Elucidating metabolic tuning of mixed purple phototrophic bacteria biofilms in photoheterotrophic conditions through microbial photo-electrosynthesis

doi:10.21203/rs.3.rs-2467581/v1

Download PDF

Article

Elucidating metabolic tuning of mixed purple phototrophic bacteria biofilms in photoheterotrophic conditions through microbial photo-electrosynthesis

https://doi.org/10.21203/rs.3.rs-2467581/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The reduction of greenhouse gas emissions is a red tag for humanity nowadays, but it can be beneficial through developing engineered systems that valorize CO₂ into commodities, thus mimicking nature's wisdom. Purple phototrophic bacteria (PPB) naturally accept CO₂ into their metabolism as a primary redox sink system in photo-heterotrophy. Dedicated use of this feature for developing sustainable processes (e.g., through negative-emissions photo-bioelectrosynthesis) requires a deep knowledge of the inherent metabolic mechanisms. This work provides evidence of tuning the PPB metabolic mechanisms upon redox stressing through negative polarization (-0.4 and -0.8 V vs. Ag/AgCl) in photo-bioelectrochemical devices. A mixed PPB-culture upregulates its ability to capture CO₂ from organics oxidation through the Calvin-Besson-Bassam cycle and anaplerotic pathways, and the redox imbalance is promoted to polyhydroxyalkanoates production. The ecological relationship of PPB with mutualist bacteria stabilizes the system and opens the door for future development of photo-bioelectrochemical devices focused on CO₂ up-cycling.

Biological sciences/Biotechnology/Environmental biotechnology

Physical sciences/Energy science and technology/Carbon capture and storage

Earth and environmental sciences/Environmental sciences/Environmental chemistry/Pollution remediation

Biological sciences/Microbiology/Applied microbiology

Significant efforts on carbon dioxide emissions reduction push the European Union to decouple greenhouse gases (GHG) emissions from economic growth, achieving 17% of GHG emissions mitigation compared to the 45% of the overall economy increase in the last two decades.¹ However, more efforts are needed to comply with the United Nations Framework Convention on Climate Change.² In line with EU targets, carbon capture utilization, and storage technologies are essential in contributing directly to CO₂ reduction emissions in crucial sectors (i.e., fossil-fueled power production), leading the world to a net-zero CO₂ emission path.³ Based on circular economy and sustainability principles, biological technologies converting CO₂ into value-added products are being developed to produce chemicals (polymers, plastics, carbonates) and energy carriers (methane, ethane, methanol, syngas). The biological fixation of CO₂ is an attractive issue with good scale-up potential due to its low-cost, self-regenerative activity, and mild reaction conditions. The Calvin-Benson-Bassham (CBB) cycle is one of the critical biochemical cycles in photosynthetic organisms incorporating CO₂ into carbon metabolism. It is responsible for more than 90% of CO₂ fixation in nature, whereas the rest is through alternative autotrophic CO₂-fixing pathways, such as reductive citric acid cycle (rTCA) and reductive acetyl-CoA route⁴. Recently, photosynthetic proteobacteria known as purple phototrophic bacteria (PPB) received great attention in environmental biotechnological systems for CO₂ fixation.^5,6 PPB are a group of anaerobic, facultative microorganisms that absorb infrared irradiation (IR) through their photosystem (carotenoids and bacteriochlorophylls) and convert it into chemical energy ⁷. These bacteria exhibit high growth rates, are not inhibited by O_2, and have a versatile metabolism that allows them to grow in variable environments via photoautotrophy, photoheterotrophy, and fermentation.⁸

The primary mechanism of CO₂ fixation by PPB under photoheterotrophic growth is via the CBB cycle for maintaining redox homeostasis.^9,10 Another mechanism under photoheterotrophic growth that serves as an electron sink for the cumulative reduced factors is the ATP-driven process of H₂ production under nitrogen-fixing conditions via the nitrogenase/hydrogenase enzyme complex.^11,12 Finally, PPB can dissipate excess electrons under photoheterotrophic conditions by storing carbon in the cytoplasm, leading to polyhydroxyalkanoates (PHAs, bioplastics) generation⁶. PHAs are accumulated through the consecutive reduction of acetyl-CoA to (R)-3-Hydroxybutyryl-CoA, which is further reduced to PHA via PHA synthase (PhaC)¹³. PHA biosynthesis from PPB is highly affected by the oxidation state of organic carbon used as a source of electrons under photoheterotrophic conditions, where reduced organics like butyrate enhance PHA accumulation¹⁴. In contrast, oxidized organics like malate hinder PHA accumulation due to a lack of electrons.¹⁵ Therefore, the number of electrons given by the carbon substrate during PPB growth significantly affects their metabolic system.¹⁰

Stressing the PPB metabolic machinery through redox imbalance greatly enhances PHA production, as has been recently demonstrated through proteomic analysis over Rhodospirillum rubrum ¹⁶. An exciting way to allow redox imbalance over the PPB's metabolic system is via direct electron transfer from a solid-phase conductive electrode using bioelectrochemical systems (BES). These are considered promising and environmental-friendly technologies where microorganisms are forced to a bidirectional electron transfer with electrically conductive abiotic surfaces (the electrodes) to catalyze redox reactions for power generation, electrosynthesis, or environmental sanitation¹⁷. Recycling CO₂ into organic bio-products through microbial electrochemical synthesis (MES) has been extensively studied ^18,19. However, very few studies investigated the role of PPB's photoelectrochemical growth in the acceleration of electron sinks. Bose et al. pioneered the demonstration of the direct electron transfer from a poised graphite cathode electrode to a biofilm of iron-oxidizing Rhodopseudomonas palustris TIE-1 grown with CO₂ as the sole carbon source (photoautotrophy).²⁰ Authors linked the electron uptake with c-type cytochromes, achieving CO₂ fixation through the RuBisCO enzyme in the CBB cycle. Rengasamy et al. correlated the electron uptake by R. palustris TIE-1 during photoelectroautotrophic growth to biomass production using a graphite cathode modified with an iron complex.²¹ Guzman et al. connected the extracellular electron uptake of R. palustris from poised electrodes to the photosynthetic electron transport chain (pETC), while the CBB cycle using RuBisCO enzyme was the primary electron utilization pathway for CO₂ fixation.²² Li et al. examined the photoautotrophic H₂ production of Rhodobacter sphaeroides with CO₂ uptake in a BES using a carbon-felt cathode.²³ Liao et al. used proteomic analysis to explore the CO₂ bioreduction behavior of R. palustris CGA009 under different cathodic potentials.²⁴ Results showed that the electrons uptake improves energy generation (through ATP) by driving electrons through NAD(P)-binding domain-containing proteins, generating NADH, and that energy enhanced CO₂ fixation in the CBB cycle. Finally, Rengasamy et al. also showed that R. palustris TIE-1 could dissipate the excess electrons from an electrode coated with an iron-based redox mediator through the PHA accumulation.²¹ Nevertheless, the route for cathodic electrons entering the PPB metabolism is still unknown.

All the above photo-BES studies were conducted using pure culture systems; however, exporting these achievements to a scalable system must irremediably follow the mixed-culture way. It is the only economically practical solution, especially in environmental biotechnology systems requiring long-term stability, non-sterilized conditions, and suffering from a fluctuating environment. In this sense, Vasiliadou et al. used a mixed culture of PPB that successfully utilized a graphite electrode as an electron donor for the bioelectrosynthesis of H₂.¹¹ They reported that the redox imbalance was regulated by promoting the CO₂ fixation sink, decreasing CO₂ emissions drastically, rather than the H₂ production rate, as compared to electrode-free biological processes. Recently, Díaz-Rullo Edreira et al. examined the effect of biocathode polarization on CO₂ fixation by a mixed PPB culture under photoheterotrophic growth.²⁵ Results revealed that CO₂ fixation via the CBB cycle was the main electron sink at voltages between -0.2 and -0.4 V (vs. Ag/AgCl). However, the relationship between the soluble carbon uptake and the electron consumption at voltages between -0.6 and -0.8 V (vs. Ag/AgCl) indicated that other electron sinks were involved. Even though the abovementioned studies showed for the first time the enhanced bioelectrochemical CO₂ fixation under photoheterotrophic conditions, the entire set of metabolic paths regulated under redox imbalance by the microbial consortia of a mixed PPB biocathode has not been investigated yet, which is a critical gap for enabling the scalability of photo-BES systems.

Based on the above, this work aims to elucidate the metabolic pathways involved in the redox balancing process of a PPB mixed biofilm grown under photobioelectrochemical and heterotrophic conditions. For this purpose, metaproteomics assesses the proteins that regulate the main metabolic routes, such as extracellular electron transfer (EET), CBB and anaplerotic routes (CO₂ fixation), TCA, Glyoxylate bypass (organic carbon oxidation), and PHA accumulation. The work uses a PPB biofilm grown onto a biocathode of an H-type BES under different polarization conditions (Open Circuit -OC-, -0.4, -0.8 V vs. Ag/AgCl) to evaluate the effect of applied potential on the activation of different metabolic electron sinks. In addition, the work analyzes the structure of the microbial consortia of mixed PPB biofilm developed onto biocathode under different potentials. The knowledge of dominant PPB populations (able for electron acceptance), their interactions with other microbial species, and the awareness of the metabolic routes that are enhanced under different redox imbalances will provide a deeper insight into processes with biotechnological, environmental, and socio-economic interests.

Microbial Electrosynthesis System performance

Two photoelectrochemical experiments were conducted after the start-up period of PPB acclimation and biofilm formation onto the cathode electrode (see Supplementary Figure S1). First, the absorbance peaks at 805 and 865 nm via VIS-NIR spectra analysis demonstrated the development of a biofilm rich in PPB (see Supplementary Figure S2), as these wavelengths are typically used by the light-harvesting system of PPB that contains bacteriochlorophyll a (BChla). This analysis was performed daily throughout the operation of the system.

Chronoamperometry allowed the evaluation of the capacity of the biofilm to interact with the electrode during BES operation. Figure 1 shows the chronoamperograms of the two photo-bioelectrochemical experiments and the control (open circuit) experiment obtained by recording the electrochemical interaction between the PPB mixed biofilm and the working electrode during the first four days of the second week of operation. Chronoamperograms at -0.4 V and − 0.8 V (vs. Ag/AgCl) show a significant cathodic behavior, resulting in a net electron consumption, being the − 0.8 V experiment significantly more active than the − 0.4 V one.

Figure 1

Influence of photoelectrochemical condition in BES system process

Figure 2 exhibits the time course of CO₂ production in photo-bioelectrochemical experiments and the OC control experiment. CO₂ fixation only happens under electrochemical conditions, which means these metabolic pathways result from the excess electrons supplied to the BES.

Figure 2

Figure 3 presents the chemical oxygen demand (COD) and short-chain carboxylic acids (SCCAs) degradation vs. time during the second week of operation for the two experimental cycles (-0.4 and − 0.8 V vs. Ag/AgCl) as well as for the OC experiment performed. In all cases, the final COD did not match with SCCA, likely due to the production of non-HPLC-measurable algogenic organic matter released by the mixed consortia.²⁶ The COD uptake rate in the OC was 215 mg COD/d, whereas the values rose to 393 and 383 mg COD/d at -0.4 and − 0.8 V, respectively. In addition, Fig. 3a shows an excess of undefined COD in the OC experiment that limited the COD consumption rate, whereas the COD in the BES was close enough to the sum of the detected SCCAs (malic and fumaric acids). Thus, the biological electron's uptake from the cathode somehow enhanced the heterotrophic uptake processes.

Figure 3

Figure 4 illustrates the initial and final biomass concentrations at the photoelectrochemical and OC experiments (calculation of biomass concentration is described in Supplementary Information). The available electrode's surface for biofilm development was limited in these experiments, so the biomass mainly grows in a planktonic form where they do not have space limitations. Nevertheless, the average suspended culture growth exhibited under photoelectrochemical conditions was significantly higher (at 95% confidence level) than the suspended culture growth in the OC control: 1939, 2319, and 2942 mg COD/L for OC, -0.4 and − 0.8 V, respectively. The biomass growth was, therefore, significantly more efficient in bioelectrochemical conditions.

Figure 4

Figure 5 exhibits the amount of PHA accumulated during photo-bioelectrochemical experiments compared to the OC control. Results showed that the artificial addition of reduced factors to PPB's metabolism through the conductive electrode enhanced the accumulation of PHA, despite using malic acid as a carbon source. Besides, the voltage applied to the system had an evident influence on PHA accumulation in PPB from the biofilm, showing a higher amount of PHA (at 95% confidence level) at -0.4 V (23.8% of total PHA). However, at -0.8 V, this percentage of accumulated PHA decreased, which could be attributed to less biofilm attached to the biocathode (see Fig. 4) since the direct electron transfer from the cathode to the suspended PPB is limited. It may also be related to a lower presence of PHA-accumulating microorganisms in the consortium, as will be commented on later. The bioelectrochemical mediation of the enhancement of PHA accumulation was significantly evident at a 95% level for both cathodic potentials compared to the OC.

Figure 5

Influence of photoelectrochemical conditions on microbial populations

Figure 6 shows the abundance of the different genera in the mixed PPB biofilm in each experiment. The abundance of PPB under light conditions was 33–50%, where two genera (Rhodopseudomonas and Rhodobacter) covered almost the full PPB range, being more abundant in the − 0.4 V experiment than in the − 0.8 V one. These data agree with the screenings of the absorbance spectra measured during the experiments (805 and 865 nm) corresponding to BChla (Figure S2). Figure 6 also exhibits the presence of other electroactive genera, such as Shewanella, Raoultella, Pseudomonas, or Desulfovibrio, but their abundance was not significant compared to PPB genera. Thus, their contribution to the photo-BES performance was not relevant. However, the non-electroactive genus Wolinella presented a significant abundance (19–47% under light conditions and increased to 63% in the dark open circuit -DOC- control experiment) in the mixed biofilm, which suggests some ecological relation between this genus and PPB genera that will be further discussed.

Figure 6

Figure 7 shows the volcano plots obtained from metaproteomic data obtained for the proteins of the different genera of PPB (Fig. 7a and Fig. 7b) and the proteins of Wolinella (Fig. 7c and Fig. 7d) at the reactor's level (e.g., accounting for the total amount of proteins detected in the reactor). This figure exhibits an essential amount of statistically relevant data to analyze metabolic pathways affected by the tested photoelectrochemical conditions. On the one hand, the photoelectrochemical conditions provoked an increase of abundance in the two main PPB genera presented in the biofilm, consequently increasing, at the reactor's level, most of the proteins from PPB, like enzymes related to the CBB and TCA cycles, the anaplerotic CO₂ fixation pathways and the electron transfer proteins. These data reveal that the photoelectrochemical conditions presented a favorable environment for PPB development and, consequently, for the increment of PPB's key enzymes. Table 1 shows the regulation of main proteins from the most relevant metabolic pathways.

Table 1

Metaproteomic data obtained from PPB consortium at reactor's level (1): proteins involved in Anaplerotic CO₂ fixation, CBB cycle, PHA synthesis, TCA cycle, GB, and EET pathways.
	Accession number	Identified peptides			FC		p value		FC	p value*	Description
		-0.8V/OC	-0.4V/OC		-0.8V/OC				-0.4V/OC
Anaplerotic CO₂ fixation	A0A318TJ74	11	10		2.89		2.68E-03		2.38	1.68E-04	Phosphoenolpyruvate carboxykinase (ATP)
	A0A318TNP4	1			2.34		8.68E-03				Pyruvate dehydrogenase E1 component subunit beta
	A0A318TQ69	8	5		1.89		9.43E-04		1.98	1.19E-03	Pyruvate, orthophosphate dikinase
	A0A7H0XTV9	1			2.10		4.85E-02				Pyruvate carboxylase
	B9KNI0		1						2.10	4.61E-02
	A0A318TI59		10						2.26	3.36E-05	Pyruvate-ferredoxin/flavodoxin oxidoreductase
	A0A318TM06	2	2		3.20		8.95E-03		2.75	4.35E-06	Enolase
	A0A3G6WLM5	7			0.79		3.69E-02
	Q07ND9	1	1		3,68		6,69E-03		2.90	1.31E-04
CBB Cycle	A0A318TE67	4	4		3.56		1.51E-02		2.21	4.46E-05	Phosphoglycerate kinase
	A0A318TVC6	7	6		3.24		9.69E-03		2.45	1.15E-04	Ribulose bisphosphate carboxylase
	Q07N62	1			4.07		2.31E-04				Fructose-1,6-bisphosphate aldolase
	Q3IX56		1						0.38	1.13E-02
	E6VEW1		1						0.39	1.67E-02
	Q3J0V6	1	1		2.61		1.95E-03		1.89	2.41E-02	Fructose-1,6-bisphosphatase
	A0A318TV31		2						2.82	2.93E-04
	Q3J3I7		3						3.92	1.51E-04	Fructose-bisphosphate aldolase
PHA synthesis	A0A318T9K1	3	2		2.06		2.86E-02		2.59	5.80E-04	3-oxoacyl-[acyl-carrier-protein] synthase I
	A0A318TML2	1	1		2.61		2.76E-03		1.74	2.51E-02	3-oxoacyl-[acyl-carrier-protein] synthase II
	A0A318TA66	2	3		3.37		5.59E-04		2.98	2.03E-05	3-oxoacyl-[acyl-carrier-protein] reductase /acetoacetyl-CoA reductase
	A0A318T932		1						4.97	7.49E-05	3-oxoacyl-[acyl-carrier protein] reductase
	A0A318T8N2	4	2		3.94		1.06E-03		6.60	2.80E-06	Acetyl-CoA acetyltransferase
	B9KLT9		1						4.64	1.26E-03
	A0A7H0XVR5	1	1		0.65		4.03E-02		6.51	1.34E-02	Acetyl-CoA C-acetyltransferase
	A0A318TQH8	1			4.93		9.72E-05		1.86	4.08E-02	Acyl-CoA dehydrogenase
	A0A1D9MAQ9	1			2.82		8.76E-03				Enoyl-[acyl-carrier-protein] reductase [NADH]
	A0A318TLU6	1			2.81		3.16E-02		2.09	1.82E-02	Enoyl-CoA hydratase
	A0A318U0E2		1						0.46	4.66E-02
	Q07QY2		1						2.24	3.58E-03
	A0A7H0Y0T8	1			0.31		2.31E-02				Malonyl CoA-acyl carrier protein transacylase
	A0A318TFD2	3	3		4.20		7.42E-03		4.19	3.62E-04	Phasin
	A0A318TJM4		9						1.86	2.70E-02
	A0A318TI86	14	10		2.13		1.94E-02		1.77	7.06E-06	Short chain enoyl-CoA hydratase /3-hydroxyacyl-CoA dehydrogenase
TCA & GB	A0A318TI19	3	2	2.73		9.02E-03		2.14		4.94E-04	2-oxoglutarate ferredoxin oxidoreductase alpha subunit**
	A0A0Q0WES2		2	4.55		3.67E-04		1.95		7.21E-04	Citrate synthase***
	A0A318TKR2	4	3	2.40		1.73E-03		1.55		3.18E-03
	A0A318TLX9	5	4	2.17		1.69E-03
	B9KNB0		1					7.40		1.68E-03	Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex
	A0A318TB01	12		2.63		1.87E-02					Isocitrase
	Q218P8	1	1	3.60		3.27E-03		3.25		3.29E-04	Isocitrate dehydrogenase [NADP]
	A0A519G0W9	1		2.56		3.64E-03					Malate dehydrogenase
	A0A318TJR8	6		4.96		1.54E-02		2.55		3.82E-04
	A0A4V5PP73		2					3.25		9.47E-03
	A0A3G6W7R8		1					2.74		8.21E-03
	A0A1G7PCR9		1					0.30		1.56E-03	Malate synthase
	A0A318TAB1	7		0.59		2.89E-02					Malate synthase G
	A0A318TNB8	9	7	2.17		2.18E-02		2.73		5.05E-05	Methylmalonate-semialdehyde dehydrogenase [acylating]
	A0A318T8H9	5	4	1.99		4.00E-03		2.08		1.15E-05	Succinate dehydrogenase flavoprotein subunit
	A0A318TC46	3	3	1.93		4.30E-02		2.79		1.17E-04	Succinate–CoA ligase [ADP-forming] subunit alpha
	Q07UX7	1	1	2.73		9.02E-03		2.28		1.55E-04
	D5APB4		1					4.97		1.71E-02
	A0A330HC69		2					3.94		5.03E-03
	A0A318TBR7	6	5	3.23		2.07E-03		2.25		2.51E-06	Succinate–CoA ligase [ADP-forming] subunit beta
	A0A323UD73	1		2.92		8.71E-03
	A0A3G6WQY2		4					2.58		4.58E-04
EET	A0A318TD31	6	6	4.46		9.76E-04		4.29		4.17E-06	Cytochrome c
	A0A330H6E2	2		0.41		3.08E-04
	A0A330H898		2					1.65		2.47E-02
	F3LR89	1	1	0.48		2.31E-03		0.49		4.70E-02	Cytochrome c prime
	A0A318TR75	2	2	1.64		2.31E-02		2.27		2.30E-03	Ubiquinol-cytochrome c reductase iron-sulfur subunit
	A0A330HBE3		2					2.61		6.11E-03
	A0A318TN21		3					1.42		2.97E-03
	A0A7H0XUS3	4	3	1.29		2.78E-02		3.14		1.20E-04	Cytochrome c1
	A0A330HLV6		1					2.03		3.99E-02
	A0A0Q0QW64	1	1	10.38		3.35E-02		10.99		2.35E-03	Cytochrome c556
	A0A330HCS0	1		0.54		2.83E-02					Cytochrome-c oxidase. cbb3-type subunit II
	A0A318TNY1	2	2	4.79		4.47E-02		3.74		1.45E-02	Porin
	A0A7H0XXE9		6					2.48		9.99E-04
	A0A318TIA3		2					3.01		2.13E-04	Cytochrome b
*The ρ value of every data on the table is < 0.05
**Reverse TCA
***TCA and Reverse TCA

On the other hand, volcano plots of Wolinella show the decrease of this bacteria under photoelectrochemical conditions compared to the OC experiment and, therefore, the decrease of almost all enzymes analyzed for this genus. Key examples are the enzymes related to fumarate respiration or pyruvate synthesis. The maintained abundance of Wollinela in the consortium suggests that this genus found different ways to develop this part of its metabolism at the reactor's level, like a commensalism relation between this genus and PPB genera, and this will be further analyzed in the Discussion section.

Figure 7

Table 1

The upregulation of porin, c-type, b-type, and ubiquinol cytochromes from PPB demonstrates the electron uptaking ability of the mixed biofilm.

The chronoamperograms from each experiment (Fig. 1) demonstrate that the mixed biofilm interacted with the electrode. Also, the substantial amount of PPB genera in the biofilm in photoelectrochemical experiments (Fig. 6) corroborates that the electrochemical conditions promoted the growth of these genera over the graphite bar. Additionally, the bioelectrochemical biomass growth, in contrast to OC control (Fig. 4), suggests that the excess electrons supported the biomass growth, considerably increasing the final biomass measured. Another evidence is the formal potential of photo-bioelectrochemical experiments, taken from the cyclic voltammetry (CV) of each experiment on day two according to the apparent midpoint potential (E_1/2) ²⁷ as shown in Supplementary Information (Figure S5), when the substrate was consumed (non-turnover conditions) (Figure S3). These potentials (expressed as E (V vs. SHE)) were 0.12 V for the − 0.4 V (vs. Ag/AgCl) experiment and 0.2 V for the − 0.8 V (vs. Ag/AgCl) one, which are inside the range of redox potential of c-type cytochromes described in the literature: -0.4 to 0.2 V (vs. SHE) ^28–32. Different c-type cytochromes are involved in the electron transfer process with very similar redox potentials, making it difficult to determine the exact potential of each cytochrome involved using only CV data ²⁷. Metaproteomic data showed an increase at the reactor's level of c-type cytochromes found in Rhodobacter and Rhodopseudomonas for the photo-bioelectrochemical experiments (Table 1), as well as b-type and ubiquinol cytochromes and porin proteins. A deeper insight into this data revealed different upregulation mechanisms for electron uptake in the electron transport chain (ETC) of Rhodopseudomonas sp. and Rhodobacter sp. Figure 8 shows the regulation of the main proteins from those PPB genera, as determined at the taxon's level, normalizing the data for the increase in the abundance of these genera in the consortium. In the ETC, the electrons' main door differs between Rhodopseudomonas and Rhodobacter, where the former upregulated the periplasmic cytochrome c (CitcP), and the latter seems to use the periplasmic c-556 cytochrome (Citc556), where their associated porins are upregulated in both cases. While Rhodopseudomonas upregulated the link between the c cytochromes and the ETC through a periplasmic high-potential iron-sulfur protein (the 2Fe-2S-EP ferredoxin), however, this link was not found in Rhodobacter. In addition, both genera partially upregulated the bc1 cytochrome of the ETC (as shown in the upregulation of some of their subunits, see Fig. 8a,b). However, remarkably, both genera strongly upregulated the synthesis of the ETC-associated ATPase, which means that the cathodic electron flux mainly drives energy production. These shreds of evidence confirm that the PPB actively energize their metabolism by using electrons from the cathode.

Several authors studied the mechanism involved in electron transfer between the electrode and electroactive PPB, such as Rhodopseudomonas palustris TIE-1. These studies reveal that R. palustris TIE-1 encodes three protein types to mediate the external electron transfer: multiheme cytochrome c, an outer membrane porin, and a periplasmic high-potential iron-sulfur protein^{22, 33–35}. Furthermore, Bose et al. linked the upregulation of genes responsible for c-type cytochrome encoding with RuBisCO protein for a pure strain of Rhodopseudomonas palustris TIE-1.²⁰ Nevertheless, the regulation of EET-mediated proteins has never been reported for mixed cultures of PPB. Moreover, Bose et al. did not observe a significant difference in cell density with a pure strain under their electrochemical conditions (-0.1V vs. Ag/AgCl).²⁰ On the contrary, the data showed an increased culture density at lower voltages with a mixed culture of PPB (Fig. 4). This fact means that part of the electrons assimilated by bacteria is being actively used to create new cells.

In conclusion, the superior growth of PPB under photoelectrochemical conditions is possible thanks to their EET ability via porin, b-type, c-type, and ubiquinol cytochromes, mainly driving ATP production through the generation of a proton motive force between the periplasm and the cytoplasm with the electrons coming from the direct EET via cytochromes c. However, other potential ways described in the literature for EET, such as pilli¹⁷, have not been found in the metaproteomic data. A deeper insight into the electric link between cytochromes c and solid phases is encouraged, which is out of the scope of this work.

CBB and anaplerotic pathways are used as an electron sink under photoelectrochemical conditions by the mixed biofilm of PPB in heterotrophy

As reported in Fig. 2, the accumulated concentration of CO₂ during the electrochemical experiments decreases compared to the OC experiment, which implies the upregulation of the CO₂ fixation process. The theoretical CO₂ produced via malic acid degradation was calculated to demonstrate the bioelectrochemical fixation of this gas in our experiments as measured from inorganic carbon (IC) uptake ³⁶. Under electrochemical conditions, the average amount of CO₂ fixed was 43.19 ± 0.06% of the total CO₂ theoretically produced from malic acid degradation, in contrast to 4.61% of this CO₂ being fixated in the OC experiment (see Supplementary Information). In addition, Table 1 shows an increase of RuBisCO protein in photo-bioelectrochemical experiments, which is responsible for fixing CO₂ in the CBB cycle ^20,37,38. This enzyme's fold change (FC) values at the reactor's level are 2.45 and 3.24 for − 0.4V/OC and − 0.8V/OC, respectively, which exhibit a clear increment in the abundance of this protein under lower voltages in the reactor, probably linked to the development of PPB in the consortium. However, CO₂ fixation is also happening in an anaplerotic way. These pathways are governed by pyruvate carboxylase (PC) and phosphoenolpyruvate (PEP) carboxykinase proteins ^39–42. PEP carboxykinase increased, at the reactor's level, with a similar fold change for every experiment: 2.38 and 2.89 for − 0.4V/OC and − 0.8V/OC, respectively. Pyruvate carboxylase also rose under both voltages tested at the reactor's level (FC: 2.10 for both − 0.4V/OC and − 0.8V/OC) (Table 1). To provide more evidence, Fig. 8a and Fig. 8c exhibit the upregulation of RuBisCO from the Rhodopseudomonas genus, indicating that this species (and not Rhodobacter) benefitted from the electrochemical conditions that enabled CO₂ fixation as one of the central electron sinks used to dissipate the excess of electrons, even under heterotrophic conditions.

Some authors reported that the fixation of CO₂ is the primary electron sink used for PPB pure cultures to dissipate the excess of electrons under electrochemical conditions ^22,43,44, but BES based in PPB mixed cultures have not been deeply studied yet. This work shows evidence of CO₂ fixation under heterotrophic conditions when most of the literature related to CO₂ fixation works under autotrophic conditions.²²

The corroborated hypothesis describes that the CO₂ refixation process under heterotrophic conditions is due to the excess of electrons supplied to the biofilm, which provokes a redox imbalance in PPB. Hence, PPB uses some metabolic pathways as an electron sink to recover redox homeostasis.^9,10 This imbalance is due to the excess NADH produced in phototrophic EET, consumed via the CBB cycle in the case of Rhodopseudomonas. In this way, the photosynthetic EET, enhanced by the excess of electrons supplied by the cathode, is indirectly linked with CO₂ fixation through the CBB cycle as an electron sink.^22,44

The TCA cycle upregulation by PPB under photoelectrochemical conditions is linked to the presence of Wolinella as an opportunistic microorganism.

The metaproteomic data analyzed at the reactor's level demonstrate the increase of some enzymes from TCA, Glyoxylate bypass, and rTCA from the PPB (Table 1). These are the main pathways used by PPB to degrade COD. Their increase is linked to pyruvate and phosphoenolpyruvate synthesis by PPB genera through pyruvate carboxylase (PC) and phosphoenolpyruvate carboxykinase (PEPC), as it was commented before. The analysis of the proteomic data at the taxon's level, shown in Fig. 8, reveals the upregulation of some enzymes related to the TCA cycle in Rhodopsedomonas species (Fig. 8a and Fig. 8c). Rhodobacter did not exhibit a significant number of upregulated proteins (Fig. 8b and Fig. 8d) compared to Rhodopseudomonas. These observations support that Rhodopseudomonas was the main electroactive PPB in the biofilm since the proteomic data reveals that this taxon encounters the most significant reorganization of its central carbon metabolism when growing under photoelectrochemical conditions. However, why did Rhodopseudomonas upregulate its catabolism? Table 2 shows the fold changes (FC) of the PC and PEPC enzymes, exhibiting a downregulation under photoelectrochemical conditions for Wolinella at the reactor's level. These data could suggest that Wolinella found a metabolic advantage in the increment of TCA metabolism of Rhodopseudomonas but also have to be interpreted considering the decreased abundance of this genera in the consortium. The FC values were thus re-calculated at the taxon's level for the Wolinella genus, and the only enzymes highlighted at this level (statically significant) were fumarate reductase proteins: fumarate reductase cytochrome b subunit (P17413), fumarate reductase flavoprotein subunit (P17412), and fumarate reductase iron-sulfur subunit (P17596). The FC for these enzymes were 0.49 (ρ value 4.51E-02), 0.78 (ρ value 2.08E-02), and 0.63 (ρ value 1.61E-03), respectively. Fumarate reductase is the enzyme needed by Wolinella to make possible fumarate respiration (fumarate + a reduced electron donor ◊ succinate + oxidized electron donor), which allows anaerobic respiration. The reduced electron donor can be NADH, formate, or even H₂.⁴³ Fumarate is generated by the rTCA in chemotrophic dark conditions as the main pathway for malic acid catabolism (see Supplementary Information, Figure S4). The decreased abundance of fumarate reductase of Wolinella at the taxon level indicates that this genus is decreasing the activity of fumarate respiration, likely because of a commensalism ecological relation between PPB and Wolinella. In this sense, Wolinella takes advantage of the presence of PPB under photoelectrochemical conditions. The exact nature of this commensalism relationship will require further investigation.

Table 2

Metaproteomic data of fumarate respiration, and Pyruvate and phosphoenolpyruvate from *Wolinella* genus, at reactor's level.
	Accession number	Identified peptides		FC	ρ value	FC	ρ value	Description
	Accession number	0.8V/OC	0.4V/OC	0.8V/OC		0.4V/OC		Description
Pyruvate biosynthesis	Q7M7R5		1			0.52	9,53E-03	Pyruvate synthase alpha subunit
	Q7M9L6		3			0.60	2,40E-04	Phosphoenolpyruvate synthase
	Q7MAL2		7			0.48	7,41E-05	Malic enzyme
Fumarate respiration	P17413	2	1	0.54	3.33E-02	0.26	8,81E-03	Fumarate reductase cytochrome b subunit
	P17412		11			0.43	3,75E-04	Fumarate reductase flavoprotein subunit
	P17596		8			0.34	4,11E-04	Fumarate reductase iron-sulfur subunit

The PHA accumulation is enhanced under photoelectrochemical conditions by the mixed biofilm of PPB using malic as a carbon source.

The total percentage of PHA analyzed from the biofilm at different voltages exhibited an increase in PHA accumulation under electrochemical conditions, reaching a maximum content in the biomass at -0.4V (23.8% d.w. of total PHA) (Fig. 5). In addition, the abundance of PHA synthesis-related enzymes from PPB genera at the reactor's level (Table 1) showed an increase for all electrochemical experiments. Furthermore, some of these PHA enzymes are upregulated at the taxon level, especially for the Rhodopsedomonas genus (Fig. 8a and Fig. 8c). If it is usually mentioned that an excess of carbon source or nutrient-limited conditions is necessary to enhance the accumulation of PHA^15,45, but the observed rise in PHA content was here obtained with fully balanced nutrient conditions, so the excess of electrons from the cathode is the only driver for this PHA accumulation.

The biosynthesis of PHA allows the dissipation of the excess NADPH, so this route is dependent on the substrate employed. ^15,46,47 For this reason, the redox state of the carbon source is a key to optimizing PHA production by R. palustris TIE-1 ¹⁴. Toulopakis et al. used malate as a carbon source to study the accumulation of PHB, but they did not achieve it because of the lack of acetyl-coenzyme A produced by Rhodopseudomonas sp. in the presence of malate.¹⁵ Also, Bayon-Vicente et al. studied the influence of different C sources on PHA accumulation, comparing succinate and valerate.⁴⁸ They showed that the abundance of PHA under succinate conditions was undetectable. Thereby, C sources such as malate and succinate do not enable the biosynthesis of PHA because of the lack of electrons, and available acetyl-coenzyme A. Bayon-Vicente et al. also linked the production of PHA to a sudden increase of light intensity when Rs. rubrum was growing with acetate as sole carbon source. This PHA synthesis was also proposed to be linked to an excess of reducing equivalent⁴⁹ as no nutrient limitation was present in their conditions, as in the present work.

A previous paper demonstrated that PHA accumulation is possible under photoelectroautotrophic conditions with a pure culture of R. palustris TIE-1; they only achieve 4.48 ± 0.11 mg PHB/L.¹⁴ In contrast, this work found a significantly higher PHB accumulation under photoelectroheterotrophic conditions of 58.23 ± 2.81 and 17.59 ± 1.55 mg PHB/L at -0.4 and − 0.8V, respectively. However, the voltage that showed the best PHA accumulation in this work is lower than the voltage used by the cited work⁵⁰: -0.4 vs. -0.1V (vs. Ag/AgCl), respectively, which means PHA accumulation is enhanced under lower voltages, as corroborated the upregulation of PHA synthesis enzymes, at taxon's level, showed in Fig. 8. This data confirms that the enhancement of PHA synthesis is possible in heterotrophic conditions and with a mixed culture of PPB. As explained before, the excess of electrons supplied to the biofilm provoked a redox imbalance in PPB that generated excess reductive power inside the cell.

Figure 8

Implications for developing microbial photo-electrosynthesis devices

Bioelectrosynthesis relies on upgrading CO₂ into valuable commodities, but electrosynthetic bacteria usually leads to one compound-one metabolic pathway (e.g., cathodic electrofermentation or electromethanogenesis).⁵¹ This work demonstrated that PPB grown in mixed-culture conditions are versatile enough to capture CO₂ by refixation in a heterotrophic system, allowing the conversion of oxidized substrates like malic acid into PHA, with no metabolite production. The implications for environmental biotechnology are vast. Biomass yield enhancement is quite interesting in applications like microbial protein production, where, as demonstrated here, biomass and protein yields are increased by more than 50% compared to non-BES processes (see Fig. 4). Nevertheless, the most exciting outcome derived directly from this work is the possibility of converting oxidized compounds into PHA in a single-step process, with no energy mediators, thus avoiding the need for a pre-treatment process to convert organic feedstock rich in sugars and dicarboxylic acids into short-chain monocarboxylic acids (see Fig. 5). These results also suggest using PPB-BES technology for applications related to fixing CO_2, like biogas upgrading (photo-MES), and converting an organic waste source into bioplastics. We anticipate a rapid advance of this technology that can contribute to overcoming the global GHG reduction problem.

Preparation of Synthetic Medium, enrichment of PPB, and Biofilm Formation

Carbon and inorganic nitrogen sources were supplied as L-malic acid and ammonium chloride sources with a concentration of 2000 mg chemical oxygen demand (COD)/L and 300 mgN/L, respectively. The CO₂ obtained in the reactor is due to the oxidation of malic acid in the tricarboxylic acid cycle (TCA), allowing to focus on CO₂ fixation routes without any external source of this gas. The N source was ammonium to inhibit the hydrogen production ¹¹, so we concentrate on internal electron dissipation mechanisms (mainly the Calvin–Benson–Bassham -CBB- cycle and the accumulation of polyhydroxyalkanoates (PHA)) instead of the external hydrogen evolution. Macro and micronutrients were prepared following the Ormerod recipe ⁵². All chemical compounds came from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). The enrichment of the initial culture and biofilm formation were described previously. ²⁵ Supplementary Information (Figure S1) includes a picture of the resulting biofilm.

Photo-bioelectrochemical Experiments

The photo-bioelectrochemical experiments were performed using a glass H-type BES as previously described.²⁵ The photo-bioelectrochemical experiments with PPB biofilm aim to determine the metabolic routes affected by the electrochemical conditions under different voltages tested, especially those pathways related to CO₂ fixation and PHA accumulation. Thereby, two consecutive photo-bioelectrochemical experiments, in batch mode, were conducted at room temperature (20ºC) by progressively varying the voltage after cycles of 3 weeks (21 days for each experiment): -0.4 and − 0.8 V, compared to the Ag/AgCl (3.5M) reference electrode. The biofilm was adapted to the new voltage conditions during the first week. For the second week, sampling was performed daily to analyze pH, the absorbance of the liquid, CO₂ concentration at headspace, total inorganic carbon (TIC), soluble chemical oxygen demand (COD), and short-chain carboxylic acids (SCCA). Total COD, absorbance spectrum (400–900 nm), volatile suspended solids (VSS) from biofilm and liquid medium, and DNA samples from the biofilm were collected at the beginning and the end of the week. The samples for the metaproteomic analysis described below were taken during the last week of every cycle. CV tests (range of -1 to 1 V versus Ag/AgCl with a scan rate of 1 mV/s) were performed throughout the BES operation to determine the biocathode's electroactive behavior.

Additional control experiments were also performed for one week: (i) a photobiological control (open circuit -OC-) with a PPB biofilm formed in a graphite bar to evaluate the contribution of the PPB metabolism in the absence of current intensity, (ii) a control without light (dark open circuit -DOC-) neither current, with a biofilm over the graphite bar to study the contribution of fermentative bacteria to organic matter degradation (iii) an electrochemical control (abiotic) at -0.8 V with a graphite bar without the PPB biofilm. The initial pH used for all biological experiments was 6.74 ± 0.09 to ensure an optimal medium for PPB growth.

In all BES experiments, the cathode and anode chambers were filled with the nitrogen source, the macro-, and the micronutrient solutions of the Ormerod medium ⁵². The carbon source was added to the cathode chamber to allow the microorganism growth in this chamber only, under continuous stirring. The medium and headspace of each chamber were flushed with argon to provide an anaerobic ambient. The cathode and anode liquid media were refreshed at the beginning of each experimental week, cleaning bacteria attached to the glass surface to enhance light penetration. Liquid samples were taken from the cathode and anode chambers and analyzed daily to monitor the experiment. Likewise, the current intensity of each experiment was monitored throughout the experiment. CVs were made on the second week of each experiment on days 0, 2, and 4 to measure the electroactivity of the biofilm.

Analytical Methods

The detection of BChla of PPB was performed by analyzing the VIS-NIR spectra (400–950 nm) using a UV-vis spectrophotometer (V-630, Jasco, Madrid, Spain). Total and soluble COD and volatile suspended solids (VSS) were determined according to standard methods ⁵³. SCCAs were analyzed using an HPLC with the method described by Ventura et al. ⁵⁴. The pH and EC were measured with a pH meter (GLP 22, Hach Lange Spain, Barcelona, Spain) and an electrical conductivity meter (912 Conductometer, Metrohm, Switzerland), respectively. Biomass concentration was determined using a standard curve of PPB optical density and volatile suspended solids (gVSS/L) concentration. The optical density of PPB biomass was measured at 665 and 850 nm by UV-VIS spectrophotometer (V-630, Jasco, Madrid, Spain). TIC was analyzed by a combustion/non-dispersive infrared gas analyzer (Shimazdu TOC 5000 A). The PHA content was calculated as PHA production yield (expressed as wt.% on a dry basis). The extraction and analysis of PHA content are reported by Allegue et al.⁵⁵ All samples used for analyzing soluble components were filtered with 0.45µm nylon filters (Chrodisc filter/syringe, CHMLab Barcelona, Spain). Total COD, BChla, optical density of PPB biomass, and VSS concentration were determined using non-filtered samples.

The composition of the microbial community has been analyzed through Illumina MiSeq. The DNA from the biomass samples is previously extracted with a HigherPurity™ Bacterial Genomic DNA Isolation Kit by Canvax Biotech (Córdoba, Spain). After that, the extracted DNA samples were sent to FISABIO Sequencing and Bioinformatics (Valencia, Spain) for 16s rRNA gene amplificon sequencing following the 16S rDNA gene Metagenomic Sequencing Library Preparation Illumina protocol (Cod. 15044223 Rev. A). The primers are selected from ⁵⁶. The full-length primer sequences, using standard IUPAC nucleotide nomenclature, are: 16S V3-V4 Forward: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG CCTACGGGNGGCWGCAG and 16S V3-V4 Reverse: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC. Microbial genomic DNA (5 ng/µl in 10 mM Tris pH 8.5) was used to initiate the protocol. After 16S rDNA gene amplification, the multiplexing step was performed using Nextera XT Index Kit (FC-131-1096). After size verification, the libraries were sequenced using a 2x300pb paired-end run (MiSeq Reagent kit v3 (MS-102-3001)) on a MiSeq Sequencer. Denoising, paired-ends joining, and chimera depletion was performed starting from paired ends data using the DADA2 pipeline ⁵⁷. The database used for the taxonomic assignation was the Silva138 ⁵⁸. Data handling regarding microbiologic analysis was done using an RStatistics environment.

A quantitative metaproteomic analysis was performed on proteins extracted from mixed biofilm for each photo-bioelectrochemical experiment and open circuit control. Proteins were extracted and processed as described previously.⁵⁹ Tryptic peptides were analyzed in Data Dependent Acquisition mode using the workflow described elsewhere⁶⁰, except that the TripleTof 6600 from Sciex was used for data acquisition. Data were searched using Protein Pilot 4.2 against a Uniprot extracted proteome containing the main genera detected through the microbial community analysis. The sequence database included the following genera: Rhodobacter, Rhosopseudomonas, Rubrivivax, Wolinella, Shewanella, Desulfovivrio, and Enterococcus. Methionine oxidation and cysteine carbamidomethylation were set up as variable and fixed modification, respectively. Proteins were quantified using skyline in "precursor" mode, only with unmodified peptides, not considering peptides originating from trypsin missed cleavages. The areas under the curve were exported in excel for student t-test evaluation of the significance. The selection of relevant enzymes from metaproteomic data was made by searching manually the enzymes involved in metabolic routes of interest: TCA, CBB, PHA synthesis, anaplerotic CO₂ fixation, and extracellular electron uptake mechanism ^61–64. Protein abundances were processed to gain modification data at reactor and taxon levels. In the first case, all measured areas under the curve were used for protein abundance normalization across the replicates. This usual procedure allows for mitigating potential bias in protein loading across replicates. As the microbial consortium composition also varied during the experiment, we normalized the protein abundances taxon per taxon to mitigate the differences in the abundance of the taxon in the consortium. To obtain this taxon's level information, we considered only the four most abundant species, and normalizations were performed as described above, but restricting the dataset to the selected species. Metaproteomic calculations are described in Supporting Information.

Data availability

The data supporting the findings of this study are available within the article and its Supplementary Information. Supplementary Data includes the metaproteomic data selection at the reactor's and taxon's level and the taxonomy data in Excel files. In addition, full experimental, metaproteomic, and taxonomy data are available from the corresponding authors upon reasonable request.

Acknowledgments

This work has been partially funded by the Spanish Ministry of Economy by the FOTOBIOELECTRO project (CTM2017-91186-EXP) and the Community of Madrid through projects REMTAVARES-CM (S2018/EMT-4341) and BIOTRES-CM (S2018/EMT-4344). D.P. also acknowledges the Spanish Ministry of Economy for the concession of a Ramon y Cajal grant. Funding received from the Community of Madrid and the University Rey Juan Carlos through the R&D Young Researchers Fund 2019 (project SUN-BIOELECTROMAT) is also acknowledged. Work of B.L. and R.W. was supported by CDR funding "Redox homeostasis in purple bacteria" (CDR FRS FNRS). The Bioprofiling platform used for proteomic analysis was supported by the European Regional Development Fund and the Walloon Region, Belgium.

Author information

Authors and affiliations

Department of Chemical and Environmental Engineering, High School of Experimental Sciences and Technology, University Rey Juan Carlos, Madrid, Spain

Sara Díaz-Rullo Edreira, Juan José Espada, Fernando Martínez, Daniel Puyol

Department of Environmental Engineering, Democritus University of Thrace, Xanthi, Greece

Ioanna A. Vasiliadou

Department of Automation, Electric Engineering and Electronic Technology, Polytechnic University of Cartagena, Cartagena, Spain

Amanda Prado

Laboratory of Proteomics and Microbiology, Research Institute for Biosciences, University of Mons, Mons, Belgium

Ruddy Wattiez, Baptiste Leroy

Authors contribution

S.D.-R.E. helped design the experiments, carried out the bioelectrochemical experiments, calculated electrochemical parameters, create the metabolic pictures, carried out the analytical measurements, analyzed the data, and wrote the manuscript. I.A.V. wrote the introduction section and revised the manuscript. A.P. helped calculate electrochemical parameters and revised the manuscript. J.J.E. supervised the project and helped writing the manuscript. R.W. and B.L. performed metaproteomic analyses, analyzed the data and revised the manuscript. F.M. supervised the project, analyzed the data, and helped write the manuscript. D.P. conceived the idea, supervised the project, design the experiments, analyzed the data, and wrote the manuscript. All the authors commented on the manuscript and have given approval for the final version of the manuscript.

Corresponding author

Correspondence to Daniel Puyol ([email protected])

Competing interests

The authors declare no competing interests

European Comission. Communication from the Commission to the European Parliament, the Council, the European Economic and Social Committee and the Committee of the Regions: A policy framework for climate and energy in the period from 2020 to 2030. (2014).
UNFCCC, U. N. F. C. on C. C. Glasgow Climate Pact. 1–11 (2021).
Madejski, P., Chmiel, K., Subramanian, N. & Kuś, T. Methods and Techniques for CO2 Capture: Review of Potential Solutions and Applications in Modern Energy Technologies. Energies (Basel) 15, (2022).
Nisar, A. et al. Bio-conversion of CO2 into biofuels and other value-added chemicals via metabolic engineering. Microbiol Res 251, 126813 (2021).
George, D. M., Vincent, A. S. & Mackey, H. R. An overview of anoxygenic phototrophic bacteria and their applications in environmental biotechnology for sustainable Resource recovery. Biotechnology Reports 28, e00563 (2020).
Capson-Tojo, G. et al. Purple phototrophic bacteria for resource recovery: Challenges and opportunities. Biotechnology Advances vol. 43 107567 Preprint at https://doi.org/10.1016/j.biotechadv.2020.107567 (2020).
Batstone, D. J., Hülsen, T., Mehta, C. M. & Keller, J. Platforms for energy and nutrient recovery from domestic wastewater: A review. Chemosphere 140, 2–11 (2015).
Puyol, D. et al. Chapter 12 - Purple phototrophic bacteria as a platform to create the next generation of wastewater treatment plants: Energy and resource recovery. in (eds. Olivares, J. A., Puyol, D., Melero, J. A. & Dufour, J. B. T.-W. T. R. as R. for B. P. and B.) 255–280 (Elsevier, 2020). doi:https://doi.org/10.1016/B978-0-12-816204-0.00012-6.
McKinlay, J. B. & Harwood, C. S. Carbon dioxide fixation as a central redox cofactor recycling mechanism in bacteria. Proceedings of the National Academy of Sciences 107, 11669–11675 (2010).
Alloul, A. et al. Dehazing redox homeostasis to foster purple bacteria biotechnology. Trends Biotechnol 41, 106–119 (2022).
Vasiliadou, I. A. et al. Biological and Bioelectrochemical Systems for Hydrogen Production and Carbon Fixation Using Purple Phototrophic Bacteria. Front Energy Res 6, 12 (2018).
Vasiliadou, I. A., Melero, J. A., Molina, R., Puyol, D. & Martinez, F. Optimization of H2 Production through Minimization of CO2 Emissions by Mixed Cultures of Purple Phototrophic Bacteria in Aqueous Samples. Water (Basel) 12, (2020).
Fradinho, J. et al. Up-scale challenges on biopolymer production from waste streams by Purple Phototrophic Bacteria mixed cultures: A critical review. Bioresour Technol 327, 124820 (2021).
Ranaivoarisoa, T. O., Singh, R., Rengasamy, K., Guzman, M. S. & Bose, A. Towards sustainable bioplastic production using the photoautotrophic bacterium Rhodopseudomonas palustris TIE-1. J Ind Microbiol Biotechnol 46, 1401–1417 (2019).
Touloupakis, E., Poloniataki, E. G., Ghanotakis, D. F. & Carlozzi, P. Production of Biohydrogen and /or Poly- β -hydroxybutyrate by Rhodopseudomonas sp. Using Various Carbon Sources as Substrate. Appl Biochem Biotechnol 307–318 (2021) doi:https://doi.org/10.1007/s12010-020-03428-1.
Bayon-Vicente, G., Wattiez, R. & Leroy, B. Global Proteomic Analysis Reveals High Light Intensity Adaptation Strategies and Polyhydroxyalkanoate Production in Rhodospirillum rubrum Cultivated With Acetate as Carbon Source. Front Microbiol 11, 1–17 (2020).
Grattieri, M. Purple bacteria photo-bioelectrochemistry: Enthralling challenges and opportunities. Photochemical and Photobiological Sciences 19, 424–435 (2020).
Bian, B., Bajracharya, S., Xu, J., Pant, D. & Saikaly, P. E. Microbial electrosynthesis from CO2: Challenges, opportunities and perspectives in the context of circular bioeconomy. Bioresour Technol 302, 122863 (2020).
Dessì, P. et al. Microbial electrosynthesis: Towards sustainable biorefineries for production of green chemicals from CO2 emissions. Biotechnol Adv 46, (2021).
Bose, A., Gardel, E. J., Vidoudez, C., Parra, E. A. & Girguis, P. R. Electron uptake by iron-oxidizing phototrophic bacteria. Nat Commun 5, 3391 (2014).
Rengasamy, K., Ranaivoarisoa, T., Singh, R. & Bose, A. An insoluble iron complex coated cathode enhances direct electron uptake by Rhodopseudomonas palustris TIE-1. Bioelectrochemistry 122, 164–173 (2018).
Guzman, M. S. et al. Phototrophic extracellular electron uptake is linked to carbon dioxide fixation in the bacterium Rhodopseudomonas palustris. Nat Commun 10, 1–13 (2019).
Li, S. et al. Photoautotrophic hydrogen production of Rhodobacter sphaeroides in a microbial electrosynthesis cell. Bioresour Technol 320, 124333 (2021).
Liao, X., Pan, Q., Tian, X., Wu, X. & Zhao, F. Proteomic analysis of the electron uptake pathway of Rhodopseudomonas palustris CGA009 under different cathodic potentials. Process Biochemistry 115, 42–48 (2022).
Díaz-Rullo Edreira, S. et al. Assessment of voltage influence in carbon dioxide fixation process by a photo-bioelectrochemical system under photoheterotrophy. Microorganisms 9, 1–8 (2021).
Henderson, R. K., Baker, A., Parsons, S. A. & Jefferson, B. Characterisation of algogenic organic matter extracted from cyanobacteria, green algae and diatoms. Water Res 42, 3435–3445 (2008).
Zhang, X. et al. Rapid and Quantitative Assessment of Redox Conduction Across Electroactive Biofilms by using Double Potential Step Chronoamperometry. ChemElectroChem 4, 1026–1036 (2017).
Choi, O. & Sang, B. I. Extracellular electron transfer from cathode to microbes: Application for biofuel production. Biotechnol Biofuels 9, 1–14 (2016).
Shi, L. et al. Molecular Underpinnings of Fe(III) Oxide Reduction by Shewanella Oneidensis MR-1. Frontiers in Microbiology vol. 3 Preprint at (2012).
Pitts, K. E. et al. Characterization of the Shewanella oneidensis. Journal of Biological Chemistry 278, 27758–27765 (2003).
Gorby, Y. et al. Redox-reactive membrane vesicles produced by Shewanella. Geobiology 6, 232–241 (2008).
Hartshorne, R. S. et al. Characterization of Shewanella oneidensis MtrC: a cell-surface decaheme cytochrome involved in respiratory electron transport to extracellular electron acceptors. JBIC Journal of Biological Inorganic Chemistry 12, 1083–1094 (2007).
Conners, E. M., Rengasamy, K. & Bose, A. Electroactive biofilms: how microbial electron transfer enables bioelectrochemical applications. J Ind Microbiol Biotechnol (2022) doi:10.1093/jimb/kuac012.
Jiao, Y. & Newman, D. K. The pio operon is essential for phototrophic Fe(II) oxidation in Rhodopseudomonas palustris TIE-1. J Bacteriol 189, 1765–1773 (2007).
Dinesh, G. et al. Photoferrotrophs Produce a PioAB Electron Conduit for Extracellular Electron Uptake. mBio 10, e02668-19 (2019).
Gest, Howard., Kamen, M. D. & Bregoff, Herta. Maas. Studies on the Metabolism of Photosynthetic Bacteria. Journal of Biological Chemistry 182, 153–170 (1950).
Berman, H. M. et al. The Protein Data Bank. Nucleic Acids Res 28, 235–242 (2000).
Madigan, M. T. Brock, Brock Biology of Microorganisms. (Pearson Educación. Upper Saddle River, NJ: Prentice Hall, 2009).
Tang, K. H., Tang, Y. J. & Blankenship, R. E. Carbon metabolic pathways in phototrophic bacteria and their broader evolutionary implications. Front Microbiol 2, 1–23 (2011).
Yurkov, V. V & Beatty, J. T. Aerobic Anoxygenic Phototrophic Bacteria. MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS vol. 62 (1998).
Tang, K.-H., Feng, X., Tang, Y. J. & Blankenship, R. E. Carbohydrate Metabolism and Carbon Fixation in Roseobacter denitrificans OCh114. PLoS One 4, 7233 (2009).
Fürch, T. et al. Metabolic fluxes in the central carbon metabolism of Dinoroseobacter shibae and Phaeobacter gallaeciensis, two members of the marine Roseobacter clade. BMC Microbiol 9, 209 (2009).
Guardia, A. E., Beligni, M. V., Cortéz, N. & Busalmen, J. P. Electrochemistry of R. palustris Azul during phototrophic growth. Electrochim Acta 355, (2020).
Grattieri, M., Rhodes, Z., Hickey, D. P., Beaver, K. & Minteer, S. D. Understanding Biophotocurrent Generation in Photosynthetic Purple Bacteria. ACS Catal 9, 867–873 (2019).
Higuchi-Takeuchi, M. & Numata, K. Marine Purple Photosynthetic Bacteria as Sustainable Microbial Production Hosts . Frontiers in Bioengineering and Biotechnology vol. 7 Preprint at (2019).
Chen, Y.-T., Wu, S. C. & Lee, C. Relationship between cell growth, hydrogen production and poly-β-hydroxybutyrate (PHB) accumulation by Rhodopseudomonas palustris WP3-5. Int J Hydrogen Energy 37, 13887–13894 (2012).
Hustede, E., Steinbüchel, A. & Schlegel, H. G. Relationship between the photoproduction of hydrogen and the accumulation of PHB in non-sulphur purple bacteria. Appl Microbiol Biotechnol 39, 87–93 (1993).
Bayon-Vicente, G., Zarbo, S., Deutschbauer, A., Wattiez, R. & Leroy, B. Photoheterotrophic assimilation of valerate and associated polyhydroxyalkanoate production by Rhodospirillum rubrum. Appl Environ Microbiol 86, (2020).
Bayon-Vicente, G., Wattiez, R. & Leroy, B. Global Proteomic Analysis Reveals High Light Intensity Adaptation Strategies and Polyhydroxyalkanoate Production in Rhodospirillum rubrum Cultivated With Acetate as Carbon Source. Front Microbiol 11, 464 (2020).
Rengasamy, K., Ranaivoarisoa, T. O., Singh, R. & Bose, A. Improving microbial electrosynthesis of polyhydroxybutyrate (PHB) from CO2 by Rhodopseudomonas palustris TIE-1 using an immobilized iron complex modified cathode. Bioelectrochemistry 122, 164–173 (2018).
Wood, J. C. et al. Strategies to improve viability of a circular carbon bioeconomy-A techno-economic review of microbial electrosynthesis and gas fermentation. Water Res 201, 117306 (2021).
Ormerod, J. G., Ormerod, K. S. & Gest, H. Light-Dependent Utilization of Organic Compounds Photoproduction of Molecular Hydrogen by Photosynthetic Bacteria; Relationships with Nitrogen Metabolism. Archives of Biochemistry and Biophysicscs 94, 449–463 (1961).
American Public Health Association (APHA), American Water Works Association (AWWA) & Water Environment Federation (WEF). Standard methods for the examination of water and wastewater. (2005).
Ventura, M., Puyol, D. & Melero, J. A. The synergy of catalysis and biotechnology as a tool to modulate the composition of biopolymers (polyhydroxyalkanoates) with lignocellulosic wastes. Catal Today (2021) doi:10.1016/j.cattod.2021.09.032.
Allegue, L. D., Ventura, M., Melero, J. A. & Puyol, D. Integrated sustainable process for polyhydroxyalkanoates production from lignocellulosic waste by purple phototrophic bacteria. GCB Bioenergy 13, 862–875 (2021).
Klindworth, A. et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res 41, e1–e1 (2013).
Callahan, B. J. et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13, 581–583 (2016).
Quast, C. et al. The SILVA ribosomal RNA gene database project: Improved data processing and web-based tools. Nucleic Acids Res 41, D590 (2013).
Cabecas Segura, P. et al. Effects of Mixing Volatile Fatty Acids as Carbon Sources on Rhodospirillum rubrum Carbon Metabolism and Redox Balance Mechanisms. Microorganisms 9, (2021).
Contreras, A., Leroy, B., Mariage, P.-A. & Wattiez, R. Proteomic analysis reveals novel insights into tanshinones biosynthesis in Salvia miltiorrhiza hairy roots. Sci Rep 9, 5768 (2019).
Caspi, R. et al. The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of Pathway/Genome Databases. Nucleic Acids Res 42, D459–D471 (2014).
The UniProt Consortium. UniProt: the universal protein knowledgebase in 2021. Nucleic Acids Res 49, D480–D489 (2021).
Cabecas Segura, P. et al. Study of the production of poly(hydroxybutyrate-co-hydroxyhexanoate) and poly(hydroxybutyrate-co-hydroxyvalerate-co-hydroxyhexanoate) in Rhodospirillum rubrum. Appl Environ Microbiol AEM.01586-21 (2022) doi:10.1128/AEM.01586-21.
Fradinho, J. C., Oehmen, A. & Reis, M. A. M. Photosynthetic mixed culture polyhydroxyalkanoate (PHA) production from individual and mixed volatile fatty acids (VFAs): Substrate preferences and co-substrate uptake. J Biotechnol 185, 19–27 (2014).

There is NO Competing Interest.

SupplementaryDataTaxonomydata.xlsx
Supplementary Dataset 1
SupplementaryDataMetaproteomicdatareactorslevel.xlsx
Supplementary Dataset 2
SupplementaryData0.8VvsOCnormalizedbyspecies.xlsx
Supplementary Dataset 3
SupplementaryData0.4VvsOCnormalizedbyspecies.xlsx
Supplementary Dataset 4
SupplementaryInformation.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Elucidating metabolic tuning of mixed purple phototrophic bacteria biofilms in photoheterotrophic conditions through microbial photo-electrosynthesis

Status:

Version 1

Abstract

Figures

Introduction

RESULTS

Microbial Electrosynthesis System performance

Influence of photoelectrochemical condition in BES system process

Influence of photoelectrochemical conditions on microbial populations

DISCUSSION

Implications for developing microbial photo-electrosynthesis devices

METHODS

Preparation of Synthetic Medium, enrichment of PPB, and Biofilm Formation

Photo-bioelectrochemical Experiments

Analytical Methods

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1