Antibodies
The primary antibodies used for western blot assay and immunohistochemical analysis were as follows: anti-GAPDH (Proteintech, Wuhan, China); anti-Catalase (CAT), anti-SOD2 (Cell Signaling Technology, Danvers, MA, USA); anti-3-Nitrotyrosine (3-NT, Millipore); anti-NAD(P)H dehydrogenase quinone 1 (NQO-1), anti-Nrf2, anti-TXNIP, anti-NLRP3, anti-Caspase-1, anti-IL-18, anti-IL-1β, and anti-ASC (Abcam, Cambridge, UK). Horseradish peroxidase (HRP)-conjugated secondary antibodies used for western blot analysis were purchased from Proteintech (Wuhan, China). The SPlink Detection Kits used for immunohistochemical analysis were purchased from ZSGB-BIO Technology (Beijing, China).
Establishment Of The Eae Model
Seven-week-old female C57BL/6 mice were purchased from Chengdu Dashuo Experimental Animal Company (Chengdu, China). All mice were housed in a specific pathogen-free facility with a 12-h light/dark cycle and provided with regular food and water for 1 week before any experiments.
The EAE model was established as previously described [21]. Myelin oligodendrocyte glycoprotein35 − 55 (MOG35 − 55) peptide (Hook Labs, USA) (200 µg) was dissolved in 100-µL phosphate-buffered saline (PBS) and emulsified with 100 µL of complete Freund’s adjuvant (CFA; Chondrex, USA) supplemented with 400 µg Mycobacterium tuberculosis H37Ra (Difco, BD Biosciences, USA). Then, the above emulsions were subcutaneously injected (Day 1). Pertussis toxin (PTX; List Biological Labs, Campbell, CA) (300 ng) was intraperitoneally administered on the first and third days post-immunization.
Bixin Treatment
Animals were randomly divided into the following 5 groups: healthy control (PBS, n = 5), EAE (n = 5), EAE + bixin (50 mg/kg, once daily; n = 5), EAE + bixin (100 mg/kg, once daily; n = 5), and EAE + bixin (200 mg/kg, once daily; n = 5). Bixin was dissolved in dimethyl sulfoxide (DMSO) at 2 g/mL and then diluted with PBS. Mice in EAE + bixin group were treated with intragastric administration of bixin solutions at a dose of 50, 100, or 200 mg/kg daily from the 3rd day to the 15th day. On the 15th day, the mice from each group were euthanized; the brains and spinal cords of the mice were collected.
Nrf2 Inhibitor Treatment
The Nrf2 inhibitor ML385 (MCE, Shanghai, China) was dissolved in DMSO at 300 mg/mL and diluted with PBS [22]. Mice were randomly assigned to the following 8 groups: healthy control (PBS, n = 5), EAE (n = 5), EAE + bixin (100 mg/kg, once daily; n = 5), bixin (100 mg/kg, once daily; n = 5), ML385 (n = 5); ML385 + EAE (n = 5), ML385 + EAE + bixin (100 mg/kg, once daily; n = 5), and ML385 + bixin (100 mg/kg, once daily; n = 5). ML385 (30 mg/kg) pre-treatment was intraperitoneally administered 1 h before intragastric administration of bixin.
Bodyweight And Behavioral Assessments
Clinical behavior scores of each group were evaluated as per the following criteria: 0, without symptoms; 1, lost tail tension; 2, flaccid hind limb; 3, moderate hind limb paralysis; 4, paralysis of both hind limbs and forelimbs, or accompanied with urinary and fecal disorders; and 5, near-death state [2]. The body weight was recorded daily.
Hematoxylin and Eosin (HE) and luxury fast blue (LFB) Staining
Mice were euthanized under anesthesia, and the brain and spinal cord were fixed with 4% paraformaldehyde (in PBS) for 24 h at room temperature, dehydrated with an ethanol gradient and cleared with xylene, subsequently embedded in paraffin, and then cut into 5-µm sections.
To evaluate the degree of inflammatory cell infiltration, brain sections were stained using an HE staining kit (Beyotime Biotechnology, China, Shanghai). The sections were dewaxed and dehydrated, subsequently washed with PBS, and then stained with hematoxylin and eosin for 2 min, respectively.
The spinal cords were stained with LFB staining solution (Solarbio, Beijing, China), to evaluate changes in demyelination. The sections were stained with modified page staining solution and page peach red dye solution, respectively, after being dewaxed and dehydrated with an ethanol gradient.
The inflammatory infiltration and demyelination scores were evaluated as previously reported [23]. Images of brain or spinal cord sections were randomly captured at 20 × magnification (XI 71 Olympus, Tokyo, Japan).
Immunohistochemical Analysis (ihc)
IHC was performed using an SPlink Detection Kit (ZSGB-BIO Technology, Beijing, China). Tissue sections were dewaxed and dehydrated, and washed with PBS. After washing, the samples were boiled in a citrate buffer (pH 6.0) for antigen retrieval, and blocked using 5% normal goat serum at 37 ℃ for 1 h. Subsequently, the sections were incubated at 4 ℃ overnight with primary antibodies (1:200). After washing with PBS, the sections were then incubated with the corresponding secondary antibody for 30 min. Finally, diaminobenzidine was used as the chromogen to visualize the immunocomplexes, and then the sections were counterstained with hematoxylin. Images of the random brain sections were captured at 40 × magnification (XI 71 Olympus, Tokyo, Japan).
Quantitation Of Oxidative Stress
Dihydroethidium (DHE; Molecular Probes, Eugene, OR) staining was used to detect the ROS levels in the brain and spinal cord. The sections were dewaxed and dehydrated with an ethanol gradient, after washing with PBS (pH 7.4), tissue sections were blocked using 5% BSA for 30 min at 37 ℃, and stained with 5 µmol/L DHE (in PBS) for 30 min at 37 ℃. The ROS levels in EAE mice in the absence or presence of bixin were likewise evaluated by DHE staining. Finally, fluorescence images of brain or spinal cord sections were randomly captured at 40 × magnification (XI 71 Olympus, Tokyo, Japan).
ELISA
Mice were euthanized under anesthesia, and the brain were collected and placed in PBS (pH 7.4) on ice and homogenized using a homogenizer. The homogenates were centrifuged at 3000 rpg for 20 min, and then the supernatants were collected. A portion of each supernatant was used for quantitating IL-1β and IL-18 levels by ELISA, and the rest was maintained − 80 ℃ for further analysis. A commercial kit was used for the ELISA assays (MIBIO Biotechnology, Shanghai, China).
Measurement Of Superoxide Dismutase (sod) And Catalase (cat) Activities
The activities of SOD and CAT in brain tissues (The Institute of Biological Engineering of Nanjing Jiancheng, Nanjing, China) were measured according to the manufacturer’s instructions.
Quantitative Reverse-transcription Pcr (qrt-pcr)
Total brain RNA was extracted with a total RNA extraction kit (Solarbio, Beijing, China) according to the manufacturer’s instructions. Then, the cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Nrf2, Catalase, NQO-1, TXNIP, NLRP3, ASC, Caspase-1, IL-18, IL-1β and SOD2 mRNA levels were analyzed by qRT-PCR with SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). The primers were synthesized by Shanghai Shenggong and listed in Table 1 (β-actin was used as an internal control for quantitation). The 2−∆∆CT method was used to calculate relative mRNA levels.
Table 1
Primer sequence information
Genes | Forward primers(5'→3') | Reverse primers(5'→3') |
Actin | GTGCTATGTTGCTCTAGACTTCG | ATGCCACAGGATTCCATACC |
IL-6 | CTTGGGACTGATGCTGGTGACAAC | AGGTCTGTTGGGAGTGGTATCCTC |
IL-8 | CATGGGTGAAGGCTACTGTTGGC | GCTTCATTGCCGGTGGAAATTCC |
TNF-α | TCTACTGAACTTCGGGGTGATCGG | GTGGTTTGTGAGTGTGAGGGTCTG |
IL-10 | CACTGCTATGCTGCCTGCTCTTAC | TGGGAAGTGGGTGCAGTTATTGTC |
Nrf2 | TAAAGCACAGCCAGCACATTCTCC | TGATGACCAGGACTCACGGGAAC |
NQO-1 | GCTGGTTTGAGAGAGTGCTCGTAG | CCCGTGGACACCCTGAAGAGAG |
Catalase | GGAGGCGGGAACCCAATAGGAG | TCAAAGTGTGCCATCTCGTCAGTG |
NLRP3 | GAGCTGGACCTCAGTGACAATGC | ACCAATGCGAGATCCTGACAACAC |
Caspase1 | CATCCTGTCAGGGGCTCACTTTTC | CTATCAGCAGTGGGCATCTGTAGC |
ASC | GAAGTGGACGGAGTGCTGGATG | CTTGTCTTGGCTGGTGGTCTCTG |
TXNIP | CCCAGATACCCCAGAAGCTCCTC | TGAGAGTCGTCCACATCGTCCAG |
IL-1β | CAAGAGCTTCAGGCAGGCAGTATC | AGGTCCACGGGAAAGACACAGG |
IL-18 | GGCTGCCATGTCAGAAGACTCTTG | AGTGAAGTCGGCCAAAGTTGTCTG |
SOD2 | AGCCGTGTCTGTGGGAGTCC | AGAGCAGGCAGCAATCTGTAAGC |
Western Blot Assay
Brain tissues were lysed in ice-cold RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China). The protein concentration was determined using a BCA reagent kit (Beyotime Biotechnology, Shanghai, China). Total protein (30 µg) was separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and transferred onto PVDF membranes (Millipore, Billerica, MA, USA). The membranes were blocked in tris-buffered saline with 5% non-fat milk and 0.5% bovine serum albumin for 1 h at room temperature and then incubated overnight at 4 ℃ with primary antibodies (1:1,000). After washing, the membranes were incubated with secondary antibodies (1:5,000) for 1 h at 37 ℃. Blots were visualized with the Chemiluminescent HRP substrate (Millipore) and quantified with the Quantity 5.2 software System (Bio-Rad).
Statistical Analyses
All data are expressed as mean ± SD. Statistical analysis was performed using GraphPad Prism 7.0 software (GraphPad, San Diego, CA, USA) with one-way ANOVA, followed by post-hoc multiple comparisons with the Tukey’s test. Statistical significance was considered as p < 0.05.