Cells culture
Human colonic epithelial cell (HCoEpiC) and human colon cancer cell lines HCT116, HCT8, HT29, LS174T, LOVO, SW480 were all purchased from Shanghai Institute of Cell Research, CAS. These cells are grown in DEGM (GIBCO) mixed with 10% fetal bovine serum and 1% penicillin streptomycin in a 37 °C, 5%CO2 incubator. The cells in the logarithmic growth phase were selected to further study.
PT-PCR
The cells were collected and centrifuged at 4 °C (12,000 rpm) for 5 min. Total RNA was extracted using TRIzol reagent according to the manufacturer’s instruction (Tamara, Dalian, China). First-strand cDNA synthesis was performed by a cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, MA, USA). The RT-PCR were performed by Mastercycles with 95 °C 15 s, 60 °C 60 s, 72 °C 40 s (35 cycles). Data were analyzed by the comparison Ct(2−ΔΔCt) method and expressed as fold change relative to glyceraldehybe 3-phosphate dehydrogenase (GAPDH) or U6.
The following primers were listed as follows:
miR-22 Forward: 5'- GCATGGAAGCTGCCAGTTGAAG − 3'
Reverse: 5'- ATCCAGTGCAGGGTCCGAGG − 3'
U6 Forward: 5'- CTCGCTTCGGCAGCACA − 3'
Reverse: 5'- AACGCTTCACGAATTTGCGT − 3'
NLRP3 Forward: 5'- CCATCGGCAAGACCAAGA − 3'
Reverse: 5'- ACAGGCTCAGAATGCTCATC − 3'
GAPDH Forward: 5'- TGACTTCAACAGCGACACCCA − 3'
Reverse: 5'- CACCCTGTTGCTGTAGGCCAAA − 3'
Cell Transfection And Grouping
Human HCT116 cells were prepared for following cell experiments. These cells were passaged for 24 hr and cultured in 6-well plates for lentiviral transfection [1]. The lentiviral particles were constructed by Shanghai Jikai Biotechnology Co., Ltd. The cells were randomly divided into 5 groups according to different methods:
(1) Blank control (BC) group: no treatment.
(2) miR-22 overexpression negative group (NC1) group: cells transfected with miR-22 scramble.
(3) miR-22 overexpression group (miR-22): cells transfected with miR-22 mimic.
(4) miR-22 silencing negative group (NC2): cell transfected with miR-22 inhibitor negative control.
(5) miR-22 silencing group (si-miR): cell transfected with miR-22 inhibitor.
The expression levels of miR-22 and NLRP3 mRNA in cells after transfection 72 h was examined by RT-PCR.
Cck-8 Cell Viability Assay
Cancer cells were cultured in a 96-well plate at a density of 2 × 104cells. Then, the culture medium was incubated for 4 h at 37 °C and followed with a time-series of concentrations of CCK-8 solution at 24 h, 48 h, 72 h, and 96 h. Finally, the optical density (OD) value at 450 nm was measured by a multifunction microplate reader.
Colony Formation Assay
Cells were detached with 0.25% trypsin and plated in a 6-well plate at 37 °C in a humidified incubator with 5% CO2 in air for 2 to 3 weeks, the fresh medium was changed every 3 days. The cells were fixed in methanol and each well was added with 1 mL Ji Giemsa working fluid and stained for 30 min. After washed with ultra pure water, the record was imaged by a camera.
Transwell Assay
Cell invasion and migration were all examined with the transwell assay. For invasion, pre-cooled DMEM medium was mixed with Matrigel (Solebao, Beijing) for a 1:1 dilution, then evenly spread in the upper chamber of the transwell (Corning Life Sciences, Corning, NY) at a density of 50 ul/well. Each well was added into 100 µl cell suspension, then incubated at 37 °C for 4 hr. Next, 600 µl of DMEM medium was added to the low chamber and cultured at 37 °C in a humidified incubator with 5%CO2 in air for 72 h. Then, the champers was washed with PBS twice and fixed in 5% gluaraldehyde at 4 °C, followed by staining with 0.1% srystal violet. After 30 min, the Tanswell palate was placed under the inverted microscope (Olympus, Janpan) to observe the bottom of each chamber, from which five fields of view were selected randomly for cell counting. For migration, pre-cooled DMEM medium were not mixed with Matrigel and other steps were accordance with invasion experiment.
Western Blot
After the cells were lysed and centrifuged at 2000 rpm for 20 min, the supernatant was removed and used BCA kits (Solarbio, Beijing, China) to measure the protein concentration. Then, the cell suspension was gently mixed with 10% SDS-PAGE for a 1:1 dilution and heated at 95 °C for 5 min. Next, the proteins were transferred to PVDF membrane for 30 min and blocked with 5% bovine serum albumin (BSA) for 1 h. Followed by treating with the primary antibodies, including anti-MMP9 (ab73734, 1 µg/ml), anti-MMP2 (1:500, orb193343), anti-E-cadherin (1:500, orb43407), anti-N-cadherin (1:500, orb227888), anti-Vimentin (1:500, orb229187), anti-NLRP3 (1:500, orb319065), anti-aIL-1β (1:500, orb339111), anti-β-actin (1:2000, orb178392) and they were all incubated at 4°overnight. All antibody are from Biorbyt, Cambridge, UK. After warming, these proteins were incubated with anti-rabbit IgG secondary antibody (1:1000, ABUN101998, antibodies-online, Aachen, Germany) for 1 h and washed with ECL for 3–5 min. Protein expressions were normalized by β-actin. Grayscale scanning and quantification were performed by Image J (NIH) software.
Luciferase Reporter Assay
The wild miR-22 sequence in the 3’-UTR of CYLD or a mutated variant were amplified in pGL3/Luciferase vector (Promega, Madison, WI, USA) and were cloned into the downstream of luciferase gene. A dual luciferase assay (Promega) was performed at 48 hours after transfection.
Verification
The cells were randomly divided into 6 groups: (1) Blank control group (BC), (2) miR-22 overexpression group (miR-22), (3) NLRP3 silencing negative group (NC3), (4) NLRP3 silencing group (si-NLRP3), (5) miR-22 overexpression + NLRP3 overexpression negative group (miR + NC4), (6) miR-22 overexpression + NLRP3 overexpression group (miR + NLRP3). RT-PCR was used to examine the expression of NLRP3 mRNA in cells after transfection for 72 h, and the above experiment was repeated.
Nude Mice Xenograft Models
Mice studies were implemented in 4 weeks old male BALB/c nude mice who weighted 16–18 g and were purchased from Beijing Vital River Laboratory Animal Technology Co., license number SCXK (Beijing) 20160006. All mice were fed in an independent cage with constant humidity at 24–26℃. Animal experiments were followed the NIH guidelines (NIH Pub. No. 85 − 23, revised 1996) and have been approved by the Animal Protection and Use Committee of Shengjing Hospital, China Medical University. Each logarithmic growth phase cell was digested with 0.25% trypsin and cell concentration was adjusted respectively to each group at 5 × 10− 7 /mL [1]. The mice were injected intraperitoneally with 0.1 mL dilution on the dorsal skin of tight fore limb. Twenty-four nude mice were randomly divided into 4 groups: (1) model group, (2) miR-22 overexpression group (miR-22), (3) NLRP3 silence group (si-NLRP3) (4) miR-22 overexpression + NLRP3 overexpression group (miR + NLRP3). After the experiment, all animals were euthanized,the model animals were injected intraperitoneally with 0.6% sodium pentobarbital (50 mg/kg).
Tumor Volume Calculation
The long diameter (L) and short diameter (W) were counted to shape the tumor volume every 7 days. Tumor volume (V) = (long diameter x short diameter2) /2. After 28 days, the model animals were injected intraperitoneally with 0.6% sodium pentobarbital (50 mg/kg), then weigh the tumor tissues. The tumor specimens were partially processed with 4% paraformaldehyde and embedded in paraffin for 24 h.
Immunohistochemical Assay
After routinely sectioning, the tumor specimens were dewaxed with xylene, and hydrated with a series ethanol solution. 3% H2O2 methanol solution was added to deactivated the samples for 20 min. Then add the citrate buffer (pH6.0) to heat-fixed it in high temperature antigen for 10 min, and add 5% BSA to block it for 20 min. Polyclonal rabbit anti-human Ki67 antibody (1:200, orb88614, Biorbyt, Cambridge, UK) were added dropwise and reacted overnight at 4 °C. After rewarming, the samples were incubated with goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (1:1000, ABIN101988, antibodies-online, Germany). The Slides were developed with DAB, then followed by counterstained, dehydrated, transparent, and sealed. The results were observed under a × 400 optical microscope (Olympus, Japan) and counted by Aperio Imagescope 11.1 software, and expressed as percentage (%) of positive cells.
Statistical Analysis.
Data were processed by SPSS19.0 software and presented as the mean ± SEM deviation. Statistical significance was conditioned by ANOVA for multiple comparisons and following analysis were performed by Turkey test. P < 0.05 was considered statistically significant.