Comparison of tumour tissue homogenisation methods: mortar and pestle versus ball mill

doi:10.21203/rs.3.rs-2510226/v1

Download PDF

Article

Comparison of tumour tissue homogenisation methods: mortar and pestle versus ball mill

https://doi.org/10.21203/rs.3.rs-2510226/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Efficient genetic material (DNA and RNA) and protein isolation are crucial for obtaining scientifically significant results in biotechnological analytical procedures. DNA mutations, gene expression determination on transcript and protein levels and high-throughput screening are core analyses in cancer studies. The most common tissue homogenisation methods include mortar and pestle usage. This study compares the classic pulverisation method with the nonconventional use of a ball mill.

Methods

The biological material constituted cancerous and unchanged adjacent tissues collected from five patients with head and neck squamous cell carcinoma (HNSCC). Tissues were halved for trituration using both homogenisation methods. The obtained material was used for DNA, RNA, and protein isolation and further PCR, RT-qPCR, and Western-blot analysis.

Results

After tissue homogenisation in a ball mill, we found significantly higher DNA concentration than mortar and pestle usage but no significant differences in RNA concentration and DNA and RNA purity ratios. However, the DNA quality assessed by gel electrophoresis and PCR was more excellent in samples ground with mortar and pestle. On the contrary, we demonstrated better RNA quality in ball-milled samples and gene expression analysis using RT-qPCR. We found no significant differences between protein concentration and quality extracted from tissues homogenised with the two compared methods.

Conclusion

Our results demonstrated that both methods of tissue homogenisation: ball mill versus mortar and pestle, are suitable for human tissue homogenisation to use the DNA and protein in downstream analysis. The ball mill homogenisation is more suitable for RNA extraction and gene expression analysis.

Biological sciences/Biological techniques

Biological sciences/Cancer

Biological sciences/Molecular biology

Health sciences/Medical research

Health sciences/Oncology

tissue homogenisation

mortar and pestle

ball mill

head and neck squamous cell carcinoma

Extracting high-quality genetic material from human tissue is crucial for various downstream applications, including standard laboratory procedures and high-throughput analysis. Proper homogenisation of tissue and obtaining high quality and quantity material is essential in high-throughput studies such as NGS and microarrays (1), as well as basic molecular biology techniques including PCR and Western blot (2). Maintenance of protein integration and lack of DNA and RNA degradation is a significant factor in homogenising clinical material, especially in cancer studies (2). Tissue material obtained after tumour resection is usually limited in size, and resampling is impossible, so homogenisation must be efficient and allow recovery of as much material as possible (3). Furthermore, tissues delivered from different solid tumours, including head and neck cancers, could be hard to grind, so the choice of an effective homogenisation method determines reliable results in the downstream analysis.

Conventional homogenisation methods include mechanical tissue grinding by mortar and pestle. The most common materials used to produce mortars are ceramic, porcelain, borosilicate glass or agate. Material is the key feature to consider when choosing mortar because they differ in durability, grind efficiency and laboratory applications (4). Researchers can grind frozen tissue to powder used for further genetic material and protein isolation with a mortar and pestle. The homogenisation process of the human tissue must be quick and effective so the mortar should be cooled throughout grinding with liquid nitrogen and tissue samples. To obtain the high quality and very finely ground powder, 5 to 10 minutes of grinding is required. Each time, the tissue is pulverised using a sterile mortar and pestle to avoid contamination. The advantages of this method are low price and no additional special equipment needed. Homogenisation with mortar and pestle could be carried out in every laboratory with access to liquid nitrogen, and it is easy to perform. The drawback of this method is difficulty with grinding hard tissues and the time of grinding, as well as potentially problematic material recovery from mortar and pestle pores (5). Another disadvantage is the possibility of contact by inhalation with the tissue powder that has fallen from the mortar. Moreover, using a mortar and pestle with the help of human hands does not often give repeatable results.

Ball mills have been successfully used in grinding matter for over 100 years (6). They are equipped with jars that serve as milling vessels. These vessels are then filled with reagents, and the milling balls work as grinding material. In standard laboratory practice, mixer mills are most often used. They are benchtop devices, ensuring high-energy collisions of balls thanks to the use of horizontally oscillating cylindrical vessels. Mixer mills allow for fast, effective, and high-energy grinding while maintaining the repeatability of results (7). Factors such as the nature of the material, parameters of the milling balls (size, mass, type of material), jars (volume, lining material), as well as milling time and frequency can affect the outcome of mechanical grinding (7). When milling material possesses waxy and sticky consistency, which prevents effective milling of substances, cryomilling (cryogenic grinding) is recommended. It is performed by submerging the milling vessels of a ball mill in liquid nitrogen (LN₂) bath or using cryomill(8). Ball milling (homogenisation) of organic tissue is an established method for various purposes. Plant (9), animal (10), and human (11) tissue can be effectively ball-milled, usually in cryogenic conditions. The comparison of the features of the ball mill and the mortar and pestle is depicted in Table 1.

Other methods of tissue homogenisation include mechanical disruption using a tissue blender or rotor-stator device and ultrasonication. Still, these methods are not suitable for cancerous, fresh tissue for further genetic material and protein extraction (12).

The aim of this study was to compare the effectiveness of tissue homogenisation methods: ball mill versus mortar and pestle by further genetic material and protein extraction and assess their usage in downstream procedures such as PCR, RT-qPCR, and Western-Blot.

Table 1

Comparison of tissue homogenisation methods.
Characteristic	Mortar and pestle	Ball mill
Special equipment	not needed	needed
Price	low	high
Time of grinding	5–10 minutes	1–2 minutes
Liquid nitrogen usage	high	high
Safety	low	high

2.1 Biological material

Primary tumour and pair-matched tissues from free margin were collected from five patients with head and neck squamous cell carcinoma (HNSCC) in oral cavity localisation, who underwent surgical tumour resection in the Department of Head and Neck Surgery, Poznan University of Medical Sciences, The Greater Poland Cancer Centre. The Local Ethical Committee of Poznan University of Medical Sciences approved the procedures.

2.2 Samples preparation

Samples were immediately snap-frozen in liquid nitrogen and stored at -80ºC until RNA, DNA, and protein isolation. Subsequently, HNSCC cancerous and adjacent tissues were weighed and split in half to compare two methods of homogenisation: grinding with mortar and pestle and using a ball mill. After homogenisation, the tissue powder was divided into three parts: DNA, RNA, and protein extraction. Because of the limited material recovery from both ball mill and mortar, we could not divide all samples into three parts.

2.3 Homogenisation with mortar and pestle

Preparation for the process of conventional homogenisation using mortar and pestle requires approximately ten minutes. The mortar and pestle should be stored at -80℃ before pulverisation. Sterile conditions are required when working with tissue material. Tissues are constantly stored in liquid nitrogen (LN2) during the homogenisation process and can be taken out using tweezers. Homogenisation of one sample takes up to five minutes. After pouring LN₂ into the mortar, tissue is added by removing it from the test tube using a scalpel. During rubbing and hitting the tissue, it is required to keep the temperature as low as possible by pouring extra portions of LN₂. The process is repeated until very finely-ground powder is obtained. Then, the material is portioned for further analysis of DNA, RNA, and protein. After division, the test tubes are stored at at least − 80℃. The working site must be disinfected, and paper and gloves replaced before the next sample pulverisation.

2.4 Homogenisation with ball mill

Tissue samples were ball-milled using a Retsch MM400 mixer mill. Samples were milled in cryogenic conditions using Retsch CryoKit for grinding with liquid nitrogen. Jars, filled with samples and milling balls, were submerged in LN₂ (until boiling ceased) and then transferred to the mill using metal tongs. Tissue samples were also frozen in LN₂ before inserting them in jars. Milling was performed in stainless steel (SS) jars (V = 5 mL; one SS milling ball, φ = 7 mm), washed with methanol immediately before use. Homogenisation was carried out simultaneously in two vessels. One grinding cycle lasted 1 min at an oscillation frequency of 30 Hz. After the grinding was completed, one milling jar was placed in liquid nitrogen to maintain the low temperature. The other jar was opened to check if the fine powder was obtained. In case of incomplete grinding, the milling was repeated. Some of the samples required 2–3 cycles to complete homogenisation. Completely ground samples were poured onto polystyrene weighing boats and divided using the SmartSpatula® into portions for further DNA, RNA, and protein analysis.

2.5 RNA and DNA Isolation

Total RNA from patients' tissues was isolated with 1 ml of TRIzol™ Reagent (Thermo Fisher, USA) using Direct-zol RNA Kit (Zymo Research, USA). The quality and quantity of RNA samples were determined by spectrometric measurement and gel electrophoresis. The absorbance ratio A260/A280 and A260/A230 was measured to assess the contamination with organic solvents and protein impurities. Genomic DNA from patients' tissues was extracted using DNA Mammalian Genomic Purification Kit from Sigma-Aldrich Co. (St. Louis, USA). The concentration and quality of the isolated DNA were assessed using spectrophotometric methods and gel electrophoresis.

2.6 Nucleic acid purity measurements

The quality and quantity of isolated RNA and DNA were assessed using spectrophotometric methods and gel electrophoresis. After homogenisation, the tissue powder was transferred to new tubes and treated with proper reagents to extract genetic material. The concentration and purity of DNA and RNA were determined by measuring absorbance in wavelengths: 230, 260 and 280 nm. The absorbance ratios 260/280 and 260/230 estimate the DNA and RNA purity. DNA is pure when the 260/280 ratio is approximately 1.8 and RNA is about 2(13). The lower values indicate protein contamination. The 260/230 ratio informs about EDTA, phenol or carbohydrates impurities and for the high-quality DNA and RNA should be between the 2.0-2.2 range.

2.7 Gel electrophoresis

Electrophoresis was performed in 2% agarose gel with the addition of the ethidium bromide in 1X TAE buffer to determine the quality of the isolated genetic material. RNA and DNA bands were visualised using UV light in the ChemiDoc™ Touch Imaging System (Bio-Rad, USA). The presence of bands corresponding to the 18S rRNA and 28S rRNA fractions and the lack of genomic DNA contamination indicate the high quality of the isolated RNA. The high molecular weight band corresponds to genomic DNA, and DNA degradation is visible as a smeared band. The gel electrophoresis was also used to assess the length and quality of the PCR products.

2.8 PCR amplification of genomic DNA

The KAPA HiFi HotStart ReadyMix (Roche, Switzerland) was used to perform PCR amplification of the XPC (Xeroderma Pigmentosum type C) gene using 100 ng of each DNA sample to assess the template efficiency of extracted DNA. Each 25 µl reaction contains 12,5 µl 2X KAPA HiFi HotStart Ready Mix, 10 µM of each primer and the appropriate amount of DNA template and PCR-grade water. The amplification started with an initial denaturation at 95℃ for 3 min, 35 cycles containing denaturation 95℃ for the 20s, annealing 60℃ for 15s and elongation at 72℃ for 30s, followed by final extension in 72℃ for 30s. The length and quality of the PCR product were depicted using gel electrophoresis. The primer sequence is listed in Table 2.

2.9 Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

RNA samples were reverse-transcribed into cDNA with RevertAid First Strand cDNA Synthesis Kit (ThermoFisher, USA) using 100 ng of total RNA.QPCR was carried out in CFX96 Real-Time System (Bio-Rad, USA) using the PowerTrack SYBR Green Master Mix (ThermoFisher, USA) and primers specific for GAPDH (Glyceraldehyde 3-phosphate dehydrogenase) reference gene. The reaction was performed in 3 technical repeats. The primer sequence is listed in Table 2.

Table 2

Primers sequences.
Primer	Sequence 5' − 3'	Method
GAPDH-R	ACCACCCTGTTGCTGTAGCC	RT-qPCR
GAPDH-F	GTCTCCTCTGACTTCAACAGC	RT-qPCR
XPC-R	CTGCCTCAGTTTGCCTTCTC	PCR
XPC-F	ACCAGCTCTCAAGCAGAAGC	PCR
R-reverse primer, F-forward primer

2.10 Protein extraction and western blot analysis

Protein isolation was performed in the 180 µl RIPA buffer with the addition of 20 µl protein inhibitors and quantified with BCA colourimetric assay. Samples were separated in SDS-PAGE using Mini-PROTEAN TGX precast gels (Bio-Rad, USA), followed by gel transfer into the PVDF membrane using Trans-Blot Turbo transfer packs (Bio-Rad, USA). The membrane was blocked with 5% milk in the TBST buffer. Immunodetection of β-actin was performed with anti-β-actin Ab (Merck Millipore, USA) followed by incubation in ECL Rabbit IgG, HRP-linked whole Ab (Cytiva Lifescience, USA) and β-tubulin with HRP-anti-β-tubulin (Abcam, UK). Bands were revealed using Clarity Western ECL Blotting Substrate (Bio-Rad, USA) and ChemiDoc™ Touch Imaging System (Bio-Rad, USA).

2.11 Statistical analysis

GraphPad Prism 9.0.1 was used for all the statistical analyses. Paired t-test or Wilcoxon test was used to compare differences between the two groups, depending on data distribution assessed by the Shapiro-Wilk test. The multiple, two-sample unpaired t-test with Welch correction was used to estimate the differences between Ct values. P ≤ 0.05 was considered to be significant.

3.1 Concentration and purity of isolated DNA, RNA, and protein

Tissues from HNSCC patients were divided in half and homogenised using a ball mill or mortar and pestle. After pulverisation, the tissue powder was portioned to extract the DNA, RNA, and protein. We used the same isolation methods of genetic material to sample homogenised using two compared methods to estimate the concentration and quality differences (Table 3, Table 4). As a result, no significant concentration differences exist between RNA obtained after milling the tissue in a ball mill or mortar. However, a positive bias towards higher concentrations using a ball mill is observed (Fig. 1). The DNA samples which were ball milled exhibit a significantly higher concentration (p = 0.0313) (Fig. 1). Furthermore, we assessed the protein concentration by BCA colourimetric method and found no significant differences between compared samples (Fig. 1, Table 5).

Table 3

Concentration (A) and purity (B) of RNA isolated after homogenisation in ball mill versus mortar and pestle.

A.
RNA	Concentration [ng/µl]
ID	Ball mill	Mortar and pestle
1	105.79	48.92
3	9.75	24.25
4	35.38	14.04
5	3.72	9.1
6	35.75	42.11
7	120.98	55.2


RNA	Purity
RNA	Ball mill		Mortar and pestle
ID	260/230	260/280	260/230	260/280
1	2.14	1.88	0.82	1.71
3	1.64	1.62	1.53	1.82
4	1.92	1.86	1.5	1.9
5	0.89	1.09	1.41	1.85
6	1.82	1.91	1.43	1.81
7	1.99	1.89	1.82	2.05

Table 4. Concentration (A) and purity (B) of DNA isolated after homogenisation in ball mill and mortar.

DNA	Concentration [ng/µl]
ID	Ball mill	Mortar and pestle
1	273.33	179.51
2	143.9	48.38
3	103.88	75.68
4	102.08	40.13
5	86.64	35.11
6	143.22	112.31


DNA	Purity
DNA	Ball mill		Mortar and pestle
ID	260/230	260/280	260/230	260/280
1	2.21	1.98	2.23	1.85
2	1.88	1.88	2.68	1.91
3	1.98	1.82	1.85	1.87
4	1.61	1.9	2.59	1.82
5	1.74	1.9	2.34	1.71
6	1.85	1.87	2	1.83

Table 5. Protein concentration after tissue homogenisation using ball mill and mortar.

Protein	Concentration [µg/ml]
ID	Ball mill	Mortar and pestle
1	1431.9	1563.9
2	1157.9	1086.9
3	864.9	664.9
4	1030.9	1075.9
8	1070.9	717.9
9	1085.9	1327.9

Next, we assessed the purity of DNA and RNA by absorbance measurements. Absorbance ratios 260/230 and 260/280 can determine the RNA and DNA samples contamination by organic solvents and proteins, respectively. We found no significant differences between genetic material purity ratios (Fig. 2) in DNA and RNA samples extracted from ball-milled or mortar-and-pestle ground tissues.

3.2 RNA analysis

Gel electrophoresis was performed to assess the extracted RNA quality. Ball-milled samples present visible bands of 28S and 18S rRNA. In contrast, in RNA samples obtained by the mortar and pestle method, the bands are less visible or invisible and present possible material degradation (Fig. 3).

We performed the RT-qPCR and estimated the Ct values for the GAPDH gene to assess the feasibility of isolated RNA for gene expression analyses. We choose 3 patients' tissues with RNA concentrations sufficient to perform reverse transcription. We found that in two out of three patients' tissues, there were significant differences in GAPDH Ct values (p = 0.000759 and p = 0.032854, respectively). The ball-milled samples demonstrated lower Ct values due to lower RNA degradation, resulting in more transcript products (Fig. 4).

3.3 DNA analysis

To determine the quality of DNA material, we performed gel electrophoresis. Samples obtained using mortar presented less degradation compared to the ball-milled samples. DNA samples prior to being pulverised using a ball mill and mortar demonstrated the high molecular weight band (Fig. 5).

We performed PCR using XPC gene primers to assess the DNA's utility in gene amplification. We found that samples ground in mortar and pestle showed denser and more homogeneous products than ball-milled samples. Gel electrophoresis was used to visualise the PCR product (Fig. 6).

3.4 Protein analysis

Western blot analysis was performed to assess the protein quality. The beta-actin and beta-tubulin housekeeping proteins are common references in protein analysis. We demonstrated that we detected the beta-actin in all samples but with a weaker signal in the fourth patient's prior ball-milled tissue. Beta-tubulin was detected in almost all patient's tissue except number one, where in tissue homogenised by mortar, we could not detect an unequivocal beta-tubulin signal (Fig. 7).

This study aimed to compare the genetic material (RNA and DNA) and protein quality and quantity after homogenisation using two methods: ball mill versus mortar and pestle, commonly used to grind human tissues to apply the material in different molecular analyses. The effective homogenisation of human tissue impacts all downstream analyses and is necessary to obtain reliable results. The biological samples from tumour and free margin tissues are limited, so the pulverisation should allow recovery of as much material as possible. In addition to the quantity of homogenised material, its quality is also an essential feature. Our study isolated RNA, DNA and protein from HNSCC patients' tissues with tumours localised in the oral cavity. HNSCCs are solid tumours characterised by high heterogeneity and tissue hardness (14). These factors have a significant influence on the tissue homogenisation process. A properly selected tissue homogenisation method is essential when working with postoperative tissue material because resampling is impossible.

Tissue homogenisation using a ball mill and mortar and pestle requires different amounts of grinding time and performer experience. Tissue milling in a ball mill lasts approximately 2 minutes and 5 to 10 minutes using mortar and pestle. Liquid nitrogen usage is similar in both methods. The price varies on the ball mill type, but mortars and pestles are generally less expensive and could be sterilised. The time of grinding depends on tissue type. For cartilage homogenisation, which is harder than HNSCC tissues, it takes approximately 25 minutes by mortar and pestle (15) and for frozen biopsies, 5 to 10 minutes per sample (16).

Here, we investigated the influence of homogenisation methods on the quality and quantity of isolated DNA, RNA, and protein from cancerous and paired-matched tissues from the free margin. Isolated materials were used in different molecular applications and cancer studies. We found that DNA concentration reveals significant differences between the two compared homogenisation methods, and ball-milled samples have higher concentrations than samples ground in a mortar. After gel electrophoresis, the DNA was observed as a single, high molecular weight DNA band, but the samples homogenised in mortar were less degraded, which indicates better quality. Jordan R. Stark et al. compared 3 methods of plant tissue homogenisation for further DNA extraction. They demonstrated that only liquid nitrogen grinding with mortar and pestle results in high-molecular‐weight (HMW) DNA extraction (17). We performed amplification using a PCR reaction to assess the DNA suitability in the downstream application. We choose the XPC gene, whose protein product is part of the DNA damage recognition and repair complex responsible for initiating global-genomic nucleotide excision repair (GG-NER) (18). The gel electrophoresis reveals positive XPC amplification in samples from both homogenisation methods, but the bands from "mortar" samples are denser and more homogeneous. DNA's high molecular weight and quality are essential for library preparation of next-generation sequencing (NGS) (19).

RNA quality is crucial to obtain reliable results from gene expression analysis. Non-degraded, high-quality RNA is necessary for various applications, especially in diagnostics and cancer research (20). In our study, we found no significant differences between concentrations from samples homogenised using two compared methods. Even though the gel electrophoresis reveals the better quality of ball-milled samples. The visible bands correspond to 28S and 18S rRNA, and the lack of degradation indicates high-quality RNA. Because of the low stability of RNA samples, we detected degradation in a few samples, so we decided to analyse the influence of RNA degradation on gene expression results from RT-qPCR reaction. We speculate that less RNA degradation in ball-milled samples could result from faster grinding time than using mortar and pestle. We used the GAPDH (glyceraldehyde 3-phosphate dehydrogenase) reference gene due to its reliability for quantitative gene expression analysis (21). Degraded RNA may have a lower number of intact amplicons, so it causes a decrease in molecule availability for amplification and higher Ct values in RT-qPCR reaction (22). Our results demonstrate that in samples homogenised using a ball mill, the Ct values for GAPDH gene were significantly lower than those ground using mortar and pestle. We showed that tissue homogenisation in a ball mill is more suitable for further RNA extraction and gene expression analysis than grinding using mortar and pestle.

Our measurements reveal no significant differences between the means of RNA purity absorbance ratio: 260/230 and 260/280. However, in two compared homogenisation methods, we did not reach the standard purity values of RNA. Our results also indicate no significant differences between the mean of DNA purity absorbance ratios. However, we found that samples homogenised using mortar showed a higher 260/230 ratio and reached the standard value of DNA purity, indicating fewer organic impurities in these samples. However, the 260/280 ratio is higher in samples homogenised using a ball mill, demonstrating less protein contamination. In both methods, the 260/280 ratio value indicates pure DNA (> 1,8). We suggest choosing a tissue homogenisation process for DNA isolation suitable for further analysis, bearing in mind what impurities can lead to the inhibition of downstream enzymatic reactions like PCR (23).

The proper homogenisation method preserves the protein integrity, which is important in downstream analyses. The traditional method of frozen tissue homogenisation using a mini homogeniser in EB buffer extracts most of the clock proteins from mammalian tissues (24). Shiying Shao et al. discovered the PCT-MicroPestle tissue homogeniser used in protein extraction from biopsy samples and significantly increased sample throughput and method reproducibility (25). Cryomill is a proven novel protein isolation method to obtain native protein concentration up to the point of extraction (26). Here, we choose beta-actin and beta-tubulin housekeeping proteins to assess the isolated protein quality from different homogenisation methods (27), (28). The integrity and stability of isolated proteins are essential in translational research. We do not observe significant differences in all samples in beta-actin and beta-tubulin quality between the two homogenisation methods and in protein concentration. These results indicate that the two compared methods are equally suitable for tissue grinding to isolate proteins.

Our results indicate that for DNA and protein extraction, both methods of cancer tissue homogenisation are suitable, so the price, time of grinding, and material purity could be decisive factors. For RNA extraction and further gene expression analysis, the ball mill is a more proper method of cancer tissue homogenisation because of better quality and less RNA degradation. Our study cohort is limited, so we believe that similar studies on larger groups should be performed in the future, and different solid tumor tissues should be tested because of their heterogeneity and different susceptibility to homogenisation.

HNSCC

Head and Neck Squamous Cell Carcinoma

PCR

Polymerase Chain Reaction

RT-qPCR

Reverse transcription quantitative real-time PCR

LN₂

liquid nitrogen

GAPDH

Glyceraldehyde 3-phosphate dehydrogenase

XPC

eroderma pigmentosum type C

Acknowledgments

Not applicable.

Data availability statement

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Funding

Not applicable.

Author information

Contributions

JO, KO, DF designed the experiments; JO, BM, KO, BK, NP performed the experiments; KO and JO analyzed the data; JO, KO, BM, BK, NP, DF prepare the manuscript; WS, WG, MF, DF supervised the work; The author(s) read and approved the final manuscript.

Corresponding Author

Correspondence to Julia Ostapowicz ([email protected])

Ethic declarations

The procedures were approved by the Local Ethical Committee of Poznan University of Medical Sciences (protocol code 452/20, date of approval 17.06.2020). All methods were carried out in accordance with relevant guidelines and regulations and informed consent was obtained from all subjects and/or their legal guardian(s).

Consent for publication

Not applicable.

Competing interests

The authors declare no conflicts of interest.

Diaz E, Barisone GA. DNA Microarrays: Sample Quality Control, Array Hybridization and Scanning. J Vis Exp. 2011 Mar 15;(49):2546.
Hahn J, Moritz M, Voß H, Pelczar P, Huber S, Schlüter H. Tissue Sampling and Homogenization in the Sub-Microliter Scale with a Nanosecond Infrared Laser (NIRL) for Mass Spectrometric Proteomics. Int J Mol Sci. 2021 Oct 7;22(19):10833.
Restivo G, Tastanova A, Balázs Z, Panebianco F, Diepenbruck M, Ercan C, et al. Live slow-frozen human tumor tissues viable for 2D, 3D, ex vivo cultures and single-cell RNAseq. Commun Biol. 2022 Oct 28;5(1):1–12.
Mortars and Pestles | Fisher Scientific https:// (2023). Accessed 7 Jan 2023
A. Zelentsova E, V. Yanshole V, P. Tsentalovich Y. A novel method of sample homogenisation with the use of a microtome-cryostat apparatus. RSC Advances. 2019;9(65):37809–17.
Lynch AJ, Rowland CA. The history of grinding. Littleton, Colo.: Society for Mining, Metallurgy, and Exploration; 2005, 209 p. http://public.eblib.com/choice/publicfullrecord.aspx?p=464593 (2023). Accessed 5 Jan 2023
Rightmire NR, Hanusa TP. Advances in organometallic synthesis with mechanochemical methods. Dalton Trans. 2016 Feb 5;45(6):2352–62.
Zeisler R, Greenberg RR. Determinations of subnanomole elemental levels by NAA and their possible impact on human health related issues. Biol Trace Elem Res. 1999 Dec 1;71(1):283–9.
Allen GC, Flores-Vergara MA, Krasynanski S, Kumar S, Thompson WF. A modified protocol for rapid DNA isolation from plant tissues using cetyltrimethylammonium bromide. Nat Protoc. 2006 Dec;1(5):2320–5.
Geier FM, Want EJ, Leroi AM, Bundy JG. Cross-platform comparison of Caenorhabditis elegans tissue extraction strategies for comprehensive metabolome coverage. Anal Chem. 2011 May 15;83(10):3730–6.
Schmitt M, Sturmheit AS, Welk A, Schnelldorfer C, Harbeck N. Procedures for the Quantitative Protein Determination of Urokinase and Its Inhibitor, PAI-1, in Human Breast Cancer Tissue Extracts by ELISA. Methods Biol. Mol.; 2006 p. 245–65.
Smith KM, Xu Y. Tissue sample preparation in bioanalytical assays. Bioanalysis. 2012 Mar;4(6):741–9.
Lucena-Aguilar G, Sánchez-López AM, Barberán-Aceituno C, Carrillo-Ávila JA, López-Guerrero JA, Aguilar-Quesada R. DNA Source Selection for Downstream Applications Based on DNA Quality Indicators Analysis. Biopreserv Biobank. 2016 Aug 1;14(4):264–70.
Canning M, Guo G, Yu M, Myint C, Groves MW, Byrd JK, et al. Heterogeneity of the Head and Neck Squamous Cell Carcinoma Immune Landscape and Its Impact on Immunotherapy. Front Cell Dev Biol. 2019;7:52.
Ivanov AA, Leonova ON, Wiebe DS, Krutko AV, Gridina MM, Fishman VS, et al. Method for the Isolation of "RNA-seq-Quality" RNA from Human Intervertebral Discs after Mortar and Pestle Homogenization. Cells. 2022 Jan;11(22):3578.
PREC-026-DU137-DNA-extraction-comparison-minilys-vs.-manual-method.pdf https://www.bertin-technologies.com/wp-content/uploads/secured-pdf/PREC-026-DU137-DNA-extraction-comparison-minilys-vs.-manual-method.pdf (2023). Accessed 10 Jan 2023
Stark JR, Cardon ZG, Peredo EL. Extraction of high-quality, high‐molecular‐weight DNA depends heavily on cell homogenisation methods in green microalgae. Appl Plant Sci. 2020 Mar 10;8(3):e11333.
Nasrallah NA, Wiese BM, Sears CR. Xeroderma Pigmentosum Complementation Group C (XPC): Emerging Roles in Non-Dermatologic Malignancies. Front Oncol. 2022 Apr 21;12:846965.
Furtado A. DNA extraction from vegetative tissue for next-generation sequencing. Methods Mol Biol. 2014;1099:1–5.
Vermeulen J, De Preter K, Lefever S, Nuytens J, De Vloed F, Derveaux S, et al. Measurable impact of RNA quality on gene expression results from quantitative PCR. Nucleic Acids Res. 2011 May;39(9):e63.
Zainuddin A, Chua KH, Rahim NA, Makpol S. Effect of experimental treatment on GAPDH mRNA expression as a housekeeping gene in human diploid fibroblasts. BMC Mol Biol. 2010 Aug 14;11:59.
Antonov J, Goldstein DR, Oberli A, Baltzer A, Pirotta M, Fleischmann A, et al. Reliable gene expression measurements from degraded RNA by quantitative real-time PCR depend on short amplicons and a proper normalisation. Lab Invest. 2005 Aug;85(8):1040–50.
Schrader C, Schielke A, Ellerbroek L, Johne R. PCR inhibitors – occurrence, properties and removal. Journal of Applied Microbiology. 2012;113(5):1014–26.
Lee C. Protein extraction from mammalian tissues. Methods Mol Biol. 2007;362:385–9.
Shao S, Guo T, Gross V, Lazarev A, Koh CC, Gillessen S, et al. Reproducible Tissue Homogenisation and Protein Extraction for Quantitative Proteomics Using MicroPestle-Assisted Pressure-Cycling Technology. J Proteome Res. 2016 Jun 3;15(6):1821–9.
LaCava J, Jiang H, Rout MP. Protein Complex Affinity Capture from Cryomilled Mammalian Cells. J Vis Exp. 2016 Dec 9;(118):54518.
Gu Y, Tang S, Wang Z, Cai L, Lian H, Shen Y, et al. A pan-cancer analysis of the prognostic and immunological role of β-actin (ACTB) in human cancers. Bioengineered. 12(1):6166–85.
Vesely ED, Heilig CW, Brosius FC. GLUT1-induced cFLIP expression promotes proliferation and prevents apoptosis in vascular smooth muscle cells. Am J Physiol Cell Physiol. 2009 Sep;297(3):C759–65.

No competing interests reported.

AdditionalFile1.pdf

Download PDF

Version 1

posted

You are reading this latest preprint version

Comparison of tumour tissue homogenisation methods: mortar and pestle versus ball mill

Status:

Version 1

Abstract

Figures

1. Background

2. Materials And Methods

2.1 Biological material

2.2 Samples preparation

2.3 Homogenisation with mortar and pestle

2.4 Homogenisation with ball mill

2.5 RNA and DNA Isolation

2.6 Nucleic acid purity measurements

2.7 Gel electrophoresis

2.8 PCR amplification of genomic DNA

2.9 Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)

2.10 Protein extraction and western blot analysis

3. Results

3.1 Concentration and purity of isolated DNA, RNA, and protein

3.2 RNA analysis

3.3 DNA analysis

3.4 Protein analysis

4. Discussion

5. Conclusions

Abbreviations

Declarations

Consent for publication

Competing interests

References

Additional Declarations

Supplementary Files

Status:

Version 1