Unexpected thermal stability of two enveloped megaviruses, Emiliania huxleyi virus and African swine fever virus, as measured by viability PCR

doi:10.21203/rs.3.rs-2508557/v1

Download PDF

Research Article

Unexpected thermal stability of two enveloped megaviruses, Emiliania huxleyi virus and African swine fever virus, as measured by viability PCR

https://doi.org/10.21203/rs.3.rs-2508557/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: The particle structure of Emiliania huxleyi virus (EhV), an algal infecting member of nucleocytoplasmic large DNA viruses (NCLDVs), contains an outer lipid membrane envelope similar to that found in animal viruses such as African swine fever virus (ASFV). Despite both being enveloped NCLDVs, EhV and ASFV are known for their stability in the environment.

Method: Here we report for the first time, the application of a viability PCR method to describe the unprecedented and similar virion thermal stability of both EhV and ASFV. This result contradicts the bioassay method that suggests that virus “infectivity” is lost in a matter of seconds (EhV) and minutes (ASFV) at temperature greater than 50 °C. Confocal microscopy and analytical flow cytometry methods was used to validate the viability PCR data for EhV.

Results: We observed that both EhV and ASFV particles has unprecedented thermal tolerances. These two NCLDVs are exceptions to the rule that having an enveloped virion anatomy is a predicted weakness, as is often observed in enveloped RNA viruses (i.e., the viruses causing Porcine Reproductive and Respiratory Syndrome (PRRS), COVID-19, Ebola, or seasonal influenza). Using the viability PCR method, we confirm that no PRRSV particles remain after 20 minutes of exposure to temperatures up to 100 °C.

Conclusions: This observation has practical implications for industries involved in animal health and food security. Finally, we propose that EhV could be used as a surrogate for ASFV under certain circumstances.

NCLDVs

viability PCR

thermal stability

Emiliania huxleyi virus

African swine fever virus

Members of the phylum Nucleocytoviricota, commonly referred to as nucleocytoplasmic large DNA viruses (NCLDVs), can infect many species across diverse kingdoms. Currently, NCLDVs include members from the families Poxviridae, Iridoviridae, Ascoviridae, Asfarviridae, Marseilleviridae, Mimiviridae, and Phycodnaviridae, as well as several lineages of unclassified viruses, such as pithoviruses, pandoraviruses, molliviruses, and faustoviruses [1-3]. These viruses infect marine algae (e.g., Laminaria digitata [4] and Emiliania huxleyi [5]), freshwater algae (Chlorella sp.) [6] protozoa (e.g., amoeba) [7, 8], insects (e.g., lepidopteran larvae) [9], crustaceans (e.g., Caribbean spiny lobster and European shore crab) [10] molluscs (e.g., abalone) [11], amphibians (e.g., wood frog and gopher frog) [12], fish (e.g., finfish) [13], reptiles (e.g., lizards and snakes) [14] and mammals (e.g., humans and pigs) [15, 16].

One ecologically significant algal virus, Emiliania huxleyi virus (EhV), is a Coccolithovirus that terminates Emiliania huxleyi blooms and thereby controls algal community structure, gene transfer within the species, and nutrient cycling in the ocean [5, 17, 18]. Other members of Nucleocytoviricota have more damaging effects on their host ecology. The ascoviruses are known to cause high mortality among economically important insect pests, thereby controlling insect populations [9, 19]. The NCLDV that causes smallpox (poxviruses) afflicted humankind for millennia and may have caused more human deaths than the plague in Europe [20]. Iridoviruses have become noteworthy pathogens for farmed and wild finfish, causing huge economic losses in mariculture and threatening global biodiversity [21]. The African swine fever virus (ASFV) is an Asfivirus currently undergoing a global spread among wild boar and domestic swine populations, which is having devastating effects on animal mortality, food security, and livelihoods [22].

Members of the Nucleocytoviricota are also known for their resilience in the environment. For example, smallpox extracted from scabs stored in envelopes was successfully cultivated every year for 13 years after the initial collection date [23]. Similarly, ASFV can survive in blood for 6 years [24]. More extraordinarily, Pithovirus sibericum was isolated from an estimated 30,000-year-old radiocarbon-dated sample when the authors surveyed the virome of Siberian permafrost [25]. Researchers have reported that coccolithoviruses can pass through zooplankton guts, prolonging EhV’s half-life [26], while a 7,000-year-old record of coccolithoviruses could be amplified from sediments underlying the Black Sea [27].

In virological terms, resilience or the capability of a virus to prolong its viability is often measured by its ability to remain infectious [28]. For animal viruses, the number of infectious virus particles is frequently quantified by using the Tissue Culture Infectious Dose (TCID₅₀) cell culture-based assay. The unit of measurement is the presence of a type of cell in a virus serial dilution array that shows evidence of a cytopathic effect or cell death [29]. In unicellular systems, such as those quantifying the effects of viruses on phytoplankton or bacterial bloom events, virus lysis rates (loss of cells over time) are the preferred units to determine the kill rate of a virus in natural settings [30]. Both these systems nonetheless are used to characterize the virus infection dynamic. In the fields of Food Science, Animal Science and Medicine, the TCID₅₀ assay is used to test treatments or conditions that interfere with the virus infection cycle. For example, food safety microbiologists calculate delta (D) and log reduction values, with 1 log reduction equating to 90% reduction in the initial virus titre, based on cell culture-based assays. These units of measure are used to determine efficacy of treatments for inactivating pathogens in food products or fomites [31, 32]. These assays all require the host response to quantify the infectious state of the virus.

The viability PCR or V-PCR on the other hand, utilizes viability dyes, such as ethidium monoazide (EMA) or propidium monoazide (PMA), prior to nucleic acid extraction, and PCR (for DNA viruses) or RT-PCR (for RNA viruses) to evaluate the state of the virion directly [33]. If intact, the virus is considered “viable” and thus retains the potential to cause disease or be infectious. Photoreactive dyes are membrane-impermeable dyes that selectively penetrate virions that are compromised or damaged and are thereby considered dead or non-viable [34, 35]. These dyes bind to nucleic acids which subsequently inhibit DNA or RNA from amplifying during PCR or RT-PCR amplification, respectively. Recently, viability RT-PCR was used to evaluate the viability of Porcine epidemic diarrhea virus (PEDV) exposed to heat treatments, with the goal of using this method to monitor PEDV contamination in feed and feed ingredients [36]. Others have used the V-PCR assay to compare virus viabilities isolated from different systems. For example, Shirasaki et al. (2020) analyzed the infectivity reduction ratio of a plant virus that was proposed to be a novel surrogate for human enteric viruses to evaluate efficacy of thermal and free-chlorine disinfection processes [37]. Therefore, viability PCR could be a very useful method in determining whether NCLDVs remain viable when exposed to a variety of times and temperature conditions as well as chemical treatments.

Here, we used traditional cell culturing and a quantifiable version of the viability PCR (V-qPCR) assay to evaluate the effect of temperature on EhV-86 infection and viability, respectively. Temperature experiments were carried out using either a series or specific exposure times. We used ASFV and Porcine reproductive and respiratory syndrome virus (PRRSV) that infect domesticated swine as reference controls. The ASFV served as a structurally related NCLDV reference, while PRRSV served as a genetically unrelated enveloped virus with a positive single-stranded RNA genome. Additional methods including confocal microscopy, flow cytometry, and mathematical modelling were used to validate observations made by V-qPCR that could explain the remarkable resilience and longevity of many NCLDVs observed by others in nature.

Cell culture and virus stocks

A culture of Emiliania huxleyi CCMP374 (courtesy of Dr. Martinez-Martinez laboratory, Bigelow Laboratory for Ocean Sciences, Maine, USA) was grown in Alga-Gro® Seawater Medium (Carolina Biological Supplement Company, North Carolina, USA) at 15 °C with 18h/6h light/dark cycle (ca. 2400 lux) until the concentration of 2 x 10⁵ cells mL^-1 was reached. Isolate EhV-86 (also courtesy of Dr. Martinez-Martinez laboratory) was added to E. huxleyi at a multiplicity of infection (MOI) of 1 and grown in a 15 °C incubator until lysis was observed, which was usually after 4 days [5]. The lysate was filtered through a 0.45 µm filter (Nalgene™ Rapid-Flow™ Bottle Top Filters, ThermoFisher Scientific, MA, US) to remove cell debris. The filtered lysate was divided into aliquots, titered using flow cytometry (Supplementary Information Fig S1) and kept in the dark at 4 °C until use.

A pathogenic ASFV strain Pretoriuskop/96/4 (Pr4), isolated from Ornithodoros porcinus porcinus ticks, was collected from the Republic of South Africa in 1996 and was stored at -70^oC at the Plum Island Animal Disease Center. The Pr4 isolate was propagated in primary swine macrophage cultures as previously described in detail [38]. Virus DNA was isolated from stocks of ASFV Pr4 as previously described [39] and was sequenced by Nextera XT kit in the NextSeq (Illumnia, San Diego,CA) following the manufacturer’s protocol. Sequence analysis was performed using CLC Genomics Workbench software (CLCBio, Waltham, MA).2.3.NGS using an Illumina NextSeq550 and were determined to be identical to GenBank Accession: AY261363. The ASFV stock virus was tested to be free of Classical swine fever virus and Foot-and-mouth disease prior to shipment. Virulent PRRSV L1A or 1-4-4 variant was maintained in MARC-145 cells which were used for the isolation, propagation, and enumeration experiments [40]. The PRRSV sample used in the PCR assay came from a 4.68 x 10⁵ TCID₅₀ mL^-1 lysate which was stored at -80 °C.

Viability qPCR

EhV: Aliquots of virus filtrate were exposed to 4 °C, 60 °C, 80 °C, and 100 °C for 10, 20, 40 and 60 min. After treatment, the filtrate was split in two aliquots and PMAxx dye (25 up to 125 µM, final concentration, Biotium Inc, CA, US) was added to one of the aliquots, and incubated in the dark at room temperature for 10 min on a rocker for optimal mixing. The mixed sample was then exposed for 30 min to the light using a PMA-Lite device (Biotium Inc, CA, US) to cross-link PMAxx Dye to the DNA (V-qPCR). The second aliquot that was not treated with PMAxx dye was used as a control for S-PCR. A QIAamp® MinElute® Virus Spin (Qiagen, CA, US) was used to extract DNA from all aliquots. Quantitative PCR was conducted using QuantiNova SYBR Green PCR kit (Qiagen, CA, US) using the following conditions: 2 min at 95 °C followed by 40 cycles of 5 sec at 95 °C and 10 sec at 60 °C (reaction mix components: 10 µL SYBR Green PCR Master Mix, 0.1 µL QN ROX Reference Dye, 1.4 µL reverse primer (GACCTTTAGGCCAGGGAG, 0.7 µM final conc.), 1.4 µL forward primer (TTCGCGCTCGAGTCGATC, 0.7 µM final conc), 6.1 µL molecular grade water, 1 µL DNA template). The primers were used to amplify part of the single copy major capsid protein (MCP) gene of EhV as previously described [41]. All PCR assays were conducted using a QuantStudio 3 Real-Time PCR (Applied Biosystems, Thermo Fisher Scientific, Massachusetts, USA). Standards for the qPCR assays were created using EhV-86 as the template, with the MCP amplificon purity confirmed using an E-Gel electrophoresis system (ThermoFisher Scientific, Massachusetts, USA) and extracted using Zymoclean™ Gel DNA Recovery Kit (Zymo Research, California, USA). The number of EhV-86 genomic copies that equates to MCP copies in the extracted MCP amplicon product was calculated using the following formula:

where ng is the amount of the MCP amplicon as measured by Qubit4 (Invitrogen, ThermoFisher Scientific, Massachusetts, USA), 6.022x10²³is Avogadro’s number, 83454.93 Da is the molecular weight of our MCP amplicon as calculated using the Sequence Manipulation Suite [42] and 1 x 10⁹ is used to convert the molecular weight of the amplicon to nanograms. A dilution series of the MCP amplicon was used to create a EhV genomic equivalent standard curve as illustrated in Supplementary Information Fig S2. Fresh dilutions for the standard curve were made for every qPCR run.

ASFV: Aliquots of the virus were exposed to 4 °C, 60 °C, 80 °C and 100 °C for 20 min. After treatment, the filtrate was split into two aliquots and 100 µM final concentration of PMAxx dye (Biotium Inc, Californiz, USA) was added to one of the aliquots and incubated in the dark at room temperature for 10 min. The sample was then exposed to light for 30 min, using a PMA-Lite device (Biotium Inc, CA, US) to cross-link the PMAxx dye to the DNA. The second aliquot that was not treated with PMAxx dye was used as a control for S-PCR. A QIAamp® MinElute® Virus Spin (Qiagen, CA, US) was used to extract DNA from all the aliquots. Quantitative PCR was conducted using QuantiNova SYBR Green PCR kit (Qiagen, CA, US) using the following conditions: 2 min at 95 °C followed by 40 cycles of 10 sec at 95 °C and 60 sec at 60 °C (reaction mix components: 10 µL SYBR Green PCR Master Mix, 0.1 µL QN ROX Reference Dye, 0.7 µL reverse primer (ATGTCCAGATACGTTGCGTCCG, 0.35 µM final conc.), 0.7 µL forward primer (AGGAGGTATCGGTGGAGGGAAC, 0.35 µM final conc.), 7.5 µL molecular grade water, 1 µL DNA template). All PCR assays were conducted using a QuantStudio 3 Real-Time PCR (Applied Biosystems, Thermo Fisher Scientific, Massachusetts, USA). Standards for the qPCR assays were created using a synthetic ASFV p72 gene designed from sequence with the accession number KM262844, positions 98330 to 99821 bp, ordered from BioGX (https://www.biogx.com/) as the template. A 10-fold serial dilution of the synthetic DNA was used to create a standard curve to convert the Ct values from the qPCR assay to ASFV genomic equivalents.

PRRSV: Aliquots of virus were exposed to 4 °C, 60 °C and 100 °C for 20 min. After treatment, the filtrate was split in two aliquots and 100 µM final concentration of PMAxx dye (Biotium Inc, California, USA) was added to one of the aliquots and incubated in the dark at room temperature for 10 min. The sample was then exposed to light for 30 min using a PMA-Lite device (Biotium Inc, California, USA), to cross-link PMAxx dye to the RNA. The second aliquot that was not treated with PMAxx dye was used as a control for S-PCR. The RNA extraction was conducted using NucleoMag® VET (Takara Bio USA, Inc.) kit. The RT-qPCR was finally conducted using QuantiNova SYBR Green RT-PCR kit (Qiagen, CA, US) using the following conditions: 10 min at 50°C and 10 min at 95 °C followed by 40 cycles of 15 sec at 95 °C and 60 sec at 60 °C (reaction mix components: 10 µL QuantiNova SYBR Green RT-PCR Master Mix, 0.2 µl QuantiNova SYBR Green RT-PCR RT enzyme, 0.5 µL reverse primer (DNA: CGCCCTAATTGAATAGGTGACTTAG, 0.25 µM final conc.), 0.5 µL forward primer (DNA: TAAGTTAYACTGTGGAGTTYAG, 0.25 µM final conc), 7.8 µL molecular grade water, 1 µL RNA template). Standards for the qPCR assays were created by making 10-fold serial dilutions of PRRSV with a known starting concentration of 4.68 x 10⁵ TCID₅₀ mL^-1 (Supplementary Information Fig S3). All RT-PCR assays were conducted using a Roto-gene Q Real-Time PCR (Qiagen, CA, US).

Statistics

Statistical differences in the virus viable qPCR activity (log viable viral particles mL^-1) between the control sample and thermally treated samples for EhV, ASFV and PRSSV were evaluated by an ANOVA test (Tukey’s test) at the 95% confidence level (p <0.05).

EhV inactivation kinetics

Experimental data on virus viable qPCR activity (log viable viral particles mL^-1) were plotted over exposure time (min) to obtain the virus survival curves. GinaFit software [43] was used to estimate the kinetic parameters (delta-value, expressed as the time at certain temperature for the first-log viral decline) of the Weibull models [44]. Goodness of fit of the model to the experimental data was expressed as the adjusted R².

Flow cytometry

We sampled 100 µL volumes of 0.2 µm EhV-86 filtrate exposed to temperatures of 4 °C, 60 °C, 80 °C and 100 °C for 20 min and fixed the viruses in each treatment with glutaraldehyde (0.5% final concentration). All preparations were subsequently diluted 1:100 in 1 mL final volume. Filtrates were then stained using SYBR gold (1/100000 final dilution) and analyzed on an Accuri C6 flow cytometer (BD Biosciences, California, USA) using FL1-H threshold at 700 and fast fluidic rate (66 µL min^-1).

EhV-86 bioassay

A culture of E. huxleyi CCMP347 was grown as previously described, and once the cells reached a density of 1 x 10⁶ cells mL^-1, the culture was divided into 900 µL aliquots and each aliquot was infected with 100 µL of EhV-86 (MOI of 1 based on flow cytometry), except for the uninfected negative controls. Virus treatments were conducted using 100 µL aliquots of EhV-86 (1 x 10⁴ EhV µL^-1) at 4 °C, 37 °C, 40 °C, 42.5 °C, 45 °C, 47 °C, 48 °C, 50 °C, 60 °C, 80 °C, and 100 °C in a MiniAmp Plus Thermal Cycler (Applied Biosystems, CA, US) for intervals of 30 sec or 5 mins. Each temperature treatment at each time point had 5 replicates. Cell counts were determined on day 0, 4 and day 8 post-infection (PI) using a hemocytometer (Neubauer improved, Marienfeld, Germany) and an optical microscope (Nikon Eclipse Ci, Nikon, NY, US). Cell numbers over time were plotted as the reduction in log cell number over time of treatment (in min or sec). The lower limit for counting of E. huxleyi cells in a hemocytometer was 1 x 10⁴ cells mL^-1.

Confocal microscopy

Four samples were prepared including one non-treated control EhV-86 kept at 4°C and three EhV-86 samples treated for 20 min at 60 °C, 80 °C, and 100 °C. Each 500 µL sample of viral lysate was incubated with DAPI dilactate (ThermoFisher Scientific, Massachusetts, USA) at a final concentration of 5 µg mL^-1 overnight at 4°C to stain the nucleic acids [45]. Subsequently, FM 1-43 dye (ThermoFisher Scientific, Massachusetts, USA) was added (10 µM final concentration) to the solutions which were then incubated at 4 °C in the dark for 10 min to allow the staining of the lipid membranes. The stained viral lysate was filtered through a 0.02 µm anodisc filter (Whatman® Anopore™, Sigma Aldrich, Missouri, USA) positioned on top of a disposable 0.45 µm filter apparatus previously wetted with 1 mL of dH₂O (pump pressure 100 mbar). After filtration, the filters were dried under a flow hood in the dark, until the filters appeared opaque. Each anodisc filter was mounted in water and topped with a #1.5 cover slip. The cover slips were sealed onto the slides with clear nail polish. Images were acquired using a Nikon TiE stand equipped with an A1Rsi confocal scan head (Nikon, NY, US). DAPI was excted with a 405 nm laser, emission collected between 430 and 470 nm. FM 1-43 was excited with a 488 nm laser and emission collected between 575 and 625 nm. Channels were acquired sequentially with a Plan Apo Lambda 60x oil, 1.4 NA objective, scan average 16, 2.2 micros/px, 90 nm pixel size and confocal aperture set at 1.2AU (28 µm). Three images were obtained for each filter. Every image was analyzed with Fiji software (https://imagej.net/Fiji), pre-processed using ‘Subtract background, 50 pixels’ to both channels and segmented with DiAna plugin after application of ‘Median’ filter for the DAPI channel and ‘None’ for the FM 1-43 channel. The final co-localization and fluorescence intensity analysis was obtained with DiAna plugin which utilized the mask of the DAPI channel to quantify the signal in the DAPI and FM 1-43 channels for each detected particle. We defined the average of the mean particle intensity derived by DiAna from the background corrected images as Relative Fluorescence Units (RFU).

Thermostability of infectious EhV

To evaluate the thermal tolerance, we exposed EhV to various temperatures for various time intervals. Bioassay infectivity conditions were defined as at least a 2.5 log (corresponding to 300-fold) reduction of an E. huxleyi cell culture density by an EhV strain 86 (EhV-86) inoculum, four to eight days post-infection (Fig 1). Treating EhV-86 (0.8 x 10⁸ EhV particles as measured by flow cytometry, Supplementary Information Fig S1) with temperatures ranging from 4 °C to 60 °C for intervals of 0.5 to 5 min affirmed routine lab observations that EhV-86 remained infectious at 4 °C, 37 °C, and 40 °C (Fig 1, Supplementary Information Fig S4). As temperatures reached 45 °C and above, there was a decrease (p < 0.0001) in EhV-86 infectivity (Fig 1). Thermal treatments at 47 °C and 48 °C resulted in reduced infectivity after 120 (p < 0.0001) and 60 (p < 0.0001) seconds, which resulted in an average reduction of host cell densities of 1.32 log and 1.01 log, respectively. Temperatures of 50 °C and 60 °C were sufficient to abolish viral infection after 30 seconds (Fig 1).

Viability of EhV, ASFV and PRRSV at elevated temperatures

To further characterize the effect of high temperatures on EhV-86 particles, V-qPCR was used to elucidate the infection bioassay observations. We compared untreated infectious viruses (stored at 4 °C) and non-infectious viruses (treated at 60 °C and 100 °C for 20 min), with three concentrations of the viability dye PMAxx (25 µM, 100 µM and 125 µM, Supplementary Information Fig 2). We observed no difference (p=0.68) and less than a 0.03 log reduction in virus viability between the lowest and highest concentration of PMAxx for the 4 °C untreated samples. While differences were observed between the 25 µM and the two higher PMAxx concentrations (at 60 °C or 100 °C), the largest difference was observed in the log reductions from 4 °C to 100 °C (Fig 2). Less than one log reduction (0.60 – 0.72) was observed for 60°C despite the abolishment of infectivity as previously reported for temperatures greater than 45 °C in the bioassay experiment (Fig 1). Moreover, a 2.57-2.59 log reduction was observed for the 100 µM and 125 µM dyes used in the 100 °C treatment, suggesting that viable viruses remained post-treatment. These findings indicate that the virus capsid core remains intact but not infectious at temperatures greater than 60 °C when treated for 20 min. In addition, while minor differences in the log reduction values were observed across the broad range of PMAxx concentrations tested, the effect of temperature on EhV viability was captured irrespective of concentration used.

We also wanted to determine whether the PMAxx dye had any effect on the PCR chemistry, i.e., that we could recover the anticipated genome equivalent amounts based on the amount of virus particles tested. We found that the standard qPCR (S-qPCR) assay produced the expected virus genome copies for all the viruses when stored at 4 °C (Fig 3). We observed that even when EhV-86 was exposed to temperatures up to 80 °C for up to 20 min, no difference was found compared to the control (p >0.05) and less than a 0.25 log reduction in the number of total virus genomes occurred (Fig 3A). Temperatures greater than 90 °C resulted in a significant reduction (p <0.0001) of the number of genomes by an additional 0.43 log, with exposure to 100 °C resulting in a 1.37 log reduction of genomes (p <0.0001, Fig 3A). The use of V-qPCR, however, revealed a 0.88 log reduction (p <0.0001) in the number of viable virus particles after exposure to 80 °C (Fig 3B). The 90 °C treatment resulted in a 2.02 log reduction (p <0.0001) of the number of genomes, and a 3.40 log reduction at 100 °C (p <0.0001, Fig 3B).

Comparing the heat inactivation data obtained for EhV (Fig 3B) to that of ASFV (Fig 3C), as revealed by V-qPCR, showed a similar limited log reduction (no differences with the control sample, p >0.05) in ASFV viable particles when exposed to 60 °C and 80 °C for 20 min. Similarly, only at 100 °C was a greater than 2 log reduction (p <0.0001) in viable particles for both viruses observed. This thermal stability was not observed for PRRSV when treated at temperatures ranging from 60 °C to 100 ^oC for 20 min (Fig 3D). At 60 °C and 100 °C treatments, greater than 4 log (p <0.0001) and 5 log reductions (p <0.0001), respectively, were recorded (Fig 3D).

Modelling thermal inactivation kinetics

The Weibull model is a continuous probability distribution model applied over exposure time at different temperatures and was applied to report our V-qPCR for EhV inactivation results (Fig 4) because of the nonlinear or tailing phenomena observed in the EhV data (Fig 3A-B). The delta values (thermal resistance or time at certain temperatures to reduce 1 log of the initial virus concentration) for EhV-86 were 410.5, 14.5 and 0.02 min at 60 °C, 80 °C and 100 °C, respectively. The time required to reduce EhV-86 infectivity by 3 log was 541.7 h, 11.6 h, and 0.4 h at 60 °C, 80 °C, and 100 °C, respectively. In an effort to compare and contrast rates of EhV and ASFV inactivation, we applied the Weibull model to estimate the delta values from previously reported ASFV inactivation data based on the HAD₅₀ method [46]. The delta value for ASFV was calculated to be 4 min at 60 °C, with a 3 log reduction of ASFV requiring exposure to 60 °C for 11.4 min.

Further validation of V-qPCR

Confocal microscopy was used to confirm the structural integrity of the EhV particles after exposure to various temperatures and times because virus DNA can only be visualised if it is constrained by the virus membrane and/or capsid (Fig 5 and Supplementary Information Fig S5). We observed an average of 515 (SD = 44) particles per image (n = 3) for EhV-86 exposed to 4 °C, which corresponds to a virus concentration of 2.6 x 10⁸ EhV mL^-1 (Fig 5A), which was a concentration similar to the value obtained by flow cytometry (Supplementary Information Fig S1). After 20 min of exposure to temperatures of 60 °C, 80 °C, and 100 °C, the average number of DNA-containing particles recorded per image was 191 (SD= 20), 195 (SD = 44) and 180 (SD = 44), respectively, corresponding to a 0.43 log reduction in the number of viral particles relative to the 4 °C treatment (Fig 5C-E). Presence of genome-containing particles at 60 °C, 80 °C, and 100 °C was unexpected because the bioassays indicated a loss in virus infectivity when exposed to temperatures of 45 °C and above (Fig 1). However, the viability PCR indicated that this was not an accurate assessment (Fig 3B).

The mean ratio was 0.54 for fluorescence signals of DNA (stained by DAPI) and the lipid membrane (stained by FM 1-43) of EhV-86 particles at 4 °C. This ratio increased with increasing temperatures to 1.19 at 60 °C and peaked at 3.54 at 80 °C. The ratio was reduced to 1.58 when EhV-86 particles were exposed to 100 °C (Supplementary Information Fig S5). Like the DNA-to-lipid membrane signal ratio, the average DNA signal per virus particle (DAPI) also increased with increasing temperature from 153 Relative Fluorescence Units (RFU) at 4 °C, to 351 RFU at 60 °C, and 433 RFU at 80 °C. The DNA signal was reduced to 242 RFU at 100 °C but remained greater than that observed at 4 °C (Supplementary Information Fig S5, green line). The lipid membrane signal (FM 1-43) was similar at both 4 °C and 60 °C, measuring at 301 and 306 RFU, respectively. The lipid signal decreased at 80 °C and 100 °C to 128 and 161 RFU, respectively (Supplementary Information Fig S4, red line). From these results, we hypothesized that EhV-86 exposure to 80 °C resulted in most of the virions being damaged by loss of the outer membrane. Given that DAPI passes through viable cell membranes less efficiently compared with damaged cells [47], the loss of the outer membrane may have resulted in the DAPI stain penetrating the virion more efficiently, resulting in the higher DNA signal at all temperatures compared with the signal at 4 °C. These results suggest that the loss of the infectious state of the virus population (even at temperatures greater than 45 °C is not a function of the loss of virus genomes from the particles, but rather the damage to the outer membrane and the associated envelope complex. We speculate that increasing the temperature to 80 °C or 100 °C resulted in the loss of this outer membrane (i.e., loss in FM 1-43 signal). Most of the damaged particles had either a denatured capsid plus inner membrane or only the internal membrane to surround their genomes. This is supported by the increased DNA labelling efficiency observed at 80 °C. A loss in the DNA signal relative to 60 °C and 80 °C treatments were only observed when EhV-86 was exposed to 100 °C, indicating the likely beginning of virus DNA degradation.

Finally, flow cytometry revealed that the SYBR nucleic acid staining efficiency of EhV-86 increased with increasing temperatures (Fig 6) as previously observed with DAPI staining (Supplementary Information Fig S5). No discernible changes were observed in the particle properties as measured by side-scatter (SSC), which determines the light scatter at a ninety-degree angle relative to the laser (Fig 6). Even at 4 °C, the population of EhV-86 particles was not homogeneous (Fig 6A). When comparing flow cytometry plots of 4 °C and 60 °C, a discernible increase from 13,973 to 16,183 events per 30 µL, which corresponds to 0.47 x 10⁸ to 0.54 x 10⁸ EhV mL^-1, respectively, in the EhV-86 population was observed (Fig 6A-B, blue arrow). In addition, a new cluster of particles with a similar SSC appeared when viruses were exposed to 80 °C, which we characterized as damaged virions that still have DNA that can more efficiently be stained with SYBR (Fig 6C, red arrow). These damaged particles were also observed at 100 °C (Fig 6D, red arrow) but with reduced levels of the populations observed at 4 °C (Fig 6, blue and black arrows). In general, the extent of the particle degradation increased with increasing temperatures.

Given that growth of E. huxleyi is optimal below 25 °C, with an upper limit of 30 °C, it is interesting to note that EhV can remain infectious 10 °C above this upper limit. In addition, even under future climate change predictions of a sea surface temperature increase of up to 5.8 °C above current levels [48, 49], increased global temperatures will not negatively affect the ability of EhV-86, as a cell-free particle in the environment, to re-infect its bloom-forming host. This is an important observation as lytic viruses that infect microbes spend proportionally more time in the environment than inside their infected host. In addition, the thermal stability of the EhV particle itself, i.e., EhV-86 particles retain their genomes even after exposure to temperatures greater than 80 °C, was an unexpected result. As a result, there is a possibility that the particles with a disrupted outer membrane but with an intact capsid, inner membrane and genome could potentially infect E. huxleyi if acquired by phagocytosis or similar endolytic event [45, 50]. Based on the observed stability of genomes inside the damaged particles of EhV-86 and their potential role in infection, we propose that EhV is still viable after temperature exposure at 100 °C for 20 min. Future studies will be required to verify whether damaged but viable EhV can still be phagocytized by E. huxleyi and complete its lytic cycle to produce progeny. If this observation holds true and if we use the temperature stability data a proxy of general virion stability, it would explain why NCLDVs have been recovered after thousands of years from permafrost [51, 52] and in sediments [27].

With regards to ASFV, Plowright and Parker (1967) published one of the first studies to show that storing ASFV at 4 °C preserves infectivity, as determined by a cell culture-based method, of viraemic blood for at least 525 days. At 37 °C, culture medium containing ASFV remained infectious for 11 to 22 days, but at 60 °C it was only infectious for 30 min [46]. This observation was consistent with Montgomery’s 1921 report in which he found that ASFV was extremely resistant to high temperatures, putrefaction and desiccation [53]. As more recently reviewed by Fischer et al. (2020) indicated that many cell culture-based infection studies found that ASFV infectivity, in preserved or clotted pig blood, at 4 °C remained infective for as long as 548 days [54]. Similarly, in pig meat stored at 4 to 8 °C, infectious virus could be detected for up to 155 days [55]. Infected spleen samples stored in a refrigerator remained infectious for 204 days, but when buried in soil, it remained so for 280 days. Bone marrow (in boned meat) remained infectious for 180 to 188 days, skin and fat for 300 days, and offal for 105 days [55]. Fischer et al. (2020) also reported that when using standard PCR-based methods, ASFV genomic DNA was found in organs such as spleen, kidney and lung for up to 714 days when stored at −20 °C, 136 days at 4 °C and 17 days at 23 °C [56]. Furthermore, ASFV genomic DNA was even found to be stable in faeces with half-lives ranging from more than 730 days at temperatures up to 12 °C, and for about 15 days at temperature of 30 °C [57]. Finally, other studies that also used the cell culture-based ASFV methods confirmed Plowright and Parker’s (1967) observations that ASFV can be thermally inactivated at temperatures greater than 50 °C [58, 59]. However, our viability PCR provides a new understanding that the cell culture-based and standard PCR detection datasets do not provide [60]. The unexpected, enhanced stability of the ASFV DNA genome at 100 °C for 20 min can only be explained by the virus DNA core being protected as a result of the multi-layered protein capsid and envelope structure that surrounds it [61]. As previously described, these protective layers could also explain ASFV longevity as observed in blood, tissue, organs and even faeces.

The Weibull model estimates indicate that previous assumptions about the inactivation kinetics of ASFV need be re-evaluated, especially those based on HAD₅₀ determinations. Moreover, the endocytic pathway of macropinocytosis is constitutively active in macrophages and is a key route of entry for ASFV into host cells [62], as well as for other animal-like infecting NCLDVs [63]. Any risk assessment using inactivation kinetics data on NCLDVs should not only consider the infectious state as revealed by traditional infection experiments or bioassays, but should also consider the viable status of the NCLDV studied.

Other more common swine RNA viruses, such as Porcine epidemic diarrhea virus (PEDV) and PRRSV, are comparatively less resilient to time and temperature exposure than ASFV and EhV [64, 65]. The temperature viability PCR data for PRRSV observed in our study was similar to that observed by others based on infectivity cell cultured-based data [65]. These results are not surprising because PRRSV is reliant on surface-bound membrane glycoproteins, such as GP5-M and GP2-4, for infection [66]. Therefore, as is typically observed for enveloped viruses, neutralizing these surface virus proteins will render RNA viruses non-infectious [67]. In addition, the largely intact and potentially viable particles are unable to infect host cells because infection occurs solely through a receptor-mediated route.

Atypical routes of infection can occur as the genomes of some viruses, if acquired by injection, are able to infect and create new, fully functional virus progeny [68]. Such atypical infection routes of contagious DNA were previously confirmed for ASFV [69]. Although the hemadsorption (HAD₅₀) cell culture-based assay is commonly used to determine virus concentrations and evaluate ASFV infectivity [54]. This assay is reliant on the virus encoded CD2-like glycoprotein surface protein being present in the outer membrane of an ASFV-infected macrophage because it mediates hemadsorption [70]. This outer cell-derived membrane also becomes the outer envelope of the ASFV particle, giving the particle itself red blood cell or hemadsorption properties [71]. However, as shown for both EhV and ASFV, temperatures greater than 50 °C result in the virus particle remaining intact or viable even if the surface glycoprotein becomes denatured, which causes an inaccurate assessment using conventional cell culture-based assays. In the case of ASFV, these heat damaged ASFV particles may still be “infectious” because intact surface glycoproteins are not required for accidental phagocytosis [70]. In addition, Andrés (2017) proposed that non-receptor mediated micropinocytosis could be a key process enabling ASFV entry into host cells [72]. Even infectious cell culture-based methods (e.g., TCID₅₀or HAD₅₀) may be incapable of quantifying the true infectivity of ASFV, especially if Vero cells and not porcine-derived macrophages are used in these assays [73]. Therefore, the use of the V-PCR assay overcomes these shortcomings as it does not rely on the host cell to determine whether the virus has the potential to infect.

The thermal stability, based on viability PCR data, for both NCLDVs provides unprecedented new insight into the true resilience of NCLDVs in the environment. Furthermore, with the ongoing outbreaks of ASF across Europe and Asia, and more recently in the Dominican Republic, we must now consider a third scenario that ASFV persists stably in an altered but viable state in the environment, as well as in previously known reservoirs or alternate hosts provided by soft ticks and wild pigs [74]. Current mitigation or inactivation methods that rely solely on cell culture-based methods data to confirm ASFV inactivation will not account for the true viability and thus long-term infection potential of ASFV. Could this be why ASFV is not always eliminated or contained after applying time and temperature inactivation treatments in current decontamination or biosecurity protocols? Confirming a viable state for ASFV could have unprecedented implications for businesses directly or indirectly connected to the swine industry, including the global feed industry [60].

To our knowledge, here we show for the first time, how an enveloped virion anatomy is not an automatic weakness as often observed in other enveloped RNA virus systems (i.e., the viruses causing PRRS, COVID-19, Ebola, or seasonal influenza) [75]. In addition, EhV could be used as a safe surrogate for ASFV to evaluate inactivation kinetics in various feed ingredient matrices when subjected to thermal and chemical mitigation treatments. Given its similar stability profile to that of ASFV and that it also does not require a receptor-mediated mechanism for infection, EhV could serve as a surrogate in future viability-based experiments. We successfully used EhV in a transport study that confirmed previous modelling and lab-based data that ASFV can retain viability in swine feed matrices during long-term transport across the continental United States [76].

Ethics approval and consent to participate

Not applicable

Consent for publication

Not applicable

Availability of data and materials

Not applicable

Competing of Interest

The authors declare no competing interests.

Funding

This research was funded by United Soybean Board, contract numbers 1930-352-0516 and 2140-352-0510 (GCS, JLGvdL, DCS), the USDA NC229 (DCS) and University of Minnesota Imaging Centers SCR_02099 (GM).

Author contribution

These authors contributed equally to this work, CBS & DCS. Conceptualization of the overall study design, DCS, JLGvdL, PEU and GCS; Conceptualized the viability PCR experiments: DCS, HFY; methodology, DCS & CB; formal analysis, DCS & CB.; investigation, CB, FS, GM & AP; resources, DCS, JLGvdL, PEU, GCS; data curation, DCS.; writing—original draft preparation, DCS & CB.; writing—review and editing, all authors; supervision, DCS.; project administration, DCS & GCS.; funding acquisition, DCS, JLGvdL, PEU and GCS. All authors have read and agreed to the published version of the manuscript.

Acknowledgments

We would like to thank Dr Martinez-Martinez (Bigelow – Laboratory for Ocean Sciences, Maine, USA) and Drs Douglas Gladue & Manuel Borca (Plum Island Animal Disease Center, NY, US) for supplying us with EhV and ASFV, respectively. We also thank Christon Hurst, Pavel Plevka, Corina Buttner and Miroslav Homola for discussions and comments on the manuscript.

Colson P, De Lamballerie X, Yutin N, Asgari S, Bigot Y, Bideshi DK, Cheng XW, Federici BA, Van Etten JL, Koonin EV, et al: "Megavirales", a proposed new order for eukaryotic nucleocytoplasmic large DNA viruses. Arch Virol 2013, 158:2517-2521.
Guglielmini J, Woo AC, Krupovic M, Forterre P, Gaia M: Diversification of giant and large eukaryotic dsDNA viruses predated the origin of modern eukaryotes. Proceedings of the National Academy of Sciences 2019, 116:19585.
Koonin EV, Yutin N: Evolution of the large nucleocytoplasmic DNA viruses of eukaryotes and convergent origins of viral gigantism. Adv Virus Res 2019, 103:167-202.
McKeown DA, Stevens K, Peters AF, Bond P, Harper GM, Brownlee C, Brown MT, Schroeder DC: Phaeoviruses discovered in kelp (Laminariales). The ISME Journal 2017, 11:2869-2873.
Schroeder DC, Oke J, Malin G, Wilson WH: Coccolithovirus (Phycodnaviridae): characterisation of a new large dsDNA algal virus that infects Emiliana huxleyi. Arch Virol 2002, 147:1685-1698.
DeAngelis PL, Jing W, Graves MV, Burbank DE, Van Etten JL: Hyaluronan synthase of chlorella virus PBCV-1. Science 1997, 278:1800-1803.
Boyer M, Yutin N, Pagnier I, Barrassi L, Fournous G, Espinosa L, Robert C, Azza S, Sun S, Rossmann MG, et al: Giant Marseillevirus highlights the role of amoebae as a melting pot in emergence of chimeric microorganisms. Proceedings of the National Academy of Sciences 2009, 106:21848.
Scola BL, Audic S, Robert C, Jungang L, de Lamballerie X, Drancourt M, Birtles R, Claverie J-M, Raoult D: A giant virus in amoebae. Science 2003, 299:2033-2033.
Piégu B, Asgari S, Bideshi D, Federici BA, Bigot Y: Evolutionary relationships of iridoviruses and divergence of ascoviruses from invertebrate iridoviruses in the superfamily Megavirales. Molecular phylogenetics and evolution 2015, 84:44-52.
Subramaniam K, Behringer DC, Bojko J, Yutin N, Clark AS, Bateman KS, van Aerle R, Bass D, Kerr RC, Koonin EV, et al: A new family of DNA viruses causing disease in crustaceans from diverse aquatic biomes. mBio 2020, 11:e02938-02919.
Matsuyama T, Takano T, Nishiki I, Fujiwara A, Kiryu I, Inada M, Sakai T, Terashima S, Matsuura Y, Isowa K, Nakayasu C: A novel Asfarvirus-like virus identified as a potential cause of mass mortality of abalone. Scientific Reports 2020, 10:4620.
Miller D, Gray M, Storfer A: Ecopathology of ranaviruses infecting amphibians. Viruses 2011, 3:2351-2373.
Whittington RJ, Becker JA, Dennis MM: Iridovirus infections in finfish - critical review with emphasis on ranaviruses. J Fish Dis 2010, 33:95-122.
Marschang RE: Viruses infecting reptiles. Viruses 2011, 3:2087-2126.
Hiramatsu Y, Uno F, Yoshida M, Hatano Y, Nii S: Poxvirus virions: their surface ultrastructure and interaction with the surface membrane of host cells. Journal of Electron Microscopy 1999, 48:937-946.
Wang N, Zhao D, Wang J, Zhang Y, Wang M, Gao Y, Li F, Wang J, Bu Z, Rao Z, Wang X: Architecture of African swine fever virus and implications for viral assembly. Science 2019, 366:640-644.
Monier A, Pagarete A, de Vargas C, Allen MJ, Read B, Claverie JM, Ogata H: Horizontal gene transfer of an entire metabolic pathway between a eukaryotic alga and its DNA virus. Genome Res 2009, 19:1441-1449.
Wilson WH, Schroeder DC, Allen MJ, Holden MT, Parkhill J, Barrell BG, Churcher C, Hamlin N, Mungall K, Norbertczak H, et al: Complete genome sequence and lytic phase transcription profile of a Coccolithovirus. Science 2005, 309:1090-1092.
Bigot Y, Rabouille A, Doury G, Sizaret PY, Delbost F, Hamelin MH, Periquet G: Biological and molecular features of the relationships between Diadromus pulchellus ascovirus, a parasitoid hymenopteran wasp (Diadromus pulchellus) and its lepidopteran host, Acrolepiopsis assectella. J Gen Virol 1997, 78 ( Pt 5):1149-1163.
Kazanjian P: The Greatest Killer: Smallpox in History.: Donald R. Hopkins, 2002. Chicago, The University of Chicago Press. 80 pages, soft cover, plus illustrations. ISBN 0-226-35168-8. The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 2005, 72:108-108.
Qin QW, Lam TJ, Sin YM, Shen H, Chang SF, Ngoh GH, Chen CL: Electron microscopic observations of a marine fish iridovirus isolated from brown-spotted grouper, Epinephelus tauvina. Journal of Virological Methods 2001, 98:17-24.
Ge S, Li J, Fan X, Liu F, Li L, Wang Q, Ren W, Bao J, Liu C, Wang H, et al: Molecular characterization of African swine fever virus, China, 2018. Emerg Infect Dis 2018, 24:2131-2133.
Wolff HL, Croon JJ: The survival of smallpox virus (variola minor) in natural circumstances. Bulletin of the World Health Organization 1968, 38:492-493.
De Kock G, Robinson E, Keppel J: Swine fever in South Africa. 1940.
Legendre M, Bartoli J, Shmakova L, Jeudy S, Labadie K, Adrait A, Lescot M, Poirot O, Bertaux L, Bruley C, et al: Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology. Proceedings of the National Academy of Sciences 2014, 111:4274-4279.
Frada Miguel J, Schatz D, Farstey V, Ossolinski Justin E, Sabanay H, Ben-Dor S, Koren I, Vardi A: Zooplankton May Serve as Transmission Vectors for Viruses Infecting Algal Blooms in the Ocean. Current Biology 2014, 24:2592-2597.
Coolen MJL: 7000 years of Emiliania huxley viruses in the Black Sea. Science 2011, 333:451.
Paintsil E, Binka M, Patel A, Lindenbach BD, Heimer R: Hepatitis C Virus Maintains Infectivity for Weeks After Drying on Inanimate Surfaces at Room Temperature: Implications for Risks of Transmission. The Journal of Infectious Diseases 2013, 209:1205-1211.
Lei C, Yang J, Hu J, Sun X: On the Calculation of TCID(50) for Quantitation of Virus Infectivity. Virologica Sinica 2021, 36:141-144.
Biggs TEG, Huisman J, Brussaard CPD: Viral lysis modifies seasonal phytoplankton dynamics and carbon flow in the Southern Ocean. The ISME Journal 2021, 15:3615-3622.
Espinosa MF, Sancho AN, Mendoza LM, Mota CR, Verbyla ME: Systematic review and meta-analysis of time-temperature pathogen inactivation. International Journal of Hygiene and Environmental Health 2020, 230:113595.
Gómez-López VM, Jubinville E, Rodríguez-López MI, Trudel-Ferland M, Bouchard S, Jean J: Inactivation of Foodborne Viruses by UV Light: A Review. Foods (Basel, Switzerland) 2021, 10:3141.
Moreno L, Aznar R, Sánchez G: Application of viability PCR to discriminate the infectivity of hepatitis A virus in food samples. International Journal of Food Microbiology 2015, 201:1-6.
Elizaquível P, Aznar R, Sánchez G: Recent developments in the use of viability dyes and quantitative PCR in the food microbiology field. Journal of Applied Microbiology 2014, 116:1-13.
Nocker A, Sossa KE, Camper AK: Molecular monitoring of disinfection efficacy using propidium monoazide in combination with quantitative PCR. Journal of Microbiological Methods 2007, 70:252-260.
Puente H, Randazzo W, Falcó I, Carvajal A, Sánchez G: Rapid selective detection of potentially infectious porcine epidemic diarrhea coronavirus exposed to heat treatments using viability RT-qPCR. Frontiers in Microbiology 2020, 11:1911.
Shirasaki N, Matsushita T, Matsui Y, Koriki S: Suitability of pepper mild mottle virus as a human enteric virus surrogate for assessing the efficacy of thermal or free-chlorine disinfection processes by using infectivity assays and enhanced viability PCR. Water Research 2020, 186:116409.
Borca MV, Berggren KA, Ramirez-Medina E, Vuono EA, Gladue DP: CRISPR/Cas Gene Editing of a Large DNA Virus: African Swine Fever Virus. Bio-protocol 2018, 8:e2978.
Vuono EA, Ramirez-Medina E, Pruitt S, Rai A, Espinoza N, Spinard E, Valladares A, Silva E, Velazquez-Salinas L, Borca MV, Gladue DP: Deletion of the EP296R Gene from the Genome of Highly Virulent African Swine Fever Virus Georgia 2010 Does Not Affect Virus Replication or Virulence in Domestic Pigs. Viruses 2022, 14:1682.
Schroeder DC, Odogwu NM, Kevill J, Yang M, Krishna VD, Kikuti M, Pamornchainavakul N, Vilalta C, Sanhueza J, Corzo CA, et al: Phylogenetically Distinct Near-Complete Genome Sequences of Porcine Reproductive and Respiratory Syndrome Virus Type 2 Variants from Four Distinct Disease Outbreaks at U.S. Swine Farms over the Past 6 Years. Microbiology Resource Announcements 2021, 10:e00260-00221.
Schroeder DC, Oke J, Hall M, Malin G, Wilson WH: Virus succession observed during an Emiliania huxleyi bloom. Applied and Environmental Microbiology 2003, 69:2484-2490.
Stothard P: The sequence manipulation suite: JavaScript programs for analyzing and formatting protein and DNA sequences. Biotechniques 2000, 28:1102, 1104.
Geeraerd AH, Valdramidis VP, Van Impe JF: GInaFiT, a freeware tool to assess non-log-linear microbial survivor curves. International Journal of Food Microbiology 2005, 102:95-105.
Mafart P, Couvert O, Gaillard S, Leguerinel I: On calculating sterility in thermal preservation methods: application of the Weibull frequency distribution model. Int J Food Microbiol 2002, 72:107-113.
Mackinder LC, Worthy CA, Biggi G, Hall M, Ryan KP, Varsani A, Harper GM, Wilson WH, Brownlee C, Schroeder DC: A unicellular algal virus, Emiliania huxleyi virus 86, exploits an animal-like infection strategy. J Gen Virol 2009, 90:2306-2316.
Plowright W, Parker J: The stability of African swine fever virus with particular reference to heat and pH inactivation. Arch Gesamte Virusforsch 1967, 21:383-402.
Zink D, Sadoni N, Stelzer E: Visualizing chromatin and chromosomes in living cells. Methods 2003, 29:42-50.
Blanc-Mathieu R, Kaneko H, Endo H, Chaffron S, Hernández-Velázquez R, Nguyen CH, Mamitsuka H, Henry N, de Vargas C, Sullivan MB, et al: Viruses of the eukaryotic plankton are predicted to increase carbon export efficiency in the global sunlit ocean. bioRxiv 2019:710228.
Danovaro R, Corinaldesi C, Dell'Anno A, Fuhrman JA, Middelburg JJ, Noble RT, Suttle CA: Marine viruses and global climate change. FEMS Microbiology Reviews 2011, 35:993-1034.
Rokitta SD, de Nooijer LJ, Trimborn S, de Vargas C, Rost B, John U: Transcriptome analysis reveal differential gene expression patterns between the life-cycle stages of Emiliania huxleyi (Haptophyta) and reflect specialization to different ecological niches. J Phycol 2011, 47:829-838.
Gong Z, Zhang Y, Han G-Z: Molecular fossils reveal ancient associations of dsDNA viruses with several phyla of fungi. Virus Evolution 2020, 6.
Legendre M, Lartigue A, Bertaux L, Jeudy S, Bartoli J, Lescot M, Alempic J-M, Ramus C, Bruley C, Labadie K, et al: In-depth study of Mollivirus sibericum; a new 30,000-y-old giant virus infecting Acanthamoeba. Proceedings of the National Academy of Sciences 2015, 112:E5327.
Montgomery RE: On A Form of Swine Fever Occurring in British East Africa (Kenya Colony). Journal of Comparative Pathology and Therapeutics 1921, 34:159-191.
Fischer M, Hühr J, Blome S, Conraths FJ, Probst C: Stability of African swine fever virus in carcasses of domestic pigs and wild boar experimentally infected with the ASFV "Estonia 2014" isolate. Viruses 2020, 12.
EFSA PoAHW: Scientific opinion on African swine fever. EFSA Journal 2014, 12:3628.
Mazur-Panasiuk N, Woźniakowski G: Natural inactivation of African swine fever virus in tissues: Influence of temperature and environmental conditions on virus survival. Vet Microbiol 2020, 242:108609.
de Carvalho Ferreira HC, Weesendorp E, Quak S, Stegeman JA, Loeffen WLA: Suitability of faeces and tissue samples as a basis for non-invasive sampling for African swine fever in wild boar. Veterinary Microbiology 2014, 172:449-454.
Knight AI, Haines J, Zuber S: Thermal inactivation of animal virus pathogens. Current Topics in Virology 2013, 11:103-119.
Turner C, Williams SM: Laboratory-scale inactivation of African swine fever virus and swine vesicular disease virus in pig slurry. Journal of Applied Microbiology 1999, 87:148-157.
Shurson GC, Palowski A, van de Ligt JLG, Schroeder DC, Balestreri C, Urriola PE, Sampedro F: New perspectives for evaluating relative risks of African swine fever virus contamination in global feed ingredient supply chains. Transboundary and Emerging Diseases 2022, 69:31-56.
Andrés G, Charro D, Matamoros T, Dillard RS, Abrescia NGA: The cryo-EM structure of African swine fever virus unravels a unique architecture comprising two icosahedral protein capsids and two lipoprotein membranes. J Biol Chem 2020, 295:1-12.
Hernáez B, Guerra M, Salas ML, Andrés G: African swine fever virus undergoes outer envelope disruption, capsid disassembly and inner envelope fusion before core release from multivesicular endosomes. PLOS Pathogens 2016, 12:e1005595.
Chow A, Brown BD, Merad M: Studying the mononuclear phagocyte system in the molecular age. Nature Reviews Immunology 2011, 11:788-798.
Quist-Tybachuk GV, Kalmar I: Sensitivity of porcine epidemic diarrhea virus (PEDV) to pH and heat treatment in the presence or absence of porcine plasma. Veterinary Microbiology 2015, x.
Van Alstine W, Kanitz C, Stevenson G: Time and temperature survivability of PRRS virus in serum and tissues. Journal of Veterinary Diagnostic Investigation 1993, 5:621-622.
Kappes MA, Faaberg KS: PRRSV structure, replication and recombination: Origin of phenotype and genotype diversity. Virology 2015, 479-480:475-486.
Lopez OJ, Osorio FA: Role of neutralizing antibodies in PRRSV protective immunity. Veterinary Immunology and Immunopathology 2004, 102:155-163.
Herriott RM: Infectious Nucleic Acids, a New Dimension in Virology. Science 1961, 134:256-260.
Adldinger HK, Stone SS, Hess WR, Bachrach HL: Extraction of infectious Dexyribonucleic Acid from African swine fever virus. Virology 1966, 30:2.
Borca MV, O'Donnell V, Holinka LG, Risatti GR, Ramirez-Medina E, Vuono EA, Shi J, Pruitt S, Rai A, Silva E, et al: Deletion of CD2-like gene from the genome of African swine fever virus strain Georgia does not attenuate virulence in swine. Scientific reports 2020, 10:494-494.
Wardley RC, Wilkinson PJ: The association of African swine fever virus with blood components of infected pigs. Archives of Virology 1977, 55:327-334.
Andrés G: African Swine Fever Virus Gets Undressed: New Insights on the Entry Pathway. Journal of Virology 2017, 91:e01906-01916.
Alcamí A, Carrascosa AL, Viñuela E: The entry of African swine fever virus into Vero cells. Virology 1989, 171:68-75.
Frant M, Woźniakowski G, Pejsak Z: African swine fever (ASF) and ticks. No risk of tick-mediated ASF spread in Poland and Baltic States. Journal of veterinary research 2017, 61:375-380.
Lin Q, Lim JYC, Xue K, Yew PYM, Owh C, Chee PL, Loh XJ: Sanitizing agents for virus inactivation and disinfection. VIEW 2020, 1:e16.
Palowski A, Balestreri C, Urriola PE, van de Ligt JLG, Sampedro F, Dee S, Shah A, Yancy HF, Shurson GC, Schroeder DC: Survival of a surrogate African swine fever virus-like algal virus in feed matrices using a 23-day commercial United States truck transport model. Frontiers in Microbiology 2022, 13:1059118.

No competing interests reported.

SupplementaryInformationBalestreri012023.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Unexpected thermal stability of two enveloped megaviruses, Emiliania huxleyi virus and African swine fever virus, as measured by viability PCR

Status:

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1