MiR-199a-3p/5p participate in TGF-β and EGF induced EMT in pterygium by targeting DUSP5/MAP3K11

doi:10.21203/rs.3.rs-24980/v1

Download PDF

Research

MiR-199a-3p/5p participate in TGF-β and EGF induced EMT in pterygium by targeting DUSP5/MAP3K11

https://doi.org/10.21203/rs.3.rs-24980/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 01 Sep, 2020

Read the published version in Journal of Translational Medicine →

You are reading this older preprint version

Read the latest preprint version →

Background: Recently, it has been reported that miRNA is correlated with pterygium, however its exact mechanism in pterygium is unrevealed and require further investigation.

Methods: The differential expression of miRNA in pterygium was profiled using microarray and validated with quantitative real-time PCR (qRT-PCR). Human conjunctival epithelial cells (HCEs) were cultured and treated with TGF-b and EGF. Western blot and immunohistochemistry were carried out to detect epithelial-mesenchymal transition (EMT) markers. Wound healing and transwell assay were used to determine cell migration ability, while apoptosis was determined by flow cytometry. The target genes of miR-199a were confirmed by the dual-luciferase reporter assay.

Results: TGF-b and EGF induced EMT in HCEs to mimic the pathogenesis of pterygium. MiR-199a-3p and miR-199a-5p induced EMT in HCEs, whose respectively downstream targets DUSP5 and MAP3K11 hindered EMT in EMT-HCEs in turn. TGF-b and EGF induced EMT promotion and target genes suppression, could be promoted by miR-199a-3p and miR-199a-5p, while impeded by miR-199a-3p and miR-199a-5p inhibitors. The expression levels of miR-199a and target genes were further validated in pterygium tissues, which were consistent the results in cell model. Bioinformatics analysis indicated the miR-199a-3p/5p-DUSP5/MAP3K11 was belong to MAPK signalling pathway in pterygium. Conclusions: TGF-b and EGF probably induced EMT of HCEs through miR-199a-3p/5p-DUSP5/MAP3K11 axis, which explained the pathogenesis of EMT in pterygium and might provide new targets for pterygium prevention and therapy.

Translational Medicine

miR-199a

DUSP5

MAP3K11

pterygium

EMT

Pterygium is a common ocular surface disease with a triangular-shaped lesion growing in the limbal conjunctiva and progressive invasion of the cornea, affecting nearly 200 million people globally and the prevalence can even be as high as 22% in some countries [1–4]. Ultraviolet light exposure and ocular irritation were widely considered as the dominant risk factors of pterygium, and it caused the inactivation of p53. Inactivated p53 leaded to epithelial-mesenchymal transition (EMT), contributing to the pathogenesis of this disorder [5–7]. Nowadays, conjunctival auto-transplantation is the most common treatment for pterygium, but the recurrence rates range from 2–39% [8–10]. Recently, studies have linked aberrant miRNAs expression to EMT, but the precise contribution of miRNAs in the pathogenesis of pterygium has not been well documented [11–13].

MiRNAs are a large class of small non-coding RNAs, which can complementarily or partially complementarily bind to the 3’-untranslated regions (3’-UTR) of target mRNAs, leading to degradation or translation repression [14, 15]. Current studies indicated a close correlation between miRNAs and pterygium [2, 6, 16–19], but based on a relatively small sample size [19, 20, 18, 2]. So the underlying mechanism of the association between pterygium and miRNAs, still need further investigation.

The process of EMT was usually embodied as conjunctival epithelial cells lose the polarity and cell-cell adhesion, and obtain the migratory ability to become mesenchymal cells, which was verified as one of the most significant procedure of pterygium [21–24]. TGF-β and EGF were found to be two significant inducement in the process of EMT in various diseases [24–27]. Both TGF-β and EGF have been reported to be overexpressed in pterygium. TGF-β signalling stimulates fibroblasts migration, proliferation and myofibroblasts differentiation, which play a significant role as profibrotic agents in pterygium [28, 29]. While EGF promotes excessive keratinization and the overexpressed receptor of EGF leaded to increased proliferation in pterygium epithelial cells [30, 31]. So, we induced EMT in human conjunctival epithelial cells (HCEs) with TGF-β and EGF imitate the EMT initiation in pterygium. This EMT pterygium cell model was applied to the subsequent experiments.

Our rationale was therefore to test whether miR-199a might provide new perspectives on pterygium mechanism in EMT and hope for a new and effective treatment.

Pterygium and control conjunctiva tissue samples

A total of 263 conjunctiva tissues were analysed in this study, including 234 pterygium and 29 control conjunctiva tissues. All pterygium samples were obtained from patients who diagnosed with primary pterygium undergoing a surgical resection and control conjunctiva tissues were collected from patients who underwent cataract surgery from December 2014 to October 2019 at Zhongnan Hospital of Wuhan University. Samples were stored at -80°C immediately after surgery until used.

This study was approved by the Medical Ethical Committee of Zhongnan Hospital of Wuhan University and followed the tenets of the Declaration of Helsinki and its later amendments. Informed consents were obtained from all patients before the study was carried out.

MiRNA microarray assay

Total RNA was isolated from frozen tissue using miRNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instruction. All RNA concentration and purity was evaluated by the NanoDrop2000 spectrophotometer (Thermo Scientific, MA, USA). Total RNA was purified and labelled by FlashTag™ Biotin HSR RNA Labelling Kit (P/N 901911, Affymetrix) according to the manufacturer’s instructions to obtain biotin labelled miRNA. Array hybridization and wash was performed by GeneChip® Hybridization, Wash and Stain Kit (P/N900720, Affymetrix Santa Clara CA, USA) and GeneChip Eukaryotic Hybridization Control Kit (P/N 900454, Affymetrix Santa Clara CA, USA) in Hybridization Oven 645 (P/N 00-0331 (220V), Affymetrix Santa Clara CA, USA) and Fluidics Station 450 (P/N 00–0079, Affymetrix Santa Clara CA, USA) according to the manufacturer’s instructions. Arrays were scanned by GeneChip® Scanner 7G (Affymetrix, Santa Clara, CA, USA) and Command Console Software 3.2 (Affymetrix, Santa Clara, CA, USA) with default settings. Raw data was normalized by RMA and DABG algorithm, Expression Console (Affymetrix, Santa Clara, CA, USA).

RNA isolation, reverse transcription and quantitative real-time PCR

MiRNA and cDNA were synthesized from 500 ng total RNA by RevetAid RT Reverse Transcription Kit (Thermo Scientific, MA, USA) with specific miRNAs stem-loop RT primers (Table 1) and oligo d(T)₁₈, using reverse transcription and quantitative real-time PCR (qRT-PCR). The miRNAs or mRNA expression levels were performed using Bio-Rad CFX96™ real-time PCR detection system (Bio-Rad, CA, USA) and each sample was detected in duplicate. Each assay consisted of 1 × SYBR Green quantitative real-time PCR master mix (Bio-Rad, CA, USA), 0.5 µM of forward and reverse primers (Table 1), and 1 µl cDNA template in a total volume of 20 µl. Non-template control was used as negative control, miRNAs reactions were normalized to U6, mRNA was normalized to GAPDH and the relative expression levels were calculated using the 2^−△Cq method.

Table 1

The list of primer sequences.
Primer name	Forward primer (5’→3’)	Reverse primer (5’→3’)	Amplicon length (bp)	Tm (°C)
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT	94	60
U6-RT	AACGCTTCACGAATTTGCGT
miR-30a-5p	GCGCTGTAAACATCCTCGAC	GTGCAGGGTCCGAGGTATTC	60	60
miR-30a-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTTCCAGT
miR-199-5p	GCCCAGTGTTCAGACTACCTG	GTGCAGGGTCCGAGGTATTC	58	60
miR-199-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGAACAGGT
miR-143-5p	GGTGCAGTGCTGCATCTCT	GTGCAGGGTCCGAGGTATTC	56	60
miR-143-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCA GAGA
miR-486-3p	CGGGGCAGCTCAGTACAG	GTGCAGGGTCCGAGGTATTC	65	60
miR-486-3p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACATCCTGTA
miR-199-3p	GCACAGTAGTCTGCACATTGG	GTGCAGGGTCCGAGGTATTC	68	60
miR-199-3p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTAACCAAT
miR-675-5p	TATATGGTGCGGAGAGGGC	GTGCAGGGTCCGAGGTATTC	71	60
miR-675-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACTGTGG
DUSP5 mRNA	CTACTCGCTTGCCTACCC	ACATCCACGCAACACTCA	95	57
DUSP5 3’UTR	ATACTCGAGAACTGGGATGGAGGAATC	TGGGTCGACTGCTTTTCTCCTTTTACTATTTTTA	1118	53
MAP3K11 mRNA	GTGCCATACCGTGGCATTGA	CATTTCCCGTAGGACCTGTG	204	60
MAP3K11 3’UTR	GCTCGCTAGCCTCGAGGTGGGCCAGGCCACTCCC	ATGCCTGCAGGTCGACTGTGGGGAGACAGCTTTTGAG	536	67
CDH1 (E-cadherin)	GGATTGTCGGATTGGGAGAA	CATTCTGCTGCTTGAGGGTT	194	60
CDH2 (N-cadherin)	GAGTCGAACAGCAGCTCTGA	CTTGTCTGCTTCGGTTTGAC	199	60
VIM (Vimentin)	GATGTTTCCAAGCCTGACCT	CACTTCACAGGTGAGGGACT	216	60
COL1A1	GACTGGGAAACCAGATGCTG	GAAGCCTCTCTCTCCTCTCT	224	60
COL3A1	GAAGGAGGATGTTCCCATCT	GACCATTAGGAGGGCGAGTA	225	60
MMP1	GACTGGGAAACCAGATGCTG	GGTGAATGTCAGAGGTGTGA	226	60

Cell culture

The human conjunctiva epithelial cell line (HConEpic, HCE) was purchased from BeNa Culture Collection (Beijing, China), which was primary culture cells, and before using it was identified with short tandem repeats (STR) (Supplementary 1). HCEs were supplemented with High glucose Dulbecco’s modified Eagle’s medium (H-DMEM, HyClone) containing 10% fetal bovine serum (Gibco) and 1uM penicillin-streptomycin (Gibco). Cells were grown at a humidified atmosphere of 5% CO₂ at 37°C. About 10 nM TGF-β and 20 nM EGF purchased were added after 24 h incubation in growth medium. The medium was changed every other day and TGF-β and EGF were reintroduced to main their concentration, and the cells that harvested after 7 days were used for subsequent experiments.

Immunofluorescence staining: For EMT markers validation, the treated HCEs were fixed with 3.5% paraformaldehyde, permeabilized with 0.1% Triton X-100, blocked with 2% bovine serum albumin (BSA, sigma, USA), and incubated over night at 4°C with primary antibodies as following: anti-N-cadherin (1:100, Abclonal, China), anti-E-cadherin (1:100) and anti-vimentin (1:100). After washing with phosphate buffered saline (PBS, Gibco), the cells were incubated for 1 hour with fluorescein isothiocyanate (FITC)-conjugated mouse immunoglobulin G secondary antibody (1:200). The stained cells were counterstained with 4’, 6-diamidino-2-phenylindole (DAPI, Invitrogen, USA) and viewed under a consistent fluorescence in situ hybridization (FISH) imager (BX51, Olympus, Tokyo, Japan).

Plasmids construction and transient transfection

MiR-199a-3p and miR-199a-5p mimics and inhibitors were purchased from RiboBio Co. Ltd (Ribo, China) and short hairpin RNAs (shRNAs) knocking down DUSP5 and MAP3K11 were purchased from Shanghai Genechem Co. Ltd (Genechem, China) (Table 2). To overexpress DUSP5 and MAP3K11, a full-length coding sequence (CDS) was amplified, and the EcoRI-HF and XhoI sites (NEB, USA) were used to insert the CDS product into pCMV-myc vector (Invitrogen, NY, USA). Before transfection, 2*10⁵ cells were seeded into each well of 6-well plates. After 24 h incubation in growth medium without penicillin-streptomycin, the cells were transiently transfected by using riboFECT™ CP (Ribo, China) for miRNA mimics and inhibitors, or Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) for plasmids, according to the manufacturer’s protocol. The cell were incubated for an additional 24–48 h for the following experiments.

Table 2

The target sequence of DUSP5-shRNAs and MAP3K11-shRNAs
Name	Target Sequence	Start Site	GC (%)
DUSP5-shRNA1#	ctGAGTGTTGCGTGGATGTAA	620	47.37
DUSP5-shRNA2#	ccTGTCCTTCTGTGTGCTTAT	2213	42.11
DUSP5-shRNA3#	gaTAGGCCATTTGCAGACACT	1224	47.37
MAP3K11-shRNA1#	atTGAGAGTGACGACATGGAG	1250	52.63
MAP3K11-shRNA2#	tcTTCCCGTCCAACTATGTGT	774	47.37
MAP3K11-shRNA3#	ctTAGGAGGAGTCACAGCATA	3071	47.37

Wound healing and transwell assay

HConEpic dealt with with TGF-β and EGF for 7d, was seeded equivalently into 6-well culture plates and then was treated with transient transfection for 24 h before scratching or resuspending. A wound was scratched onto the mono-layer with a sterile 20 ul tip (Axygen, Union City, CA, USA). Images of HCEs migrating into the wound were captured at time points of 0, 24 and 48 h by an inverted microscope.

The migration assay were performed using upper chambers of Transwell insert (0.8um pore size, Corning Incorporated, Costar, USA) with 4*10⁵cells in serum-free medium for 48 h. After migration, cells passed through the coated membrane to the lower surface, where cell were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. The cell count was performed under a microscope.

Cell apoptosis determined with flow cytometry

The flow cytometry was performed to analyse the apoptosis of HCEs. Inducement or transfection was done before the cell re-suspended with Annexin V at the concentration of 10⁶ cells/ml. Every specimen was incubated with Annexin V-FITC and propidiumiodide (PI) successively according to the manufacture’s protocol (BestBio, China). Cell apoptosis was analysed via flow cytometry (FACSCanto II; BD Bioscience, Franklin Lake, NJ).

Western blot analysis

After cells were seeded in 6-well plates for 48–72 h, cells were washed with PBS and harvested in RIPA with phosphorylase inhibitor and phenylmethanesulfonyl fluoride (PMSF). Equal amounts of the supernatant were loaded per lane and resolved by SDS-polyacrylamide electrophoresis. Then, proteins were transferred onto polyvinylidene fluoride (PVDF) membrane (Millipore, USA) and blocked by 5% BSA. Primary antibodies should be probed overnight at 4°C, including rabbit anti-MAP3K11, anti-DUSP5, anti-Vimentin, anti-E-Cadherin, anti-N-Cadherin antibodies and mouse anti-GAPDH (abClone) antibody. Membranes were washed in Tris buffered saline tween (TBS-T) and incubated with horseradish peroxidase-conjugated anti-rabbit or anti-mouse secondary antibodies. Membranes were washed in TBS-T and exposured using the electrochemical luminescence (ECL) system. Protein loading was normalized by GAPDH.

Dual-luciferase reporter assay

The fragments of DUSP5 or MAP3K11 3’UTR whole region containing the wild-type binding sites of miR-199a -3p or miR-199a-5p, were amplified with primers containing restriction sites, according to the human cDNA library and cloned into pmirGLO vector (Promega, Madison, WI, USA) to generated DUSP5-WT and MAP3K11-WT vectors. Then the DUSP5-WT and MAP3K11-WT were amplified with primers containing mutant loci to construct the DUSP5-MUT, MAP3K11-MUT1, MAP3K11-MUT2 and MAP3K11-MUT1 + 2 since there are 2 binding sites between miR-199a-5p and MAP3K11. For luciferase reporter assay, 293T and HConEpic cells were plated in 12-well plates and transfected with 50 nM miR-199a-3p or miR-199a-5p mimics and mimic-NC or 100 nM miR-199a-3p or miR-199a-5p inhibitor and inhibitor-NC, and 1ug of plasmids. After about 36 h of transfection, cells were harvested. Luciferase activity was detected by the Dual Luciferase Reporter Assay Kit (Promega, WI, USA) and the Promega GloMax 20/20 luminometer (Promega, WI, USA). All experiments were performed in triplicates and the relative luciferase activity ratios of firefly luciferase activity normalized to Renilla luciferase were calculated.

MiRNAs target gene prediction and GO/pathway analysis: Differentially expressed miRNAs identified by microarray were subjected to target gene prediction analysis using TargetScan, miRDB, mirTarBase, miRanda, Targetminer and miRNAorg. The predicted results of target genes were shown by Venn diagram. GO network maps and term enrichment analysis were performed by using plug-in of Cytoscape: ClueGO and CluePedia, with terms defined by GO_BiologicalProcess-GOA_07.12.2015 and KEGG pathway. Significance was defined by p value < 0.05 and Kappa score threshold of 0.4 for pathways reporting.

Statistical analysis

All data were analysed by GraphPad-Prism8.0 (Graph Pad, CA, USA) in independent t-test, Mann–Whitney U test or Pearson Correlation. p < 0.05 (two-tailed) was considered statistically significant.

Expression profiling showed that miR-199a was upregulated in pterygium

To identity miRNAs expression profiling in pterygium, miRNA microarray analysis was performed in 3 pairs of pterygium and control conjunctiva tissue. Of the 2578 miRNAs screened, 1362 were upregulated and 1216 were downregulated in pterygium compared with normal conjunctiva (Fig. 1a). Using filtering criteria of p < 0.05 and log₂Fold Change (FC) > 1, 40 differentially expressed miRNAs in pterygium tissues were selected (Fig. 1b). These differentially expressed miRNAs were listed (Table 3) and selected for heat map (Fig. 1c). Among them, 30 were upregulated and 10 were downregulated.

Table 3

The list of 41 differentially expressed miRNAs.
Gene symbol*	Fold change	p-values	Sequence length
hsa-miR-30a-5p	2.112	0.033	22
hsa-miR-30a-3p	4.872	0.047	22
hsa-miR-100-5p	4.741	0.030	22
hsa-miR-29b-1-5p	3.224	0.035	24
hsa-miR-199a-5p	3.910	0.046	23
hsa-miR-199a-3p	4.368	0.010	22
hsa-miR-10b-5p	3.733	0.007	23
hsa-miR-10b-3p	3.444	0.044	22
hsa-miR-181c-5p	3.283	0.034	22
hsa-miR-199b-3p	4.368	0.010	22
hsa-miR-214-5p	4.160	0.029	22
hsa-miR-125b-5p	2.725	0.034	22
hsa-miR-125b-1-3p	5.576	0.045	22
hsa-miR-143-5p	6.493	0.003	22
hsa-miR-143-3p	6.958	0.012	21
hsa-miR-145-5p	5.561	0.048	23
hsa-miR-126-3p	3.288	0.011	22
hsa-miR-150-5p	2.789	0.008	22
hsa-miR-185-5p	5.271	0.036	22
hsa-miR-195-5p	3.714	0.003	21
hsa-miR-362-5p	5.418	0.035	24
hsa-miR-370-3p	2.406	0.029	22
hsa-miR-382-5p	6.757	0.041	22
hsa-miR-424-3p	3.182	0.037	21
hsa-miR-433-3p	2.661	0.014	22
hsa-miR-486-3p	20.11	0.010	21
hsa-miR-503-5p	8.349	0.044	23
hsa-miR-1270	2.247	0.036	23
hsa-miR-3175	5.079	0.020	22
hsa-miR-5010-5p	3.225	0.045	22
hsa-miR-210-3p	0.247	0.035	22
hsa-miR-222-3p	0.391	0.045	21
hsa-miR-141-3p	0.071	0.042	22
hsa-miR-149-5p	0.223	0.023	23
hsa-miR-193b-5p	0.270	0.041	22
hsa-miR-193b-3p	0.331	0.034	22
hsa-miR-675-5p	0.130	0.034	23
hsa-miR-744-5p	0.446	0.028	22
hsa-miR-514b-5p	0.187	0.034	22
hsa-miR-6081	0.486	0.020	24
*Using filtering criteria of p < 0.05 and two fold change, 40 miRNAs were differentially expressed.

Furthermore, a part of the results of the miRNAs microarray was verified in a small group of samples as the explorer category, including 55 pterygium and 12 control conjunctiva tissues with qRT-PCR. In line with results of miRNA microarray, the qRT-PCR demonstrated the same direction for these miRNAs except miR-675-5p, which presented no significant decrease in pterygium (p > 0.05) (Fig. 1d). Based on the essential role of miR-199 family in the EMT process, and the primary exploration results of microarray, miR-199a-3p and miR-199a-5p were selected for further exploration on the potential mechanism downstream.

Overexpression of miR-199a-3p/5p promoted EMT in HCEs

We used commercially obtained mimics for miR-199a-3p and miR-199a-5p overexpression, or inhibitors for knockdown in HCEs (Fig. 2a and 2b). Transfection of miR-199a-3p and miR-199a-5p mimics respectively, resulted in a significant increase in cell migration ability (Fig. 2c and 2d) and promoted the occurrence of EMT (Fig. 2e-2 h). Immunofluorescence was used to verify the result of western blot (Fig. 2i). N-cadherin and Vimentin expressions were increased, while E-cadherin was reduced, when HCE treated with mimic of miR-199a-3p or miR-199a-5p. Then we detected matrix metalloproteinases and collagens, and found both miR-199a-3p and miR-199a-5p upregulated the expression of COL3A1 (Fig. 2j and 2 k). Overall, the results showed that both miR-199a-3p and miR-199a-5p promoted the incidence of EMT in HCEs. Transfection of miR-199a-3p and miR-199a-5p mimics, both resulted in a significant suppression in apoptosis, while the apoptosis cells increased after inhibiting the expression of miR-199a-3p or miR-199a-5p (Fig. 2l).

The EMT cell model was established using HCEs induced by TGF-β and EGF

We attempted to establish the EMT-pterygium cell model in HCEs, induced by TGF-β and EGF with different concentration gradients and time gradients. After cultured in the inducement of 10 nM TGF-β and 20 nM EGF for 7 days, the HCEs showed a distinct EMT phenotype (Fig. 3a). The characteristic of EMT-HCEs was identified with qRT-PCR, western blot and immunofluorescence. Compared with control HCEs without inducement, the expression of N-cadherin and Vimentin increased significantly, while E-cadherin decreased (Fig. 3b-3d). In order to confirm the migration ability of EMT activation, the wound healing and transwell assays were executed to find that TGF-β and EGF improved epithelial cells migration (Fig. 3e and 3f). Furthermore, cell apoptosis was detected by flow cytometry with the Annexin V-FITC/PI reagent, and decreased apoptosis cells were observed after induced with TGF-β and EGF (Fig. 3g).

To further confirm that whether the EMT-HCE model could represent the EMT process in pterygium, we detected the expression of EMT markers in primary culture pterygium cells. We found that the primary culture cells of pterygium showed the same characteristics of EMT promotion as that of EMT-HCE (Supplementary 2).

Knockdown miR-199a-3p/5p hindered EMT

After the induced cells were transfected with miR-199a-3p and miR-199a-5p inhibitor respectively to inhibit the expression, features of EMT would be diminished according to the decreased EMT markers (Fig. 4a). The migration ability of EMT-HCEs was significantly increased, but decreased after treating with inhibitors (Fig. 4b). Our result further verified that the expression variation trend of miR-199a-3p or miR-199a-5p was consistent with the EMT process of HCEs.

DUSP5 and MAP3K11 were the targets of miR-199a-3p and miR-199a-5p

Venn diagram was used to demonstrate the consistent target genes of miR-199a-3p and miR-199a-5p respectively, screened by multiple miRNA related databases (Fig. 5a and 5b). DUSP5 and MAP3K11 were selected for further verification. The predicted binding sites between the 3’-untranslated region (3’-UTR) of DUSP5 or MAP3K11 and miR-199a-3p or miR-199a-5p sequences were verified by dual-luciferase reporter gene assay (Fig. 5c and 5d). Luciferase activity of DUSP5-WT 3’UTR was inhibited by miR-199a-3p mimic, but DUSP5-MUT 3’UTR not (Fig. 5e). There were 2 predicted binding sites between the 3’UTR of MAP3K11 and miR-199a-5p, and luciferase activity of MAP3K11-WT 3’UTR was inhibited by miR-199a-5p mimic. With mutation at either of the two binding sites (MAP3K11-MUT1 and MAP3K11-MUT2), luciferase activity could still be inhibited, but the reduce degree was approximately as half of the MAP3K11-WT 3’UTR, but miR-199a-5p had no more impact on the luciferase activity of MAP3K11-MUT1 + 2 3’UTR (Fig. 5f). The results of qRT-PCR and western blot further used to verify the negative correlation between miR-199a and their target genes in both mRNA and protein levels. MiR-199a-3p and miR-199a-5p downregulated the expression of DUSP5 and MAP3K11 respectively, and when miR-199a-3p or miR-199a-5p was knocked down, the expression of DUSP5 or MAP3K11 was increased (Fig. 5g-5j).

DUSP5/MAP3K11 inhibition could promote EMT in HCEs

The effects of knockdown and overexpression were performed by qRT-PCR and western blot. The results showed that DUSP5-shRNA2# and MAP3K11-shRNA1# had the best knockdown effects, and both of the overexpression vectors demonstrate the effect of significantly upregulated expressions of the two gene (Fig. 6a-6d). The HCEs were treated for 36 h for RNA extracting, 48 h for protein extracting, wound healing and cells migration (Fig. 6e and 6f). Both of the wound healing and transwell assay results showed that knockdown either DUSP5 or MAP3K11 promoted the HCEs migration, and when either of the two gene was overexpressed, EMT was inhibited (Fig. 6g and 6 h).

The suppression on DUSP5/MAP3K11 induced by TGF-β and EGF could be regulated by miR-199a-3p/5p expression

In the process of TGF-β and EGF induced EMT in HCE, the expression changes of miR-199a-3p, miR-199a-5p, DUSP5 and MAP3K11 were detected. To some extent, with the increase of TGF-β and EGF induction time, the EMT process was promoted, and the expression levels of miR-199a-3p and miR-199a-5p were also increased, while the expression levels of DUSP5 and MAP3K11 were decreased. WB results verified that, compared with HCE, the expression levels of DUSP5 and MAP3K11 of EMT-HCE were significantly reduced (Fig. 8a-8e). Inhibition of the expression of miR-199a-3p or miR-199a-5p in EMT-HCE resulted in increased expression of corresponding target genes (Fig. 8f-8i). That is to say, the inhibition of TGF-β and EGF on DUSP5 and MAP3K11 was weakened by decreasing the expression of miR-199a-3p and miR-199a-5p. We speculated that miR-199a-3p and miR-199a-5p may be involved in the occurrence of pterygium EMT by targeting DUSP5 and MAP3K11.

MiR-199a-3p/5p potentiated EMT induced by TGF-β and EGF by targeting DUSP5/MAP3K11

Transwell assays were then used to determine the effect of miR-199a-mediated target gene regulation on TGF-β and EGF-induced migration of HCEs. Treated with 10 nM TGF-β and 20 nM EGF for 7 days, the migration ability of HCEs was increased, while the effects were inhibited when either of DUSP5 or MAP3K11 was overexpressed. The migration ability of HCEs was enhanced when miR-199a-3p or miR-199a-5p was overexpressed by mimics, but decreased when either of the two miRNAs was knockdown by inhibitors (Fig. 8a and 8b). The inhibition of miR-199a-3p or miR-199a-5p resulted in the enhancement of DUSP5 or MAP3K11-mediated inhibition of HCEs migration, and TGF-β and EGF induced migration of HCEs was increased by miR-199a-3p or miR-199a-5p treatment. The change trend of EMT markers was consistent with that of migration ability. Overexpression of DUSP5 or MAP3K11 rescued the effects of TGF-β and EGF-induced EMT, and miR-199a-3p and miR-199a-5p could further regulate the induction by regulating the expression of DUSP5 and MAP3K11 respectively (Fig. 8c and 8d). All in all, inhibition of either of DUSP5 or MAP3K11 resulted in the promotion of EMT by miR-199a-3p or miR-199a-5p.

MiR-199a-3p-DUSP5 and miR-199a-5p-MAP3K11 axes regulated EMT in pterygium

In order to further confirm the function of miR-199a-3p and miR-199a-5p in pterygium, qRT-PCR was performed in more pterygium (n = 234) and control conjunctiva tissues (n = 29). Both of the expression of miR-199a-3p and miR-199a-5p were significantly increased in pterygium (p < 0.0001) (Fig. 9a and 9b). To gain insight into the association between miRNAs and target genes, expression levels of DUSP5 and MAP3K11 were also measured by qRT-PCR. The mRNA expression level of DUSP5 (p = 0.0124) and MAP3K11 (p = 0.0005) were significantly decreased in pterygium (Fig. 9c and 9d). The expression level of MAP3K11 in tissues was low, so the results did not contain some meaningless value calculated by qRT-PCR. The amplification efficiency of these primers were verified (Supplementary 3). Downregulated expressions of DUSP5 and MAP3K11 proteins in pterygium tissues were further verified by western blot (Fig. 9e). Moreover, expression levels of miR-199a-3p and miR-199a-5p tended to be negatively associated with those of DUSP5 and MAP3K11 respectively (Fig. 9f and 9 g), which validated the previous experiments in HCEs.

Downstream pathway prediction by bioinformatics

In order to explore the possible roles of miR-199a-3p and miR-199a-5p in greater depth in the occurrence and development of EMT in pterygium, we subjected the putative targets of the two miRNAs to pathway enrichment analysis. The network showed that miR-199a-3p and miR-199a-5p might participate in the development of pterygium by affecting MAPK signalling pathway, TGF-β signalling pathway, PI3K-Akt signalling pathway, focal adhesion and others (Fig. 10a). From the pathway enrichment network, both of the DUSP5 and MAP3K11 were related with MAPK signalling pathway and we speculated that miR-199a might be involved in the MAPK pathway by regulating DUSP5 and MAP3K11, thereby promoting the EMT in HCE. Consistent with other researches, both of miR-199a-3p and miR-199a-5p had the effect on EMT processes and induced cell migration through MAPK signalling pathway, such as miR-199a-3p-DUSP5-ERK and miR-199a-5p-MAP3K11-JNK-p53 pathway. The pathway network was established based on our observation and bioinformatics analysis (Fig. 10b).

The effects of miR-199a and their target genes DUSP5 and MAP3K11 on EMT, were characterized in our study, using HCEs and EMT-HCEs induced by TGF-β and EGF. In previous researches, both activated TGF-β and EGF participates in promoting the process of migration, proliferation and EMT in many different diseases, and there might even be some synergy between TGF-β and EGF [32–34]. On the other hand, EMT and related phenotypes, including migration promotion, extracellular matrix remodelling and apoptosis inhibition, could be regulated by the expression of miRNAs [35–37]. There was a relationship of mutual regulation between specific miRNAs and TGF-β. Our study indicated the feasibility of building EMT cell model with TGF-β and EGF, and presented that miR-199a-3p and miR-199a-5p participated in the process of EMT induced by TGF-β and EGF, by targeting DUSP5 and MAP3K11 in pterygium.

Firstly, we got the miRNA expression profile of pterygium from Affymetrix’ miRNA 4.0 microarray and validated in a small sample of pterygium tissues, where we first indicated that miR-199a might promote the progression pterygium. The function and downstream pathway of miR-199a were performed in HCEs, and finally verified in a large sample of pterygium tissues. Although there were many researches, using microarray to detect the differentially expressed miRNAs in pterygium [19, 2, 20, 18], the Affymetrix’ miRNA 4.0 microarray provided more complete measurements of miRNA transcripts involved in gene regulation compared to GeneChip® miRNA 2.0 and 3.0, based on reports in Sanger miRBase 20.0 database. And For instance, a larger number of miRNA reads, reached to 6659, were discovered in our study compared to previous pterygium microarray research, such as Silin Chen’s (GSE21346), only 1380 reads.

MiR-199 family, consisting of miR-199a/b-3p and miR-199a/b-5p, is encoded within the Dynamin (DNM) genes and exhibit high conservation across species [38]. There are mounting evidences suggesting that miR-199 family acts as a fatal effector of TGF-β signalling in many diseases, regulating multiple disordered processes including cell proliferation, apoptosis, migration, invasion and EMT [39, 40, 25]. The most typical biomarker change in EMT was the conversation from E-cadherin to N-cadherin, accompanied by the increase of cell migration and the decrease of cell apoptosis[41]. We found that as the time of treatment with TGF-β and EGF increased, expression levels of both miR-199a-3p and miR-199a-5p were increased gradually. And, the migration and EMT of EMT-HCEs could be suppressed by inhibiting the expression of either miR-199a-3p or miR-199a-5p. It disclosed that miR-199a-3p/5p were also acted as TGF-β effector in pterygium.

Recently, Antoon JW et al. found that inhibition of p38 mitogen-activated protein kinase (MAPK) signalling pathway even could reverse EMT [42], which is previously considered as a key process of inducting and maintaining the inflammation in various disease [43]. Accordingly, in our study both DUSP5 and MAP3K11 implicated in MAPK signalling pathway, might be a potential therapeutic agent targeted specifically to reverse EMT in pterygium. Knockdown DUSP5 or MAP3K11 promoted EMT. Upregulated DUSP5 had been verified to inhibit the process of EMT in gastric cancer and hepatocellular carcinoma through MAPK pathway, and the cells showed a reduced migration ability and increased apoptosis to inhibit the progression of cancers [44, 45]. Furthermore, combining with existing literature, our pathway bioinformatics analysis also speculated that DUSP5 and MAP3K11 function as a suppressor in cell EMT by downregulating ERK and JNK [46–48].

In accordance with the expression change of miR-199a under TGF-β and EGF induction, the expression level of DUSP5 and MAP3K11 was decreased with time gradient negatively. The results of compensation were shown that, the miR-199a promotion of migration and EMT was possibly regulated by the expression level of DUSP5 and MAP3K11. Regardless the effects of miR-199a-3p and miR-199a-5p, high expression of DUSP5 or MAP3K11 could also inhibit the EMT. That is to say, TGF-β and EGF affected the expression of DUSP5 and MAP3K11 through the regulation of miR-199a-3p and miR-199a-5p, so as to take part in the MAPK signaling pathway, further to promote the EMT of HCEs, and participate in the initiation and development of pterygium.

Of note, in the present study, the most worthy of mention were the establishment of the EMT-HCE model and exploration of miR-199a-DUSP5/MAP3K11-MAPK axis in the process of EMT in pterygium. On the other hand, there were some limitations. Firstly, the number of control conjunctiva tissues was limited to obtain. Secondly, the investigation on large population in different stages of pterygium might be helpful for understanding miRNA’s function in different stage of pterygium [6, 17]. So, it was imperative to further expand the sample size in the followed-up study. Finally, the in vivo animal experiments were lack in the present study.

Our present research presented that TGF-b and EGF activated the miR-199a-DUSP5/MAP3K11-MAPK axis in the EMT process of pterygium. Our research results supplemented basic understanding of the pathophysiological mechanisms of pterygium, hoping to help develop new targets for pterygium treatment.

3’ –untranslated regions	3’ -UTR
4’, 6-diamidino-2-phenylindole	DAPI
bovine serum albumin	BSA
coding sequence	CDS
dynamin	DNM
electrochemical luminescence	ECL
epithelial-mesenchymal transition	EMT
fold change	FC
fluorescence in situ hybridization	FISH
fluorescein isothiocyanate	FITC
human conjunctival epithelial cell	HCE
high glucose Dulbecco’s modified Eagle’s medium	H-DMEM
phosphate buffered saline	PBS
phenylmethanesulfonyl fluoride	PMSF
polyvinylidene fluoride	PVDF
quantitative real-time PCR	qRT-PCR
short hairpin RNA	shRNA
short tandem repeats	STR
Tris buffered saline tween	TBS-T

Ethics approval and consent to participate

Consent for publication

Not application.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This research was supported by the Grant of National Natural Science Foundation of China (Grant Numbers. 81472024) and Youth Projects of Health and Family Planning Commission of Wuhan Municipality (WX18Q46).

Authors’ contributions

Ming Yan and F.Z conceptualize the research. Siying He, Yifang Huang, Guohua Yang, Shuai Zhang and Chen Wang carried out the research. Siying He and Yifang Huang performed the bioinformatics, while Shuai Zhang and Chen Wang validated. Shiqi Dong, Chen Qiao and Yuting Xu provide the tissues and data. Siying He and Yifang Huang wrote the original draft, while Fang Zheng and Ming Yan reviewed and edited. The project was funded by Ming Yan and Chen Qiao.

Acknowledgements

Not applicable.

Lucas RM, McMichael AJ, Armstrong BK, Smith WT. Estimating the global disease burden due to ultraviolet radiation exposure. International journal of epidemiology. 2008;37(3):654-67. doi:10.1093/ije/dyn017.
Lan W, Chen S, Tong L. MicroRNA-215 Regulates Fibroblast Function: Insights from a Human Fibrotic Disease. Cell Cycle. 2015;14(12):1973-84. doi:10.1080/15384101.2014.998077.
Todani A, Melki SA. Pterygium: current concepts in pathogenesis and treatment. International ophthalmology clinics. 2009;49(1):21-30. doi:10.1097/IIO.0b013e3181924f62.
Kocamis O, Bilgec M. Evaluation of the recurrence rate for pterygium treated with conjunctival autograft. Graefe's archive for clinical and experimental ophthalmology = Albrecht von Graefes Archiv fur klinische und experimentelle Ophthalmologie. 2014;252(5):817-20. doi:10.1007/s00417-014-2581-y.
Di Girolamo N. Signalling pathways activated by ultraviolet radiation: role in ocular and cutaneous health. Current pharmaceutical design. 2010;16(12):1358-75.
Wu CW, Peng ML, Yeh KT, Tsai YY, Chiang CC, Cheng YW. Inactivation of p53 in pterygium influence miR-200a expression resulting in ZEB1/ZEB2 up-regulation and EMT processing. Exp Eye Res. 2016;146:206-11. doi:10.1016/j.exer.2016.03.012.
Ando R, Kase S, Ohashi T, Dong Z, Fukuhara J, Kanda A et al. Tissue factor expression in human pterygium. Mol Vis. 2011;17:63-9.
Huerva V, March A, Martinez-Alonso M, Muniesa MJ, Sanchez C. Pterygium surgery by means of conjunctival autograft: long term follow-up. Arquivos brasileiros de oftalmologia. 2012;75(4):251-5.
Gumus K, Karakucuk S, Mirza GE, Akgun H, Arda H, Oner AO. Overexpression of vascular endothelial growth factor receptor 2 in pterygia may have a predictive value for a higher postoperative recurrence rate. Br J Ophthalmol. 2014;98(6):796-800. doi:10.1136/bjophthalmol-2012-301944.
Wu M, Wang J, Zhang Q, Wang Y, Niu L, Shao T. Overexpression of low-density lipoprotein receptors stimulated by vascular endothelial growth factor in fibroblasts from pterygium. Biomed Pharmacother. 2017;93:609-15. doi:10.1016/j.biopha.2017.06.090.
Guo D, Ye Y, Qi J, Zhang L, Xu L, Tan X et al. MicroRNA-181a-5p enhances cell proliferation in medullary thymic epithelial cells via regulating TGF-beta signaling. Acta biochimica et biophysica Sinica. 2016;48(9):840-9. doi:10.1093/abbs/gmw068.
Guo Y, Lu X, Wang H. Downregulation of miR-18a induces CTGF and promotes proliferation and migration of sodium hyaluronate treated human corneal epithelial cells. Gene. 2016;591(1):129-36. doi:10.1016/j.gene.2016.07.008.
Chen SY, Teng SC, Cheng TH, Wu KJ. miR-1236 regulates hypoxia-induced epithelial-mesenchymal transition and cell migration/invasion through repressing SENP1 and HDAC3. Cancer Lett. 2016;378(1):59-67. doi:10.1016/j.canlet.2016.05.006.
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281-97.
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136(2):215-33. doi:10.1016/j.cell.2009.01.002.
Chien KH, Chen SJ, Liu JH, Woung LC, Chen JT, Liang CM et al. Correlation of microRNA-145 levels and clinical severity of pterygia. Ocul Surf. 2013;11(2):133-8. doi:10.1016/j.jtos.2012.12.001.
Chueh-Wei Wu Y-WC, Nan-Yung Hsu, Ken-Tu Yeh, Yi-Yu Tsai, Chun-Chi Chiang, Wei-Ran Wang, Jai-Nien Tung. MiRNA-221 negatively regulated downstream p27Kip1 gene expression involvement in pterygium pathogenesis. Molecular Vision. 2014.
Lee JH, Jung SA, Kwon YA, Chung JL, Kim US. Expression of microRNAs in fibroblast of pterygium. Int J Ophthalmol. 2016;9(7):967-72. doi:10.18240/ijo.2016.07.05.
Engelsvold DH, Utheim TP, Olstad OK, Gonzalez P, Eidet JR, Lyberg T et al. miRNA and mRNA expression profiling identifies members of the miR-200 family as potential regulators of epithelial-mesenchymal transition in pterygium. Exp Eye Res. 2013;115:189-98. doi:10.1016/j.exer.2013.07.003.
Cui YH, Li HY, Gao ZX, Liang N, Ma SS, Meng FJ et al. Regulation of Apoptosis by miR-122 in Pterygium via Targeting Bcl-w. Invest Ophthalmol Vis Sci. 2016;57(8):3723-30. doi:10.1167/iovs.16-19402.
Yang J, Weinberg RA. Epithelial-mesenchymal transition: at the crossroads of development and tumor metastasis. Developmental cell. 2008;14(6):818-29. doi:10.1016/j.devcel.2008.05.009.
Zeisberg M, Neilson EG. Biomarkers for epithelial-mesenchymal transitions. J Clin Invest. 2009;119(6):1429-37. doi:10.1172/JCI36183.
Sun Z, Ma Y, Chen F, Wang S, Chen B, Shi J. miR-133b and miR-199b knockdown attenuate TGF-beta1-induced epithelial to mesenchymal transition and renal fibrosis by targeting SIRT1 in diabetic nephropathy. Eur J Pharmacol. 2018;837:96-104. doi:10.1016/j.ejphar.2018.08.022.
Zhang J, Lang Y, Guo L, Pei Y, Hao S, Liang Z et al. MicroRNA-323a-3p Promotes Pressure Overload-Induced Cardiac Fibrosis by Targeting TIMP3. Cell Physiol Biochem. 2018;50(6):2176-87. doi:10.1159/000495059.
Lino Cardenas CL, Henaoui IS, Courcot E, Roderburg C, Cauffiez C, Aubert S et al. miR-199a-5p Is upregulated during fibrogenic response to tissue injury and mediates TGFbeta-induced lung fibroblast activation by targeting caveolin-1. PLoS Genet. 2013;9(2):e1003291. doi:10.1371/journal.pgen.1003291.
Yang ZC, Qu ZH, Yi MJ, Shan YC, Ran N, Xu L et al. MiR-448-5p inhibits TGF-beta1-induced epithelial-mesenchymal transition and pulmonary fibrosis by targeting Six1 in asthma. J Cell Physiol. 2018. doi:10.1002/jcp.27540.
Loboda A, Sobczak M, Jozkowicz A, Dulak J. TGF-beta1/Smads and miR-21 in Renal Fibrosis and Inflammation. Mediators Inflamm. 2016;2016:8319283. doi:10.1155/2016/8319283.
Kria L, Ohira A, Amemiya T. Immunohistochemical localization of basic fibroblast growth factor, platelet derived growth factor, transforming growth factor-beta and tumor necrosis factor-alpha in the pterygium. Acta histochemica. 1996;98(2):195-201. doi:10.1016/s0065-1281(96)80038-9.
Nuwormegbe SA, Sohn JH, Kim SW. A PPAR-Gamma Agonist Rosiglitazone Suppresses Fibrotic Response in Human Pterygium Fibroblasts by Modulating the p38 MAPK Pathway. Invest Ophthalmol Vis Sci. 2017;58(12):5217-26. doi:10.1167/iovs.17-22203.
Das P, Gokani A, Bagchi K, Bhaduri G, Chaudhuri S, Law S. Limbal epithelial stem-microenvironmental alteration leads to pterygium development. Molecular and cellular biochemistry. 2015;402(1-2):123-39. doi:10.1007/s11010-014-2320-z.
Ghoz N, Britton J, Ross AR, Mohammed I, Hogan E, Said DG et al. Management of primary pterygium with intra-lesional injection of 5 flurouracil and bevacizumab (Avastin). Eye (Lond). 2019;33(11):1776-83. doi:10.1038/s41433-019-0493-0.
Syed V. TGF-beta Signaling in Cancer. Journal of cellular biochemistry. 2016;117(6):1279-87. doi:10.1002/jcb.25496.
Murillo-Garzon V, Gorrono-Etxebarria I, Akerfelt M, Puustinen MC, Sistonen L, Nees M et al. Frizzled-8 integrates Wnt-11 and transforming growth factor-beta signaling in prostate cancer. Nat Commun. 2018;9(1):1747. doi:10.1038/s41467-018-04042-w.
Chen XH, Liu ZC, Zhang G, Wei W, Wang XX, Wang H et al. TGF-beta and EGF induced HLA-I downregulation is associated with epithelial-mesenchymal transition (EMT) through upregulation of snail in prostate cancer cells. Molecular immunology. 2015;65(1):34-42. doi:10.1016/j.molimm.2014.12.017.
Ahn JH, Lee HS, Lee JS, Lee YS, Park JL, Kim SY et al. nc886 is induced by TGF-beta and suppresses the microRNA pathway in ovarian cancer. Nat Commun. 2018;9(1):1166. doi:10.1038/s41467-018-03556-7.
Li Y, Zhang D, Chen M, Wang R, Zhang T, Zhao F et al. The Novel miRNA N-72 Regulates EGF-Induced Migration of Human Amnion Mesenchymal Stem Cells by Targeting MMP2. Int J Mol Sci. 2018;19(5). doi:10.3390/ijms19051363.
Han M, Wang F, Gu Y, Pei X, Guo G, Yu C et al. MicroRNA-21 induces breast cancer cell invasion and migration by suppressing smad7 via EGF and TGF-beta pathways. Oncol Rep. 2016;35(1):73-80. doi:10.3892/or.2015.4360.
Aranda JF, Canfran-Duque A, Goedeke L, Suarez Y, Fernandez-Hernando C. The miR-199-dynamin regulatory axis controls receptor-mediated endocytosis. J Cell Sci. 2015;128(17):3197-209. doi:10.1242/jcs.165233.
Chen T, Margariti A, Kelaini S, Cochrane A, Guha ST, Hu Y et al. MicroRNA-199b Modulates Vascular Cell Fate During iPS Cell Differentiation by Targeting the Notch Ligand Jagged1 and Enhancing VEGF Signaling. Stem cells (Dayton, Ohio). 2015;33(5):1405-18. doi:10.1002/stem.1930.
Murakami Y, Toyoda H, Tanaka M, Kuroda M, Harada Y, Matsuda F et al. The progression of liver fibrosis is related with overexpression of the miR-199 and 200 families. PLoS One. 2011;6(1):e16081. doi:10.1371/journal.pone.0016081.
Xu J, Lamouille S, Derynck R. TGF-beta-induced epithelial to mesenchymal transition. Cell research. 2009;19(2):156-72. doi:10.1038/cr.2009.5.
Antoon JW, Nitzchke AM, Martin EC, Rhodes LV, Nam S, Wadsworth S et al. Inhibition of p38 mitogen-activated protein kinase alters microRNA expression and reverses epithelial-to-mesenchymal transition. Int J Oncol. 2013;42(4):1139-50. doi:10.3892/ijo.2013.1814.
Zwerina J, Hayer S, Redlich K, Bobacz K, Kollias G, Smolen JS et al. Activation of p38 MAPK is a key step in tumor necrosis factor-mediated inflammatory bone destruction. Arthritis and rheumatism. 2006;54(2):463-72. doi:10.1002/art.21626.
Du M, Zhuang Y, Tan P, Yu Z, Zhang X, Wang A. microRNA-95 knockdown inhibits epithelial-mesenchymal transition and cancer stem cell phenotype in gastric cancer cells through MAPK pathway by upregulating DUSP5. J Cell Physiol. 2020;235(2):944-56. doi:10.1002/jcp.29010.
Chen Z, Yu W, Zhou Q, Zhang J, Jiang H, Hao D et al. A Novel lncRNA IHS Promotes Tumor Proliferation and Metastasis in HCC by Regulating the ERK- and AKT/GSK-3beta-Signaling Pathways. Mol Ther Nucleic Acids. 2019;16:707-20. doi:10.1016/j.omtn.2019.04.021.
Lee HS, Hwang CY, Shin SY, Kwon KS, Cho KH. MLK3 is part of a feedback mechanism that regulates different cellular responses to reactive oxygen species. Science signaling. 2014;7(328):ra52. doi:10.1126/scisignal.2005260.
Li Y, Wang D, Li X, Shao Y, He Y, Yu H et al. MiR-199a-5p suppresses non-small cell lung cancer via targeting MAP3K11. J Cancer. 2019;10(11):2472-9. doi:10.7150/jca.29426.
Wang Z, Reinach PS, Zhang F, Vellonen KS, Urtti A, Turner H et al. DUSP5 and DUSP6 modulate corneal epithelial cell proliferation. Mol Vis. 2010;16:1696-704.

Supplementary 1. The STR verification of HCEs.

Supplementary 2. Primary culture of pterygium. (a) Primary cells were cultured by tablet culture. (b, c) EMT markers validation with qRT-PCR and immunofluorescence (*p < 0.05, **p < 0.01, ***p < 0.001).

Supplementary 3. Validation of the amplification efficiency of primers. (a-f) The validation results of the amplification efficiency of primers for miR-199a-3p, miR-199a-5p, U6, DUSP5, MAP3K11 and GAPDH respectively. And the amplification efficiency was performed with amplification curve, melt curve, melt peak and standard curve.

Download PDF

Journal Publication

published 01 Sep, 2020

Read the published version in Journal of Translational Medicine →

Editorial decision: Major revision
16 Jun, 2020
Review #2 received at journal
15 Jun, 2020
Review #1 received at journal
02 Jun, 2020
Reviewer #2 agreed at journal
20 May, 2020
Reviewers invited by journal
19 May, 2020
Reviewer #1 agreed at journal
19 May, 2020
Editor assigned by journal
30 Apr, 2020
Editor invited by journal
29 Apr, 2020
Submission checks completed at journal
27 Apr, 2020
First submitted to journal
25 Apr, 2020

You are reading this older preprint version

Read the latest preprint version →

MiR-199a-3p/5p participate in TGF-β and EGF induced EMT in pterygium by targeting DUSP5/MAP3K11

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Material And Methods

Result

Discussion

Conclusions

List Of Abbreviations

Declarations

References

Supplementary Files

Supplementary Files

Status:

Journal Publication

Version 1