Microencapsulate Probiotics (MP) Promote Growth Performance and Inhibit Inflammatory Response in Broilers Challenged with Salmonella Typhimurium

doi:10.21203/rs.3.rs-2487798/v1

Download PDF

Research Article

Microencapsulate Probiotics (MP) Promote Growth Performance and Inhibit Inflammatory Response in Broilers Challenged with Salmonella Typhimurium

https://doi.org/10.21203/rs.3.rs-2487798/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 12 Apr, 2023

Read the published version in Probiotics and Antimicrobial Proteins →

You are reading this latest preprint version

Antibiotic-resistant becteria are prevalent in husbandry around the world due to the abuse of antibiotic growth promoters (AGPs), therefore it is necessary to find alternatives to AGPs in animal feed. Among all the candidates, probiotics are promising alternatives to AGPs against Salmonella infection. The anti-Salmonella effects of three probiotic strains, namely Lactobacillus crispatus 7 − 4, Lactobacillus johnsonii 3 − 1 and Pediococcusacidilactici 20 − 1, have been demonstrated in our previous study. In this study, we further obtained the alginate beads that containing compound probiotics, namely microencapsulate probiotics (MP), and evaluated its regulatory effect on the health of broilers. The results showed that compared to free probiotics, encapsulation increased tolerance of compound probiotics in the simulated gastrointestinal condition. We observed that the application of probiotics, especially MP, conferred protective effects against S.Tm infection in broilers. Compared to the S.Tm group, the MP could promote the growth performance (p < 0.05) and reduce the S.Tm load in intestine and liver (p < 0.05). In detail, MP pretreatment could modulate the cecal microflora, up-regulate the relative abundance of Lactobacillus and Enterobactericeae. Besides, MP could reduce the inflammation injury of the intestine and liver, reduce the pro-inflammatory cytokines (IL-6, TNF-α, IL-1β) expression, and induce of anti-inflammatory cytokine (IL-10) expression. Futhermore, MP could inhibit NLRP3 pathway in ileum, thereby attenuating S.Tm-induced inflammation. In conclusion, MP could be a new feeding supplementation strategy to substitute AGPs in poultry feeding.

Probiotics

Microencapsulate

Salmonella Typhimurium

Broiler

As a widespread zoonotic pathogen[1], Salmonella spp. can cause foodborne diseases and, result in high costs for prevention and treatment, so it is one of the most important public health and economic concerns around the world. Among them, Salmonella Typhimurium (S.Tm) is one the most common pathogens, and can cause food poisoning and intestinal inflammation in millions of people every year[2]. In poultry industry, S.Tm infection in chickens can lead to inflammatory diarrhea, decreased growth performance, and dysbiosis of intestinal flora, causing huge economic losses[3]. In the past, antibiotics were the most widely administrated in poultry feed as growth promoters to prevent or control the S.Tm infection[4]. However, the long-used of AGPs will destroy the balance of the flora in animal’s intestine and cause bacterial resistance to S.Tm. At present, AGPs are gradually prohibited due to the increasing S.Tm resistance strains and antibiotic residues in poultry products. Therefore, it is urgent to find a substitute for AGPs.

Probiotics, prebiotics, herbs, and plant extracts are advocated to become the substitute to AGPs, and probiotics are the most favored by people due to its natrue and safety[1, 5]. Probiotics are defined as one or a group of live non-pathogenic microorganisms, which can benefit the hosts when given in appropriate quantities[6]. In all probiotics, Lactobacilli and Bifidobacteria are the most globally employed in poultry feed, as they are the natural inhabitants in gastrointestinal tract and consequently generally recognized as safe[7], and the antibacterial activities of Lactobacilli in many studies were well documented[8, 9]. Aside from the antibacterial activity, probiotics can also modulate the intestinal microbiota in hosts, and mostly by increasing the colonization of beneficial bacteria[10].

However, there are many problems in the application of probiotics. Although single strain probiotics could inhibit pathogens[11, 12] and regulate the intestinal microbiota, complex of multiple strains of probiotics could combine a great quantity of advantages of single strain and create probiotic niches, which were superior to single strain probiotics[13]. Simultaneously, probiotics taken orally are easy to be inactivated during gastrointestinal transit, which requires a suitable way to keep its stability, therefore encapsulation has become an effective way to improve the survival of probiotics. Microencapsulation techniques are being widely used for the development of functional food, such as dairy products[14, 15], meat products[16] and fruits as well as their derivatives, but are seldomly used in probiotics reservation. Emulsion systems[17] is the most economic one that are widely used for sample encapsulation nowadays. Alginate is the most widely used material in encapsulation due to its biocompatibility, biodegradability, inertness, low cost and ease to production and formulation[18, 19]. Normally, emulsion method consists of two phases: oil phase and water phase, the principle of it is to generate a water-in-oil emulsion consisting of alginate droplets with encapsulant (e.g., cells) in it in mineral oil, then the alginate droplets happen internal gelation. The encapsulated microspheres were recovered by phase inversion, phase separation by centrifugation, repeated washing and filtration[20]. After all these steps, the encapsulated microspheres could be applied in the experiments, which could protect probiotics from adverse challenge.

A previous study[21] in our laboratory proved that Lactobacillus crispatus 7 − 4 (L. crispatus 7 − 4), Lactobacillus johnsonii 3 − 1 (L. johnsonii 3 − 1) and Pediococcusacidilactici 20 − 1 (P. lactis 20 − 1) were effective in anti- S.Tm and could improve the growth performance of broilers. In this study, we aimed to investigate the protective effects of compound probiotics (CP) and microencapsulate probiotics (MP) on S.Tm-infected broilers, explore the underlying protective mechanism. We hope this study may provide new data for development of probiotic-based products as substitute of AGPs.

2.1 Preparation of bacterial strains

Salmonella Typhimurium (S.Tm, CVCC542) was purchased from China General Microbiological Culture Collection Center. For experimental infection, S.Tm was inoculated into LB and incubated at 37 ℃. The concentration of S.Tm was observed by plating onto the LB agar plates.

The CP was composed of Lactobacillus crispatus 7 − 4 (L. crispatus 7 − 4), Lactobacillus johnsonii 3 − 1 (L. johnsonii 3 − 1) and Pediococcusacidilactici 20 − 1 (P. lactis 20 − 1). The three strains were cultured in MRS medium (Hopebio, China) broth at 37 ℃. When the concentration of each probiotic strain reached 5×10⁸ CFU/mL, mix in a 3:1:1 ratio, and CP was obtained.

The emulsion method was used for the preparation of MP. Briefly, 1 g sodium alginate and 1 g soy dietary fiber powder were swelling in 43 g sterile ddH₂O, then 5 mL CP suspension was added. The mixture was gently poured in 140 mL of soybean oil containing 1% v/v of Span 80, stirring during the addition at the speed of 300 rpm/min for 30 min. Subsequently, 40 mL of 1% w/v calcium chloride (Xilong scientific, China) aqueous solution was added dropwise to the emulsion and maintained a vigorous agitation. After adding lots of sterile ddH₂O, the sample was stand at 4 ℃ overnight to allow the separation of calcium alginate beads on the bottom. After pouring out the upper oil phase and water phase carefully, the MP was collected by centrifugation (10000 rpm/min, 10 min, 4 ℃). The MP was stored at 4 ℃ before experimental use.

2.2 Morphological observation of MP

Scanning electron microscopy (SEM) (Hitachi Regulus-8100, Japan) was used to observe the surface morphology and the microstructure of MP. Firstly, the MP was filtrated by a cell filtration screen (400 mesh) and frozen in -80 ℃ for 24 h to maintain the original structure of the particles, followed by lyophilization for 48 h. The freeze-dried MP was attached to the adhesive carbon tab on a cylindrical aluminum mount and coated with gold, examined with different magnifications at an accelerating voltage of 15 kV.

2.3 Resistance to simulated gastrointestinal juice

MP (1 g) was added into 9 mL stimulated gastric and intestinal juice, respectively, then placed into 37 ℃, 60 rpm/min for 30, 60 and 120 min, respectively. At each time point, appropriate amount of MP suspension was diluted in appropriate gradients with 1× PBS, and plated on the MRS agar plates and incubated at 37 ℃ for 24 h.

2.4 Animal experiments

A total of 50 one-day-old male yellow-feather broilers were used in this study. The broilers were raised for a 3-day-adaption period and then equally divided into 5 groups: the control group (Control), the S.Tm-infected group (group Ⅰ), the group received CP pretreatment (group Ⅱ), the group received MP pretreatment (group Ⅲ), and the group received Neomycin sulfate (group Ⅳ). From days 5 to 21, broilers in the Control group and group Ⅰ, Ⅳ were orally administrated an equal amount of MRS medium, group Ⅱ and Ⅲ received CP or MP 1.5×10⁹ CFU per broiler per day, respectively. At 15-day-old, group Ⅰ, Ⅱ, Ⅲ and Ⅳ were infected with 1 × 10⁸ CFU S.Tm suspension per broiler by gavage, while the Control group was gavaged with the same amount of LB medium. At the same day, group Ⅳ received solution containing Neomycin sulfate (0.5 mg/mL/chick). All animal experiments were performed at a controlled room temperature with 24 h light and free access to food and water. The experiment lasted for 17 days and all animal welfare and experimental procedures were in accordance with the approval of the Animal Ethics Committee of Nanjing Agricultural Unicersity (Permission Number: SYXK (Su) 2017-0007). During the experiment, the body weight and food intake of broilers in each group were measured every 7 days before infection and daily after infection at 9:00 am. Clinical signs and mortality were observed. The average daily gain (ADG), average daily food intake (ADFI) and feed conversion ratio (FCR) were calculated.

On day 21, all broilers from each group were euthanized by cervical dislocation. The intestine, liver, spleen and bursa of fabricius were seperated, the liver, spleen and bursa of facricius were weighed. The fresh cecal content was weighed, flash frozen with liquid nitrogen in a sterile centrifuge tube and stored at -80 ℃ for bacterial analysis. The immune organ coefficient was expressed as a percentage to the individual body weight.

2.5 Determination of S.Tm in intestine and liver

As described in the previous study[22], the intestine, including ileum and cecum, and liver were weighed, homogenized and diluted with sterile PBS. Then, 10 µL of each dilution was coated on the XLD (Hopebio, China) agar plates. After incubated at 37 ℃ for 24 h, the colony forming units (CFU) of each plate was counted and calculated.

2.6 H&E staining and liver pathological indexes

Ileum, cecum and liver samples were collected and fixed in 4% (v/v) paraformaldehyde solution, dehydrated and embedded in paraffin. The morphology of samples stained with H&E staining was observed with an inverted microscope. Image J was used to measure the height of intestinal villi and the depth of crypts.

Commercial diagnostic kits (Jiancheng, China) were used to detect the alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in liver according to the manufacturer’s protocols.

2.7 Relative quantitative real-time PCR analysis

According to the manufacturer’s instructions, microbial genomic DNA was extracted from cecum contents samples using stool genomic DNA extraction kit (Solarbio, China). The DNA quality and quantity were using a Nanodrop spectrophotometer (Thermo Fisher).

The domain-, family-, genus-specific primers for the selected bacterial groups targeting the 16S rRNA gene were listed in Table 1. The invF gene was targeted for Salmonella, which is the transcriptional regulator of Salmonella pathogenicity island 1.

Table 1

Primers used in RT-PCR of bacterial groups.
Target bacterial group	Primer sequence (5’-3’)	Amplicon length (bp)	Tm (℃)
Total bacteria	F: GTGCCAGCWGCCGCGGTAA R: GACTACCAGGGTATCTAAT	291	64.2, 52.4
Salmonella	F: TACTCAACATGGACGGCTCC R: TTTGCAAGAGAGAAGCGGGT	630	56.6, 58.3
Lactobacillus spp.	F: AGCAGTAGGGAATCTTCCA R: CACCGCTACACATGGAG	341	54.5, 55.2
Enterobacteriaaceae	F: ATGTTACAACCAAAGCGTACA R: TTACCYTGACGCTTAACTGC	185	54.0, 56.3
Bifidobacterium spp.	F: GCGTGCTTAACACATGCAAGTC R: CACCCGTTTCCAGGAGCTATT	125	60.3, 59.8
Prevotella spp.	F: CACRGTAAACGATGGATGCC R: GGTCGGGTTGCAGACC	514	58.3, 56.9

Total RNA was extracted from the ileum, cecum and liver samples using TRIzol (Invitrogen, USA), and the concentration and purity of RNA were measured by a Nanodrop (Thermo Fisher). Quantifications of target genes were performed using the ChamQ Universal SYBR qPCR Master Mix (Vazyme Biotech Co.,ltd, China). cDNA was generated using a commercial RT-PCR kit (Yeasen, China). The primers used are listed in Table 2. The relative mRNA expression levels of the target genes were calculated using the comparative Cq method (2^{−ΔΔ Cq}) and were normalized to GAPDH.

Table 2

Primers used in RT-PCR.
Gene	Gene bank ID	Primer sequence (5’-3’)
GAPDH	XM_009932317.1	F: CCACTGGTGTCTTCACGACC R: GGTTCACGCCCATCACAAAC
IL-1β	XM_046931582.1	F: ACTGGGCATCAAGGGCTA R: GGTAGAAGATGAAGCGGGTC
IL-6	NM_204628.2	F: AAATCCCTCCTCGCCAATCT R: CCCTCACGGTCTTCTCCATAAA
TNF-α	XM_046927265.1	F: TATCCTCACCCCTACCCTGTCC R: TCTGGTTACAGGAAGGGCAAC
IL-10	NM_001004414.4	F: GCTGTCACCGCTTCTTCACCT R: GGCTCACTTCCTCCTCCTCATC
NLRP3	XM_048949578.1	F: TGAGGATTTGGACACCTTCCCCT R: TGCTTGATGCAGAAGCAAAGAGCC
Caspase-1	XM_040687588.2	F: GTGCTGCCGTGGAGACAACATAG R: AGGAGACAGTATCAGGCGTGGAAG

2.8 Western blot analysis

Total protein in the ileum was extracted by RIPA lysis buffer (Beyotime, China) with a protease inhibitor cocktail (MedChemExpress, USA). The proteins were isolated by SDS-poluacrylamide gel, and transferred to a PVDF membrane. The PVDF membrane was blocked in 5% skim milk for 1 h, and incubated with the appropriate primary antibody at 37 ℃ for 2 h. Then rinse with 1×TBST three times, the membrane was incubated with corresponding secondary antibody at 4 ℃ overnight. After three 10-min-washes, the membrane was visualized using Image Studio software.

All specific primary antibodies: rabbit polyclonal anti-NLRP3 (Wanleilab, China) (dilution 1:2000), mouse polyclonal anti-IL-1β (BPI, China) (dilution 1:1000), and anti-Actin (Yeasen, China) (loading control, dilution 1:10000). The second antibody IgG anti-rabbit-HRP and IgG anti-mouse-HRP (Sangon, China) was diluted to 1:5000.

2.9 Statistical analysis

All data were expressed as the mean ± standard error of mean (SEM) and evaluated with Graph Pad Prism 7.0 software. The results between groups were analyzed using one-way analysis of varience (ANOVA). Different letters indicate that the changes between groups are statistically significant (p < 0.05).

3.1 Characterizations of MP in vitro

The SEM microphotographs of free probiotics, unfilled alginate beads and alginate beads filled with probiotics (MP) were examined and compared. As shown in the figure, the free probiotics were rod shaped that around 2 µm in length (L. crispatus 7 − 4 and L. johnsonii 3 − 1), and some of them were spherical shaped in 1 µm (P. lactis 20 − 1) (Fig. 1A). The unfilled alginate beads did not have any visible probiotics, and their shapes were irregular (Fig. 1B). The MP formed by emulsion method were generally spherical and uniform (around 5 µm in diameter) and the surface was smooth (Fig. 1C).

The survival of MP under conditions simulating the gastrointestinal environment was evaluated using an in vitro assay. As shown in Fig. 2, when incubated in simulated gastric juice at pH 2.0 for 0.5 h, the survival rate of CP sharply dropped from 100–78.33%, and when the incubating time went to 2 h, the survival rate of CP was only 49.52% (Fig. 2A) (p < 0.001). In comparation, MP was able to survive in the simulated gastric juice and 69.12% was alive after incubating for 2 h, which means most of MP could translocate from stomach to intestine to exert its effects. In the simulated intestinal juice, the changes of survival rate of CP were similar to that in the simulated gastric juice. After incubating for 0.5 h, survival rate of CP was 73.32% while MP was 83.33%. At the time point of 2 h, the survival rate of CP went to 50.33% and MP was 69.33% (p < 0.001).

3.2 MP promoted the Growth performance of broilers

The effects of different treatments on the ADG, ADFI and FCR of broilers were shown in Table 3. Before oral S.Tm infection (day 14), the ADG of group Ⅲ and Ⅳ showed no difference compared with the Control group, while the ADFI and FCR were significantly lower than Control group (p < 0.05). After S.Tm infection (15–21 day), no broiler died among the Control group, group Ⅱ, Ⅲ and Ⅳ, however, the majority of the broilers in group Ⅰ appeared the symptoms of gastroenteritis, diarrhea with significant body weight loss. The ADFI showed no difference among the groups, but the ADG of group Ⅰ was significantly lower than Control group and group Ⅱ and Ⅲ (p < 0.05). Therefore, the FCR was significantly higher in group Ⅰ compared with Control group (p < 0.05). There was no difference between Control group and group Ⅱ and Ⅲ on FCR of S.Tm-infected broilers.

Table 3

Growth performance of broilers before (5–14 day) and after (15–21 day) *S.Tm* infection.
Items	Experimental groups					p value
Items	Control	Ⅰ	Ⅱ	Ⅲ	Ⅳ	p value
5–14 day
ADG(g)	4.79 ± 0.14^b	5.76 ± 0.21^a	3.44 ± 0.16^c	4.61 ± 0.36^b	5.25 ± 0.14^ab	p༜0.05
ADFI(g)	14.56 ± 0.86^a	14.56 ± 0.25^a	12.10 ± 0.18^b	11.24 ± 0.57^b	12.81 ± 0.65^ab	p༜0.05
FCR	3.01 ± 0.12^a	2.79 ± 0.07^ab	3.10 ± 0.07^a	2.38 ± 0.07^c	2.47 ± 0.09^bc	p༜0.05
15–21 day
ADG(g)	12.15 ± 0.79^a	6.98 ± 0.58^b	11.16 ± 1.14^a	12.22 ± 1.22^a	10.00 ± 0.82^ab	p༜0.05
ADFI(g)	19.14 ± 1.45	24.46 ± 2.36	21.72 ± 2.44	20.66 ± 2.12	21.82 ± 2.37	p༞0.05
FCR	1.57 ± 0.02^a	3.51 ± 0.20^b	1.95 ± 0.16^ac	1.69 ± 0.05^ac	2.17 ± 0.08^c	p༜0.05

^{a, b, c} In the same row, means with different superscripts significantly differ at p < 0.05.

Control (MRS medium); Ⅰ (S.Tm, 1×10⁸CFU/chick); Ⅱ (L. crispatus 7 − 4, L. johnsonii 3 − 1, P. lactis 20 − 1, 1.5×10⁹CFU/chick); Ⅲ (encapsulate L. crispatus 7 − 4, L. johnsonii 3 − 1, P. lactis 20 − 1, 1.5×10⁹CFU/chick); Ⅳ (Neomycin sulfate, 0.5 mg/mL/chick).

3.3 Effects of MP in Organ index of S.Tm -infected broilers

No significant difference was observed in organ index of liver, spleen, and bursa of fabricius among the groups (Table 4, p > 0.05). Compared to group Ⅰ, the organ index of spleen and bursa of fabricius of broilers in group Ⅲ were 13.33% and 23.81% lower, which showed the smallest difference from Control group among the 3 treatment groups (group Ⅱ, Ⅲ, Ⅳ).

Table 4

Organ index of broilers after *S.Tm* infection.
	Experimental groups
Organ index (g/100g)	Control	Ⅰ	Ⅱ	Ⅲ	Ⅳ	p value
Liver	3.78 ± 0.39	4.18 ± 0.35	3.57 ± 0.14	3.51 ± 0.25	3.82 ± 0.09	p༞0.05
Spleen	0.10 ± 0.01	0.15 ± 0.01	0.15 ± 0.02	0.13 ± 0.01	0.14 ± 0.02	p༞0.05
Bursa of Fabricius	0.19 ± 0.02	0.21 ± 0.01	0.16 ± 0.01	0.16 ± 0.01	0.19 ± 0.01	p༞0.05

3.4 MP could decrease the S.Tm load in intestine and liver of S.Tm -infected broilers

The survival and pathogenicity of S.Tm can be evaluated by its translocation and colonization in organs. Therefore, we determined the S.Tm colonization in intestine and liver. The results showed that after S.Tm oral infection, the bacteria could be detected in ileum, cecum and liver. Among them, cecum loaded the highest S.Tm in all groups (Table 5). Compared to group Ⅰ, the load of S.Tm of the other 3 treatment groups (group Ⅱ, Ⅲ, Ⅳ) were significantly decreased (p < 0.05). For example, in group Ⅲ, the S.Tm load in ileum and cecum were 45.45% and 29.28% lower than group Ⅰ, while in group Ⅳ, the S.Tm load in liver was 43.18% lower.

Table 5

Organ bacterial load of broilers after *S.Tm* infection.
	Experimental groups
Organ	Control	Ⅰ	Ⅱ	Ⅲ	Ⅳ	p value
Ielum(10⁶CFU/g)	0^a	24.20 ± 1.16^b	15.20 ± 0.37^cd	13.20 ± 0.66^c	17.60 ± 1.36^d	p < 0.05
Cecum(10⁶CFU/g)	0^a	36.20 ± 0.86^b	26.40 ± 1.03^c	25.60 ± 0.87^c	26.00 ± 1.00^c	p < 0.05
Liver(10³CFU/g)	0^a	8.80 ± 0.58^b	7.00 ± 0.32^c	6.40 ± 0.25^cd	5.00 ± 0.45^d	p < 0.05

^{a, b, c, d} In the same row, means with different superscripts significantly differ at p < 0.05.

3.5 MP re-regulated the cecal microflora of S.Tm-infected broilers

As shown in Fig. 3, S.Tm could affect the relative abundance of Lactobacillus and Enterobacteriaceae in cecum (Fig. 3A-B), while the relative abundance of Bifidobacterium and Prevotella were not significantly influenced among the groups (Fig. 3C-D). In detail, concerning Lactobacillus, compared with the Control group, the relative abundance was significantly reduced by 66.37% in group Ⅰ (p < 0.05). However, compared to group Ⅰ, the pretreament with probiotics up-regulated the number of Lactobacillus, for example, the relative abundance of Lactobacillus in group Ⅱ and Ⅲ was improved by 63.81% (p > 0.05) and 141.11% (p > 0.05), respectively (Fig. 3A). Likely, compared to the Control group, the relative abundance of Enterobacteriaceae in group Ⅰ was obviously reduced (Fig. 3B), while both the CP and MP pretreatment improved its abundance. It is worth noting that, AGP (group Ⅳ), different from the probiotics, could upset the balance of intestinal beneficial bacteria.

3.6 MP ameliorated intestinal and liver injury of S.Tm -infected broilers

We performed H&E staining on ileum, cecum and liver sections to investigate the effects of probiotics on the histological changes of S.Tm-infected broilers. The results showed that the application of probiotics could ameliorate the intestine and liver injury caused by S.Tm infection. As shown in Fig. 4A and 4B, in Control group, an orderly arrangement of villi and crypts of the ileum and cecum could been seen, and integrated gland structure was obvious. However, compared with the Control group, villous shedding was shown, and the intestinal epithelial cells were damaged, while villus height and crypt depth were decreased in group Ⅰ with the effect of S.Tm infection. The influence could be ameliorated by probiotics and AGP, as demonstrated by recovered villus height and crypt depth, comparing to group Ⅰ. As we know, S.Tm could translocate to liver and cause lesions. In this study, after S.Tm infection, increased hepatic sinusoid space, inflammatory cells and blood infiltration were seen on liver in group Ⅰ. Likely, with the help of probiotics, the inflammatory cells and blood infiltration were reduced, the hepatic cells alignment were closer, and the level of ALT was significantly decreased in group Ⅱ and Ⅲ (p < 0.05) (Fig. 4C).

3.7 MP modulated the inflammatory cytokines expression levels on ileum, cecum and liver of S.Tm -infected broilers

To examine the effects of probiotics on modulating the inflammation in S.Tm -infected broilers, the levels of inflammatory cytokines of ileum, cecum and liver were detected. Over expression of pro-inflammatory cytokines plays an important role in pathogenesis in intestinal inflammation. Results showed that the levels of pro-inflammatory cytokines (IL-1β, IL-6, TNF-α) on ileum and cecum in group Ⅰ were significantly higher than Control group (Fig. 5A-a, 5A-b, 5A-c, 5B-b, 5B -c, p < 0.05). However, probiotics and AGP could reduce the levels of these pro-inflammatory cytokines, of which the effects of MP were the most obvious. Aside from pro-inflammatory cytokines, anti-inflammatory cytokine is also critical in the development of inflammation. S.Tm decreased the level of IL-10 in group Ⅰ, while MP could significantly increase it in ileum and cecum (p < 0.05) (Fig. 5A-d, 5B-d). S.Tm infection could also increase the level of IL-1β, IL-6 and TNF-α in liver, and probiotics and AGP treatment could downregulation them, but all the treatments had no significant influence on IL-10 (Fig. 5C).

3.8 MP inhibited inflammation through NLRP3 pathway of S.Tm- infected broilers

The redundant role for NLRP3 inflammasome activation has been demonstrated upon S.Tm infection, therefore, to further verify whether probiotics can inhibit the S.Tm-induced inflammation through NLRP3 pathway, we examined the key genes and proteins in the NLRP3 pathway by qPCR and western blotting. As shown in Fig. 6, the level of NLRP3 and Caspase-1 inflammasome was significantly increased in ileum and cecum in group Ⅰ (Fig. 6A-B, p < 0.05) With MP pretreatment, the levels of NLRP3 and Caspase-1 inflammasome were significantly reduced in ileum (p < 0.05) (Fig. 6A-B) comparing with group Ⅰ. In liver, MP could significantly reduce the increased NLRP3 level caused by S.Tm infection, however, it had no influence on Caspase-1 (Fig. 6C). The protein expressions of NLRP3 and IL-1β in ileum were shown in Fig. 6D. S.Tm significantly induced the expression of NLRP3 and IL-1β, and the expression levels were significantly reduced in group Ⅲ. This indicates that MP pretreatment could inhibit the expression of NLRP3 and IL-1β proteins.

S.Tm is a gram-negative zoonotic bacterium, which has become one of the most important public health concerns with a significant economic impact on society[23]. As the most common prevention measure, the supplementation of AGPs in poultry feed is popular[24, 25]. However, the long-term use of AGPs may lead to multi-drug resistance to pathogens and the demanding of “antibiotic-free feeding” [26] is getting stronger nowadays.

Probiotics, due to their safety and multiple nutritional and health benefits, are being used as a promising substitute for AGPs. Meanwhile, compared to single-strain probiotics, compound probiotics have more beneficial effects to broilers on growth performance[27, 28]. Futhermore, to protect the active molecules[29] and control the release and solubilization of probiotics, we also carried out microencapsulation of probiotics[30] in this study and obtained MP encapsulated by calcium alginate as wall, and compound probiotics as a core. As imagined[31], the resistance of MP in a simulated gastrointestinal environment was obviously enhanced after incubating in simulated gastric or intestinal juice, which means encapsulation was an effective way to enhance the resistance of probiotics in adverse conditions.

The mechanisms of a food additives for promoting growth performances constitute competitive inhibition of pathogens, modulation of gut microbiome, or promote the development of intestine morphology, etc. Intestine microflora is one of the central defense components in the gastrointestinal tract against enteric pathogens, has a crucial role in maintaining the intestinal homeostasis. Once the intestinal microbiota dysbiosis, potentially pathogens, including enteric pathogens, could trigger inflammation, which can help the proliferation and colonization of pathogens[32]. It has revealed that probiotics could alleviate the negative impact from Salmonella to intestine microflora[33]. In this study, MP pretreatment could increase the relative abundance of Lactobacillus and Enterobacteriaceae in cecum compared to group Ⅰ, while had no effect on Bifidobacterium and Prevotella, and it was worth noting that the use of AGP could lowered the relative abundance of Lactobacillus (Fig. 3). As we all know, Lactobacillus and Bifidobacterium are beneficial bacteria in intestine[34, 35], but the increasing population of Enterobacteriaceae could be associated with the dysbiosis and risk of disease according to former studies[36]. However, there was also reported that Enterobacteriaceae could consume the oxygen so that inhibited the growth of facultative anaerobic pathogens in intestine, such as S.Tm[37]. In other words, MP pretreatment could modulate the relative abundance of specific bacteria in cecum to maintain intestinal microbial homeostasis.We found that the height of villus in ileum and the depth of crypt in ileum and cecum was shorten after S.Tm infection, while the inflammatory cells and blood infiltration happened in liver, and the ALT level was significantly increased (p < 0.05), whereas the symptoms were alleviated in MP pretreatment broilers (Fig. 4). All above, MP could first promote the growth performance by stabilizing the intestine microflora and repairing the intestine and liver injury.

Probiotics can stimulate the host’s innate immune response while inhibiting the reproduction and translocation of pathogens and regulating the competition of gut microbiota with pathogens, it has been shown that the pretreatment with lactic acid bacteria strains was effective in reducing pro-inflammatory cytokines (IL-1β, IL-6 and IFN-γ) and inducing anti-inflammatory cytokine (IL-10) in S.Tm-infected chicken[38]. Our results presented that the pro-inflammatory cytokines were reduced and anti-inflammatory cytokine was increased in S.Tm-infected broilers, of which the pretreatment of MP was most effective, especially in ileum (Fig. 5A). That was because ileum was not only the main site of nutrients absorption, but also the primary site that pathogens entry[39, 40], which were closely related to animal health[41].

It is well known that S.Tm could activate NLRC4 and NLRP3 inflammasomes[42], and the activation of NLRP3 inflammasome could trigger the assemble of Caspase-1, result in intestine and liver inflammation, thus we examined the mRNA levels of NLRP3 and Caspase-1 in intestine and liver. We found that the expression levels of the above two inflammasomes were significantly inhibited in group Ⅲ compared to group Ⅰ (Fig. 6A, p < 0.05), which means the NLRP3 pathway may be suppressed in ileum by MP. These results were confirmed by western blot, in which, enhanced protein levels of NLRP3 and Caspase-1 were observed in ileum from S.Tm-infected broilers and MP pretreatment significantly lowered them (Fig. 6D). The results suggested that MP could inhibit the ileum inflammation through NLRP3 pathway.

In conclusion, our study confirmed that MP could mitigate intestine and liver inflammation and regulate S.Tm-induced cecal microflora imbalance thus improving growth performance. We also revealed that MP could alleviate the inflammation caused by S.Tm through NLRP3 pathway in ileum. Our study proved MP’s promising clinical application as AGPs substitution in the poultry industry.

ADG

Average daily gain

ADFI

Average daily feed intake

AGPs

Antibiotic growth promoters

ALT

Alanine aminotransferase

AST

Aspartate aminotransferase

CFU

Colony forming units

Compound probiotics

FCR

Feed conversion ratio

Microencapsulate probiotics

SEM

Scanning electron microscopy

S.Tm

Salmonella Typhimurium

Competing Interests

The authors declare no competing financial interest.

Author contributions

SS and WH designed the experiments. WH, DC, LB and MX carried out animal experiment, data analysis, and drafted the manuscript. WH and MX did the cell culture. GZ and LS analyzed the qRT-PCR. WH and DC wrote the manuscript. SS and LB reviewed the manuscript.

Conflicts of interest

The authors declare no competing financial interest.

Acknowledgments

We would like to thank Jiangsu Yancheng Nature Reserve provides sampling opportunities; Yuting Wu, Shuo Zhang, Jiwen Liu and Meihua Zhang for helping with the necropsy of experimental animals.

Funding Sources

This work was supported by National Key R&D Program (2022YFC2105005), the Forestry Science and Technology Innovation and Promotion Project of Jiangsu Province (LYKJ [2021]40), the Project of Science and Technology Support Plan of Taizhou (SNY20210022), Jiangsu Agriculture Science and Technology Innovation Fund (JASTIF) (CX (21)3174), and the Priority Academic Program Development of Jiangsu Higher Education Institutions.

Ferrari RG, Rosario DKA, Cunha-Neto A, Mano SB, Figueiredo EES, Conte-Junior CA (2019) Worldwide Epidemiology of Salmonella Serovars in Animal-Based Foods: a Meta-analysis. Appl Environ Microbiol 85 (14). doi:10.1128/aem.00591-19
Grassl GA, Valdez Y, Bergstrom KS, Vallance BA, Finlay BB (2008) Chronic enteric salmonella infection in mice leads to severe and persistent intestinal fibrosis. Gastroenterology 134 (3):768–780. doi:10.1053/j.gastro.2007.12.043
Wang WW, Jia HJ, Zhang HJ, Wang J, Lv HY, Wu SG, Qi GH (2019) Supplemental Plant Extracts From Flos lonicerae in Combination With Baikal skullcap Attenuate Intestinal Disruption and Modulate Gut Microbiota in Laying Hens Challenged by Salmonella pullorum. Front Microbiol 10:1681. doi:10.3389/fmicb.2019.01681
Gut AM, Vasiljevic T, Yeager T, Donkor ON (2018) Salmonella infection - prevention and treatment by antibiotics and probiotic yeasts: a review. Microbiology (Reading) 164 (11):1327–1344. doi:10.1099/mic.0.000709
He T, Long S, Mahfuz S, Wu D, Wang X, Wei X, Piao X (2019) Effects of Probiotics as Antibiotics Substitutes on Growth Performance, Serum Biochemical Parameters, Intestinal Morphology, and Barrier Function of Broilers. Animals (Basel) 9 (11). doi:10.3390/ani9110985
Hill C, Guarner F, Reid G, Gibson GR, Merenstein DJ, Pot B, Morelli L, Canani RB, Flint HJ, Salminen S, Calder PC, Sanders ME (2014) Expert consensus document. The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat Rev Gastroenterol Hepatol 11 (8):506–514. doi:10.1038/nrgastro.2014.66
Fuller R (1992) Probiotics: The scientific basis. Springer Dordrecht. doi:https://doi.org/10.1007/978-94-011-2364-8
Wang L, Zhang H, Rehman MU, Mehmood K, Jiang X, Iqbal M, Tong X, Gao X, Li J (2018) Antibacterial activity of Lactobacillus plantarum isolated from Tibetan yaks. Microb Pathog 115:293–298. doi:10.1016/j.micpath.2017.12.077
Xu X, Peng Q, Zhang Y, Tian D, Zhang P, Huang Y, Ma L, Dia VP, Qiao Y, Shi B (2020) Antibacterial potential of a novel Lactobacillus casei strain isolated from Chinese northeast sauerkraut and the antibiofilm activity of its exopolysaccharides. Food Funct 11 (5):4697–4706. doi:10.1039/d0fo00905a
Pagnini C, Saeed R, Bamias G, Arseneau KO, Pizarro TT, Cominelli F (2010) Probiotics promote gut health through stimulation of epithelial innate immunity. Proc Natl Acad Sci U S A 107 (1):454–459. doi:10.1073/pnas.0910307107
Castanon JI (2007) History of the use of antibiotic as growth promoters in European poultry feeds. Poult Sci 86 (11):2466–2471. doi:10.3382/ps.2007-00249
Cox LA, Jr., Ricci PF (2008) Causal regulations vs. political will: why human zoonotic infections increase despite precautionary bans on animal antibiotics. Environ Int 34 (4):459–475. doi:10.1016/j.envint.2007.10.010
Timmerman HM, Koning CJ, Mulder L, Rombouts FM, Beynen AC (2004) Monostrain, multistrain and multispecies probiotics–A comparison of functionality and efficacy. Int J Food Microbiol 96 (3):219–233. doi:10.1016/j.ijfoodmicro.2004.05.012
Homayouni A, Azizi A, Ehsani MR, Yarmand MS, Razavi SH (2008) Effect of microencapsulation and resistant starch on the probiotic survival and sensory properties of synbiotic ice cream. Food Chemistry 111 (1):50–55. doi:https://doi.org/10.1016/j.foodchem.2008.03.036
Wang M, Wang C, Gao F, Guo M (2018) Effects of polymerised whey protein-based microencapsulation on survivability of Lactobacillus acidophilus LA-5 and physiochemical properties of yoghurt. J Microencapsul 35 (5):504–512. doi:10.1080/02652048.2018.1538266
Bilenler T, Karabulut I, Candogan K (2017) Effects of encapsulated starter cultures on microbial and physicochemical properties of traditionally produced and heat treated sausages (sucuks). LWT 75:425–433. doi:https://doi.org/10.1016/j.lwt.2016.09.003
Qin X-S, Gao Q-Y, Luo Z-G (2021) Enhancing the storage and gastrointestinal passage viability of probiotic powder (Lactobacillus Plantarum) through encapsulation with pickering high internal phase emulsions stabilized with WPI-EGCG covalent conjugate nanoparticles. Food Hydrocolloids 116:106658. doi:https://doi.org/10.1016/j.foodhyd.2021.106658
Yeung TW, Üçok EF, Tiani KA, McClements DJ, Sela DA (2016) Microencapsulation in Alginate and Chitosan Microgels to Enhance Viability of Bifidobacterium longum for Oral Delivery. Front Microbiol 7:494. doi:10.3389/fmicb.2016.00494
Sun J, Tan H (2013) Alginate-Based Biomaterials for Regenerative Medicine Applications. Materials (Basel) 6 (4):1285–1309. doi:10.3390/ma6041285
Dhamecha D, Movsas R, Sano U, Menon JU (2019) Applications of alginate microspheres in therapeutics delivery and cell culture: Past, present and future. Int J Pharm 569:118627. doi:10.1016/j.ijpharm.2019.118627
Ding C, Wu H, Cao X, Ma X, Gao X, Gao Z, Liu S, Fan W, Liu B, Song S (2021) Lactobacillus johnsonii 3 – 1 and Lactobacillus crispatus 7 – 4 promote the growth performance and ileum development and participate in lipid metabolism of broilers. Food Funct 12 (24):12535–12549. doi:10.1039/d1fo03209g
Taub N, Nairz M, Hilber D, Hess MW, Weiss G, Huber LA (2012) The late endosomal adaptor p14 is a macrophage host-defense factor against Salmonella infection. J Cell Sci 125 (Pt 11):2698–2708. doi:10.1242/jcs.100073
Organization WH (2016) Interventions for the Control of Non-typhoidal Salmonella spp. in Beef and Pork.
Van Boeckel TP, Brower C, Gilbert M, Grenfell BT, Levin SA, Robinson TP, Teillant A, Laxminarayan R (2015) Global trends in antimicrobial use in food animals. Proc Natl Acad Sci U S A 112 (18):5649–5654. doi:10.1073/pnas.1503141112
Barton MD (2000) Antibiotic use in animal feed and its impact on human health. Nutrition Research Reviews
Union E (2006) Ban on antibiotics as growth promoters in animal feed enters into effect.
Reuben RC, Sarkar SL, Ibnat H, Roy PC, Jahid IK (2022) Novel mono- and multi-strain probiotics supplementation modulates growth, intestinal microflora composition and haemato-biochemical parameters in broiler chickens. Vet Med Sci 8 (2):668–680. doi:10.1002/vms3.709
Reuben RC, Sarkar SL, Ibnat H, Setu MAA, Roy PC, Jahid IK (2021) Novel multi-strain probiotics reduces Pasteurella multocida induced fowl cholera mortality in broilers. Sci Rep 11 (1):8885. doi:10.1038/s41598-021-88299-0
Motalebi Moghanjougi Z, Rezazadeh Bari M, Alizadeh Khaledabad M, Amiri S, Almasi H (2021) Microencapsulation of Lactobacillus acidophilus LA-5 and Bifidobacterium animalis BB-12 in pectin and sodium alginate: A comparative study on viability, stability, and structure. Food Sci Nutr 9 (9):5103–5111. doi:10.1002/fsn3.2470
Zhang H, Yang C, Zhou W, Luan Q, Li W, Deng Q, Dong X, Tang H, Huang F (2018) A pH-Responsive Gel Macrosphere Based on Sodium Alginate and Cellulose Nanofiber for Potential Intestinal Delivery of Probiotics. ACS Sustainable Chemistry & Engineering 6 (11):13924–13931. doi:10.1021/acssuschemeng.8b02237
Lee KY, Heo TR (2000) Survival of Bifidobacterium longum immobilized in calcium alginate beads in simulated gastric juices and bile salt solution. Appl Environ Microbiol 66 (2):869–873. doi:10.1128/aem.66.2.869-873.2000
Pickard JM, Zeng MY, Caruso R, Núñez G (2017) Gut microbiota: Role in pathogen colonization, immune responses, and inflammatory disease. Immunol Rev 279 (1):70–89. doi:10.1111/imr.12567
Pei L, Liu J, Huang Z, Iqbal M, Shen Y (2021) Effects of Lactic Acid Bacteria Isolated from Equine on Salmonella-Infected Gut Mouse Model. Probiotics Antimicrob Proteins. doi:10.1007/s12602-021-09841-0
Papizadeh M, Rohani M, Nahrevanian H, Javadi A, Pourshafie MR (2017) Probiotic characters of Bifidobacterium and Lactobacillus are a result of the ongoing gene acquisition and genome minimization evolutionary trends. Microb Pathog 111:118–131. doi:10.1016/j.micpath.2017.08.021
Xiao Y, Zhao J, Zhang H, Zhai Q, Chen W (2021) Mining genome traits that determine the different gut colonization potential of Lactobacillus and Bifidobacterium species. Microb Genom 7 (6). doi:10.1099/mgen.0.000581
Litvak Y, Byndloss MX, Tsolis RM, Bäumler AJ (2017) Dysbiotic Proteobacteria expansion: a microbial signature of epithelial dysfunction. Curr Opin Microbiol 39:1–6. doi:10.1016/j.mib.2017.07.003
Litvak Y, Mon KKZ, Nguyen H, Chanthavixay G, Liou M, Velazquez EM, Kutter L, Alcantara MA, Byndloss MX, Tiffany CR, Walker GT, Faber F, Zhu Y, Bronner DN, Byndloss AJ, Tsolis RM, Zhou H, Bäumler AJ (2019) Commensal Enterobacteriaceae Protect against Salmonella Colonization through Oxygen Competition. Cell Host Microbe 25 (1):128–139.e125. doi:10.1016/j.chom.2018.12.003
Chen CY, Tsen HY, Lin CL, Yu B, Chen CS (2012) Oral administration of a combination of select lactic acid bacteria strains to reduce the Salmonella invasion and inflammation of broiler chicks. Poult Sci 91 (9):2139–2147. doi:10.3382/ps.2012-02237
Abreu MT (2010) Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol 10 (2):131–144. doi:10.1038/nri2707
Zampiga M, Bertocchi M, Bosi P, Trevisi P, Meluzzi A, Sirri F (2019) Differences in productive performance and intestinal transcriptomic profile in two modern fast-growing chicken hybrids. J Anim Physiol Anim Nutr (Berl) 103 (1):125–134. doi:10.1111/jpn.13015
Fries-Craft KA, Meyer MM, Lindblom SC, Kerr BJ, Bobeck EA (2021) Lipid Source and Peroxidation Status Alter Immune Cell Recruitment in Broiler Chicken Ileum. J Nutr 151 (1):223–234. doi:10.1093/jn/nxaa356
Qu Y, Misaghi S, Newton K, Maltzman A, Izrael-Tomasevic A, Arnott D, Dixit VM (2016) NLRP3 recruitment by NLRC4 during Salmonella infection. J Exp Med 213 (6):877–885. doi:10.1084/jem.20132234

No competing interests reported.

Download PDF

Journal Publication

published 12 Apr, 2023

Read the published version in Probiotics and Antimicrobial Proteins →

Editorial decision: Major revision
02 Mar, 2023
Reviews received at journal
14 Feb, 2023
Reviewers agreed at journal
07 Feb, 2023
Reviewers invited by journal
24 Jan, 2023
Editor assigned by journal
18 Jan, 2023
Submission checks completed at journal
18 Jan, 2023
First submitted to journal
17 Jan, 2023

You are reading this latest preprint version

Microencapsulate Probiotics (MP) Promote Growth Performance and Inhibit Inflammatory Response in Broilers Challenged with Salmonella Typhimurium

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Preparation of bacterial strains

2.2 Morphological observation of MP

2.3 Resistance to simulated gastrointestinal juice

2.4 Animal experiments

2.5 Determination of S.Tm in intestine and liver

2.6 H&E staining and liver pathological indexes

2.7 Relative quantitative real-time PCR analysis

2.8 Western blot analysis

2.9 Statistical analysis

3. Results

3.1 Characterizations of MP in vitro

3.2 MP promoted the Growth performance of broilers

3.3 Effects of MP in Organ index of S.Tm -infected broilers

3.4 MP could decrease the S.Tm load in intestine and liver of S.Tm -infected broilers

3.5 MP re-regulated the cecal microflora of S.Tm-infected broilers

3.6 MP ameliorated intestinal and liver injury of S.Tm -infected broilers

3.7 MP modulated the inflammatory cytokines expression levels on ileum, cecum and liver of S.Tm -infected broilers

3.8 MP inhibited inflammation through NLRP3 pathway of S.Tm- infected broilers

4. Discussion

Abbreviations

Declarations

Competing Interests

References

Additional Declarations

Status:

Journal Publication

Version 1