Pei Z, Wang YL, Li Z, Khan A, Meng XT (2019) Ascl1 Regulates Electric Field-Induced Neuronal Differentiation Through PI3K/Akt Pathway. Neuroscience 404:141-152
Earley AM, Burbulla LF, Krainc D, Awatramani R (2021) Identification of ASCL1 as a determinant for human iPSC-derived dopaminergic neurons. Sci Rep 11:22257
Imayoshi I, Isomura A, Harima Y, Kawaguchi K, Kori H, Miyachi H, Fujiwara T, Ishidate F, Kageyama R (2013) Oscillatory control of factors determining multipotency and fate in mouse neural progenitors. Science 342:1203-1208
Imayoshi I, Kageyama R (2014) bHLH factors in self-renewal, multipotency, and fate choice of neural progenitor cells. Neuron 82:9-23
Imayoshi I, Sakamoto M, Yamaguchi M, Mori K, Kageyama R (2010) Essential roles of Notch signaling in maintenance of neural stem cells in developing and adult brains. J Neurosci 30:3489-3498
Kageyama R, Ohtsuka T, Kobayashi T (2007) The Hes gene family: repressors and oscillators that orchestrate embryogenesis. Development 134:1243-1251
Kobayashi T, Kageyama R (2010) Hes1 regulates embryonic stem cell differentiation by suppressing Notch signaling. Genes Cells 15:689-698
Leung AW, Murdoch B, Salem AF, Prasad MS, Gomez GA, Garcia-Castro MI (2016) WNT/beta-catenin signaling mediates human neural crest induction via a pre-neural border intermediate. Development 143:398-410
Malatesta P, Appolloni I, Calzolari F (2008) Radial glia and neural stem cells. Cell Tissue Res 331:165-178
McCaig CD, Rajnicek AM, Song B, Zhao M (2005) Controlling cell behavior electrically: current views and future potential. Physiol Rev 85:943-978
Meng X, Arocena M, Penninger J, Gage FH, Zhao M, Song B (2011) PI3K mediated electrotaxis of embryonic and adult neural progenitor cells in the presence of growth factors. Exp Neurol 227:210-217
Meng XT, Du YS, Dong ZY, Wang GQ, Dong B, Guan XW, Yuan YZ, Pan H, Wang F (2020) Combination of electrical stimulation and bFGF synergistically promote neuronal differentiation of neural stem cells and neurite extension to construct 3D engineered neural tissue. J Neural Eng 17:056048
Park JS, Yang HN, Woo DG, Jeon SY, Do HJ, Huh SH, Kim NH, Kim JH, Park KH (2012) Exogenous Nurr1 gene expression in electrically-stimulated human MSCs and the induction of neurogenesis. Biomaterials 33:7300-7308
Reynolds BA, Weiss S (1992) Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255:1707-1710
Spitzer NC (2006) Electrical activity in early neuronal development. Nature 444:707-712
Toledo EM, Colombres M, Inestrosa NC (2008) Wnt signaling in neuroprotection and stem cell differentiation. Prog Neurobiol 86:281-296
Yamada M, Tanemura K, Okada S, Iwanami A, Nakamura M, Mizuno H, Ozawa M, Ohyama-Goto R, Kitamura N, Kawano M, Tan-Takeuchi K, Ohtsuka C, Miyawaki A, Takashima A, Ogawa M, Toyama Y, Okano H, Kondo T (2007) Electrical stimulation modulates fate determination of differentiating embryonic stem cells. Stem Cells 25:562-570
Yu X, Meng X, Pei Z, Wang G, Liu R, Qi M, Zhou J, Wang F (2022) Physiological Electric Field: A Potential Construction Regulator of Human Brain Organoids. Int J Mol Sci 23
Zhu L, Yang S, Zheng L, Zhang G, Cheng G (2020) WNT/beta-catenin pathway activation via Wnt1 overexpression and Axin1 downregulation correlates with cadherin-catenin complex disruption and increased lymph node involvement in micropapillary-predominant lung adenocarcinoma. J Thorac Dis 12:5906-5915

Download PDF

Journal Publication

published 16 Jan, 2024

Read the published version in Molecular Biology Reports →

Reviewers agreed at journal
07 Feb, 2023
Reviewers invited by journal
05 Jan, 2023
Editor assigned by journal
03 Jan, 2023
First submitted to journal
01 Jan, 2023

You are reading this latest preprint version

bHLH transcription factors Hes1, Ascl1 and Oligo2 exhibit different expression patterns in the process of physiological electric fields-induced neuronal differentiation

Status:

Journal Publication

Version 1

Abstract

Background

Methods

Results

Conclusions

Figures

1 Introduction

2 Materials And Methods

2.1 Primary culture of neural stem cells

2.2 In vitro application of EF-stimulation

2.3 Immunofluorescence cytochemical staining

2.4 Reverse transcriptase polymerase chain (RT-PCR) detection

2.5 Image Analysis

2.6 Statistical Analysis

3 Results

3.1 Identification of NSCs

3.2 Expression changes of bHLH transcription factors Hes1, Ascl1 and Oligo2 in the process of EF-stimulation induced NSCs differentiation

3.3 Hes1, Ascl1 and Oligo2 exhibit different expression patterns during the process of EF-induced neuronal differentiation

4 Discussion

Declarations

References

Status:

Journal Publication

Version 1