Pomegranate seed pulp was received from a pomegranate juice factory located in Ferdows (South Khorassan, Iran) and dried in shadow. The same basic ratio was prepared for camels and goats by SRNS 2012. All ration components were ground in a heavy-duty high rotation hammer mill to pass through a 1 mm mesh sieve to obtain the fine powder.
The dry matter (DM), ash, crude protein (CP), crude fat (CF), neutral detergent fiber (NDF), and Acid detergent fiber (ADF) were determined according to AOAC. (Table 1).
In order to examine the effect of PSP on rumen microbial population and fermentation, Batch culture method was used. The experimental treatments were included: basic ration as control, basic ration + 5% PSP and basic ration + 10% PSP; PSP replaced wheat bran. For three replications of in vitro gas production experiment, Rumen fluids were collected from slaughtered goats and camels. These samples immediately were transported to the microbiology lab at University of Birjand under anaerobic and thermal conditions (Co2 injection and 37 centigrade degree) and filtered through 4 layers of cheesecloth into a glass amber container.
In vitro gas production was carried out using the method described by Blümmel et al (1997), in three runs with 15 replicates. Artificial of saliva added to mixed rumen fluid at a 2:1 ratio and placed in bath water at 39°c under continuous flushing with CO2, and then 50 ml of the solution were pipetted into each syringe containing 500 ± 10 mg dry matter feedstuffs and placed in bath water at 39°c. The syringes were gently shaken every 2 h. The gas production was recorded after 2, 4, 6, 8, 12, 24, 36, 48, 72, 96, and 120 h of incubation.
Volumes of gas production for each fermentation bottle were recorded continuously until 120h, and the cumulative gas values were fitted with the following exponential model without a lag phase, \(y=v\times (l-exp-kt)\), where y is the cumulative gas volume (mL) produced at time t (h); v is the asymptotic gas volume (mL) and k is a constant rate (mL/h) (Schofield et al, 1994).
To measure methane, NH3-N, pH, and dry matter digestibility after 0, 12, 24, 48, and 72 h of incubation, were sampled from the culture medium with three replications for each parameter. The content of each syringe was filtered through filter bags and the residue was used to determine degradability of the feed substrate. The pH value of the culture was measured using a pH meter. The content of NH3-N was determined using the phenol-hypochlorite (Broderick and Kang, 1980).The filtered sample at 12, 24 and 48 hours of incubation, was aliquoted into different tubes and kept at -20°C until DNA extraction experiment.
The concentrations of volatile fatty acids in 24 hours of incubation were measured according to Getachew et al method (1998), also the efficiency of microbial protein synthesis in the rumen was estimated by Blümmel et al method (1997).
Table 1
Ingredients and proximate composition of diet
Item Ingredients % of DM* | Diet |
1 | 2 | 3 |
Dehydrated alfalfa hey | 20.19 | 20.19 | 20.19 |
Barley | 35.12 | 35.12 | 35.12 |
Wheat bran | 10 | 5 | 0 |
Pomegranate seed pulp | 0 | 5 | 10 |
Straw | 13.17 | 13.17 | 13.17 |
Beet pulp | 118 | 18 | 18 |
Vitamin Minerals mix | 1.76 | 1.76 | 1.76 |
Calcium carbonate | 0.88 | 0.88 | 0.88 |
Salt | 0.88 | 0.88 | 0.88 |
Metabolic energy (Mcal / kg Dm) | 1.14 | 1.14 | 1.14 |
Crude protein % DM | 12.9 | 12.8 | 12.8 |
*ADF % DM | 22.8 | 23.79 | 24.78 |
*NDF % DM | 47.7 | 48.3 | 49 |
Crude fat % DM | 1.1 | 1.5 | 2 |
Ash % DM | 10 | 9.9 | 9.8 |
Calcium % DM | 1.14 | 1.14 | 1.05 |
Phosphor % DM | 0.79 | 0.61 | 0.52 |
DM: Dry Matter |
ADF: acid detergent fiber |
NDF: neutral detergent fiber |
For molecular microbial analyses, DNA of the culture fluid was extracted according to modified RBB + C method (Yu and Morrison, 2004).The concentration of DNA was determined in absorbance at 260 and 280 nm using a NanoDrop Termo 2000 spectrophotometer. The DNA samples were stored at − 20°C until analysis.
Multiple alignments of the 16s rRNA and 18s rRNA genes sequences were used to identify conserved regions along with rumen cellulolytic bacteria and protozoan sequences, respectively. Several primer sets including degenerate and non-degenerate, were designed from these conserved regions to amplify target and competitive fragments (Table 2).
Prior to the cPCR analysis, gradient PCR was performed for optimization of the annealing temperature of the primer sets for protozoa (Tm = 60 and G = 8) and Methanogens (Tm = 60 and G = 7.2). The reaction was conducted in a final volume of 25 µl including 12.5 µl Yekta Tajhiz Master Mix 2x, 10 pM as a forward primer, 10 pM as a reverse primer,8.5 µl distilled water, and 1.0 µl of DNA solution. Afterward, the amplicons were validated through visualization on a 1% (w/v) agarose gel containing Ethidium Bromide for a single band and the absence of primer-dimer products (Fig. 1).
Table 2
The specific primers for PCR and cPCR
Microorganism | Primer | Primer sequence | length |
Protozoa | Target | *F 5' – TCAGTACCTTATGAGAAATC − 3' | 20 |
*R 5' – CAGGACATATAAGGGCATCAC- 3' | 21 |
competitor | *FC 5' – TCAGTACCTTATGAGAAATCTAGTAAGGATTGACAGATTG- 3' | 40 |
*RC 5' – CAGGACATATAAGGGCATCACGACAAATCACTCCACCAACTA − 3' | 42 |
methanogen | Target | F 5' – AGTCAGGCAACGAGCGAGAC- 3' | 20 |
R 5' – GTGTGTGCAAGGAGCAGGGAC- 3' | 21 |
competitor | FC 5' – AGTCAGGCAACGAGCGAGACGCWACACGCGGGCTACAATG- 3' | 40 |
RC 5' – GTGTGTGCAAGGAGCAGGGACTACTACGSATTCCAGCTTCA- 3' | 41 |
F: Forward Primer R: Reverse Primer |
FC: Forward Primer for competitor RC: Reverse Primer for competitor
Competitor DNA for Methanogen (196 kb) and for Protozoa (235 kb) was produced by removing a fragment to yield a shorter fragment.
Reactions for amplifying the competitor fragment were carried out under the following conditions: 1- for protozoan population: one cycle at 95 ° C for 9 min of initial denaturation, 40 cycles of denaturation at 95 ° for 40 s, annealing at 61 ° for 40 s, 72 ° for 40 s of extension, and one cycle of final extension at 72 ° C for 10 minutes. 2- for methanogen population: one cycle at 95 ° C for 9 min of initial denaturation, 40 cycles of denaturation at 95 ° C for 40 s, annealing at 66 ° for 40 s, 72 ° for 40 s of extension, and one cycle of final extension at 72 ° C for 10 min.
Cycle conditions for cPCR were: a) for protozoan population: 95 ° C for 9 min, 30 cycles; 95 ° C for 40 s, 55 ° for 40 s, 72 ° for 40 s, and then 72 ° C for 10 min. b) for methanogen population: 95 ° C for 9 min, 34 cycles; 95 ° for 40 s, 62 ° for 40 s, 72 ° for 40 s, and final extension at 72 ° C for 10 min.
To determine the sensitivities of cPCR assay, competitor fragments from the PCR product for both population were serially diluted. Serial dilutions were made by mixing 15 µl of the competitor and distilled water in consecutive tubes, in a final volume of 150 µl. In the next step cPCR reactions were carried out in a final volume of 25µl, consisting of 1 µl of each dilution, 1 µl of target DNA, 12.5 µl Master Mix 2x (Yekta Tajhiz Azma), 10 pM as a forward primer, 10 pM as a reverse primer,8.5 µl distilled water. In order to distinguish of suitable dilutions for counting population, the PCR products were analyzed by running on 1% agarose gels (Fig. 2). Dilutions 10− 5 to 10− 7 were selected to calculate the protozoa population and expanded to 10− 5, 3×10− 6, 2×10− 6, 10− 6, 7×10− 7, 3×10− 7 and 10− 7, also Dilutions 10− 5 to 10− 8 were selected to count the methanogen population and expanded to 10− 5, 10− 6, 7×10− 7, 5×10− 7, 10− 7, 7×10− 8, 5×10− 8 and 10− 8.
Each competitor was co-amplified by PCR with total DNA from each culture. Negative controls, (DNA was replaced by water), were run for each set. The cPCR products were separated on a 1% agarose gel containing Ethidium Bromide and photographed. The negatives were scanned, and band intensities were measured using image analysis software (ImageJ). Then, using the following formula, the number of copies of the competitor fragment in the specified dilutions was obtained (Ball et al., 2013). In the next step, the intersection points were plotted and by performing mathematical calculations, the frequency of microbial populations at different times and also in different animals was calculated.
$$Number of copies=amount\times 6.022\times {10}^{23})/(length\times 1x{10}^{9}\times 650)$$
$$Number=(ng\times \frac{number}{mole})/(bp\times \frac{ng}{g}\times \frac{g}{mole of bp})$$
Statistical analysis
The data were analyzed in mixed procedure (SPSS 2009) to test the differences among three treatments, two spices and 3 runs, in ruminal fermentation characters and, the population of the total methanogens and protozoa. The Tukey test was used to test differences among individual means for significance.\({y}_{ijk}=\mu +{T}_{i}+{R}_{j}+{S}_{k}+b\left({Y}_{ijk}-{\underset{\_}{Y}}_{0}\right)+{e}_{ijk}\), where, yijk is the dependent variable, µ is an overall mean, Ti is the treatment, Rj is a replication and eijk is a random error.