MiR-183-5p Promotes Migration and Invasion of Prostate Cancer by Targeting TET1

doi:10.21203/rs.3.rs-2522857/v1

Download PDF

Research Article

MiR-183-5p Promotes Migration and Invasion of Prostate Cancer by Targeting TET1

https://doi.org/10.21203/rs.3.rs-2522857/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 09 Jul, 2023

Read the published version in BMC Urology →

You are reading this latest preprint version

Background: Prostate cancer (PCa) is one of the common malignant tumors and it is difficult to diagnose at its early stage. MiR-183-5p has been reported involved in the proliferation of human PCa, this study aimed to investigate how miR-183-5p affects the migration and invasion of prostate cancer.

Methods: In this study, we analyzed the expression of miR-183-5p in PCa patients and its correlation with clinicopathological parameters based on TCGA data portal. CCK-8, migration assay and invasion and wound-healing assay were performed to detect proliferation, migration and invasion in PCa cells.

Results:We found the expression of miR-183-5p was significantly increased in PCa tissues, and high expression of miR-183 was positively associated with poor prognosis of PCa patients. Over-expression of miR-183-5p promoted the migration, invasion capacities of PCa cells, whereas knockdown of miR-183-5p showed reversed function. Furthermore, luciferase reporter assay showed TET1 was identified as a direct target of miR-183-5p, which was negatively correlation with miR-183-5p expression level. Importantly, rescue experiments demonstrated TET1 over-expression could reverse miR-183-5p mimic induced-acceleration of PCa malignant progression.

Conclusion:Our results indicated that miR-183-5p could act as a tumor promoter in PCa and it accelerated the malignant progression of PCa by directly targeting and down-regulating TET1.

Prostatic cancer

miR-183-5p

Migration

Invasion

Prostate cancer (PCa), as one of the most prevalent cancers among males, is the leading cause of cancer mortality worldwide[1]. Although PCa usually evolves slowly during the early stages, metastatic progression severely worsens patient prognosis and leads to death[2]. Despite the great progress in treatment efficiency, metastatic PCs remains largely incurable[3]. Thus, in-depth understanding of the mechanism of metastatic PCa will help us intervene and treat of PCa patients better. Previous studies have confirmed that the malignant progress of PCa is a multi-step and multi-stage progress, which is involved with the dysregulation of multiple molecules, including miRNAs[4–6].

MicroRNAs (miRNAs) are a kind of non-coding RNAs with 22–25 nucleotides encoded by endogenous genes. They control gene expression by binding to the 3'-untranslated region (UTR) of target genes, resulting in mRNAs degradation or translational inhibition. MiRNAs have been reported involving in the initiation and progression of PCa, such as miR-222[7, 8], miR-141[9, 10], miR-145 and miR-148[11, 12]. MiR-183-5p is a recently discovered cancer-related miRNA, which has been confirmed to be an oncogenic role in PCa[13–16]. Studies reported that the expression of miR-183-5p in prostate biopsy was correlated with tumor status and prognosis[17, 18], and the inhibition of miR-183 reduces cell proliferation and migration of PCa[19]. Moreover, miRNA-183 expression could also reduce tumor cell adhesion of PCa[20]. Furthermore, miR-183 positively regulated the level of prostate-specific antigen (PSA) in serum and it might be used as a prognostic marker of diagnosis progression of PCa[13, 21, 22]. Similarly, in our previous experiments, we found the expression of miR-183-5p was up-regulated in PCa tissues.

Ten-eleven-translocation enzymes (TETs) including TET1, TET2 and TET3, which could catalyze the oxidation of 5-methylcytosine (5mC) to 5-hydroxymetylcytosine (5hmC), participate a critical step in epigenetic reprogramming[23]. It has been proved that TET1 acts as a tumor suppressor gene, associated with multiple malignancies such as gastric, lung, breast cancer[24–26]. Moreover, recent studies have revealed that TET1 mediates DNA hydroxymethylation and downregulates epithelial-mesenchymal transition (EMT) in pancreatic and cervical carcer[27, 28]. All these results suggest that TET1 may involve in tumor aggressive growth and metastasis.

In our study, we hypothesize that miR-183-5p could promote migration and invasion of PCa by regulating the target gene TET1, thereby exacerbating the process of PCa.

PCa tissues samples

A total of 12 prostate cancer tissues and their paired adjacent tissues were collected from patients undergoing the radical prostatectomy at the Third Affiliated Hospital of SooChow University from Jun 2019 to Dec 2019. Patients enrolled in this study received no preoperative radiotherapy and/or chemotherapy. Each tissue was snap-frozen immediately in liquid nitrogen after excision, and stored at -80ºC until use.

Bioinformatic analyses

Gene expression and clinicopathological features of patients with prostate cancer in PRAD-TCGA were downloaded from UCSC Xena Cancer browser (https://xenabrowser.net). Microarray datasets (GSE21036 and GSE64318) containing miR-183-5p expression profiles of prostate biopsy samples (52 cancer tissues and 52 adjacent tissues) were downloaded from Gene Expression Omnibus (GEO) (https://www.ncbi.nlm.nih.gov/gds/). SPSS17.0 (Chicago, IL, USA) and GraphPad Prism 5.0 (San Diego, CA, USA) software was used for the statistical analysis. Moreover, TargetScan, miRDB, miRWalk and StarBase were used to predict miR-183-5p target genes.

Cell lines and transfection

Human PCa cell lines, including androgen-dependent LNCaP and androgen-independent PC-3, were obtained from the Cell Bank of the Committee on Type Culture Collection of the Chinese Academy of Sciences. Cells were cultured in F12K or RPMI-1640 medium (Gibco, Carlsbad, CA) containing 10% fetal bovine serum (BI, Israel) at 37ºC with 5% CO₂.

MiR-183-5p mimics, mimics negative control (miR-NC), miR-183-5p inhibitor and inhibitor NC were purchased from GenePharma (GenePharma, Shanghai, China). Cells were seeded in 6-well plates and grown to a density of 40–60%, then transfection was performed using Lipofectamine 2000 (Invitrogen, CA, USA) according to the manufacturer’s instructions, respectively. And these cells were harvested for verification of transfection efficacy after 48h.

CCK-8 assay

Cells were seeded in a 96-well plate at a density of 1×10⁴ cells/well, and culture medium was used as a blank control. CCK-8 was added to each well (six replicate wells per group) at the indicated time points (10 µl/well), and the absorbance at 450 nm was measured 2 h later to estimate viable cells using an automatic plate reader.

Cell migration and invasion assay

A transwell chamber with an 8-µm pore size polycarbonate membrane (Corning, NY) was used to evaluate cell migration. After 48h of transfection, the PCa cells were resuspended with basic medium and seeded into the upper chamber (2×10⁴ for PC-3 cells and 5×10⁴ for LNCaP cells), while culture medium containing 15% FBS was added to the lower chamber. After incubation for 48 h at 37°C, the medium was removed from the upper chamber, and non-migrated cells were scraped off with a cotton swab. The migrated cells on the other side of the membrane were fixed in 4% paraformaldehyde for 30 min, stained with crystal violet for 15 min, and counted under an inverted microscope at 200x magnification in at least three randomly selected fields.

In the invasion assay, the upper chamber was pre-coated with 10% Matrigel (BD Biosciences, San Jose, CA, United States) and the procedures of the cell invasion assay were identical to the cell migration assay.

Wound healing assay

Transfected cells were plated into 6-well plates and grown to 90% confluence. A 10 µl sterile pipette tip was used to create a scratch wound across cell monolayer, then detached cells and debris were removed by PBS, and the attached cells were incubated in the medium with 1% FBS. Images of the wound closure was captured at 0 h and 48 h using the microscope.

Luciferase reporter assay

To verify whether miR-183-5p directly binds to the 3’UTR of TET1, luciferase reporter assay was performed. MiR-183-5p mimics or mimics negative control (NC) were transfected into HEK293T cells together with TET1 (wild type (WT) or mutant (MUT)) using lipofectamine 2000 (Invitrogen), respectively. The relative luciferase activities were measured using a detection kit (Promega Corp, USA) after 48 h, according to the manufacturer’s instructions.

Western blot analysis

The cells were harvested and lysed using protein RIPA buffer (Beyotime, Shanghai, China) supplemented with protease inhibitor and phosphatase inhibitor (Thermo Fisher Scientific, USA). The protein concentration was determined by the BCA protein assay kit (Beyotime, Shanghai, China). Samples were mixed with SDS-PAGE loading buffer (Beyotime, Shanghai, China) and separated by 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). After transferring onto polyvinylidene difluoride (PVDF) membranes (Merck Millipore, Billerica, MA, USA), the membranes were blocked with 5% skim milk in TBST at room temperature for 1 h, and then incubated with anti-TET1(MA5-16312, 1:1000 dilution, Thermo Fisher Scientific) or anti-β-actin (ARG65683, 1:1000 dilution, Arigo) antibodies for 2 h, followed by incubation with horseradish peroxidase-conjugated goat anti-rabbit IgG for 1 h. Protein bands were visualized by an ECL + Plus western blotting detection system (CW Biotech, Beijing, China) and quantified using a scanner with Quantity One software (Version 4.2.1, Bio-Rad Laboratories, Hercules, CA, USA).

Total RNA extraction and real-time PCR (qRT‐PCR)

Total RNA was extracted from PCa cell lines and clinical tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed into cDNA using the RevertAid™ first strand cDNA synthesis kit (Thermo Fisher Scientific, USA). The obtained cDNA was subjected to qRT-PCR by performing on a LightCycler480®II in a final volume of 25 µL. Optimum reaction conditions were obtained with 0.04 µL of 100 µM of each primer and probe, 2.5 µL of 10× PCR buffer, 2.5 µL of 25 mM MgCl₂, 0.5 µL of 10 mM 4× dNTPs, 0.25 µL of 5 U/µL Taq DNA polymerase, and 2 µL template cDNA. Finally, 17.13 µL ddH₂O was added to the reaction mixture. The mixture was preheated at 95ºC for 3 min to activate Taq polymerase, followed by 40 cycles at 95ºC for 5 s and 60ºC for 15 s. Samples were amplified simultaneously in triplicate in one assay run. Data were normalized to GAPDH or U6. Sequences of primers and probes are summarized in Table 1.

Table 1

Sequences of primers and probes for real-time RT-PCR
Gene	Primer / Probe	Sequence (5’ to 3’)
miR-183-5p	Forward	CCTGTTCTGTGTATGGCACTGGT
miR-183-5p	Reverse	TTCACTGACTGAGACTGTTCACAGTG
Human TET1	Forward	CCATCTGTTGTTGTGCCTCTG
	Reverse	GCCATTTACTGGTTTGTTGTCA
	Probe	FAM-AGGTTATAAAGGAAAACAAGAGGCCCC-BHQ-1
Human GAPDH	Forward	CAACTACATGGTTTACATGTTC
	Reverse	GCCAGTGGACTCCACGAC
	Probe	CY5-TTTGGTCGTATTGGGCGCCTG-BHQ-1

Statistically analysis

Data were presented as mean ± S.E.M., and GraphPad Prism (version 5.0) was used for data analyses.

The paired Student’s t-tests were performed to compare two related samples, while the unpaired Student’s t-tests were used to compare differences between different groups. A one-way ANOVA test was conducted to compare the intergroup difference more than two groups. Kaplan– Meier curves were introduced for survival analysis. P value less than 0.05 was considered as statistically significant.

Up-regulated expression of miR-183-5p in PCa tissues

To investigate the expression level of miR-183-5p in PCa, we collected miRNA expression profiles of PCa patients from the TCGA and GEO database. We found that the expression of miR-183 was significantly increased in PCa tissues (Fig. 1). Data from microarray datasets (GSE21036 and GSE64318) showed miR-183 expression was remarkably upregulated in PCa tissues compared to that in adjacent tissues (Fig. 1A, B), these differences were consistent with the results obtained from TCGA(Fig. 1C). To further validate the miR-183-5p expression level in PCa tissues, we examined the expression in 12 pairs clinical specimens of prostate cancer by qRT-PCR. The results showed that miR-183-5p was highly expressed in PCa tissues, which was consistent with the above (Fig. 1D). In addition, Kaplan-Meier analysis showed that PCa patients with high miR-183 expression had shorter recurrence-free survival than those with low miR-183 expression (Fig. 1E). Therefore, all the above indicate that miR-183-5p may serve an important role in the development and progression of PCa.

MiR-183-5p mimic transfection promotes migration and invasion of PCa cell lines

To study the biological function of miR-183-5p in PCa cell lines, overexpression or inhibition of miR-183-5p was transfected into two prostate cancer lines LNCaP and PC-3, respectively (Fig. 2A). Results obtained showed the horizontal and vertical migration abilities of both LNCaP and PC3 cells were notably enhanced following miR-183-5p mimic transfection, while alleviated by miR-183-5p inhibitor transfection (Fig. 2B, C). Besides, transwell assay revealed similar results (Fig. 2D). However, there were no significant differences on the cell proliferation among different groups of both LNCaP and PC3 cells (Fig. 2E). All these results indicated that miR183-5p could promote the migration and invasion of PCa cell lines.

MiR-183-5p targets TET1 in prostate cancer

MiRNAs exert their biological functions primarily by degrading or inhibiting their target mRNAs. In order to explore the potential target gene of miR-183-5p, software including TargetScan, miRDB, miRWalk database was used to predict proper molecules. The website indicated the presence of a binding site between the sequence of miR-183-5p the 3’-UTR of TET1(Fig. 3A), subsequently luciferase reporter assay was performed to confirm whether TET1 was a direct target of miR-183-5p. The results showed the luciferase activity of TET1 WT 3'-UTR but not TET1 MUT 3'-UTR was remarkably reduced following miR-183-5p mimic transfection (Fig. 3B), suggesting that miR-183-5p targets TET1.

Moreover, western blotting and qRT-PCR were performed to confirm the targeted relationship between miR-183-5p and TET1. The results showed the expression levels of TET1, both mRNA and protein, were significantly decreased in PC-3 and LNCaP cells transfected with miR-183-5p mimics, compared to mimic NC (Fig. 3C, D). Taken together, these data indicated that miR183-5p negatively regulated TET1 expression in PCa cell lines.

Upregulation of TET1 partially reversed the effects of miR-183-5p in PCa cell lines

To further explore whether the acceleration of PCa cell lines migration and invasion mediated by miR-183-5p was regulated by TET1, TET1 overexpression plasmid was constructed and co-transfected into both LNCaP and PC3 cells with miR-183-5p mimic or miR-NC. qRT-PCR assay demonstrated that the mRNA expression level of TET1 was upregulation after co-transfection of TET1 and miR-183-5p mimic compared with the control group transfected with miR-183-5p mimic alone (Fig. 4A). Additionally, overexpression of TET1 was able to counteract the accelerated migration and invasion of miR-183-5p mimic on PCa cells by wound healing assay and transwell assay (Fig. 4B, C, D).

The present study aimed to investigate the regulatory role of miR-183-5p and its potential target TET1 in the progression of PCa. In clinical studies, we found that miR-183-5p was up-regulated in PCa tissues, moreover, PCa patients with high miR-183 expression had shorter recurrence-free survival than those with low miR-183 expression. While in functional studies, we observed that overexpression of miR-183-5p promoted the migration and invasion of PCa cells, both LNCaP and PC3 cells. Meanwhile, miR-183-5p down-regulated the expression of TET1 protein in cells. On the contrary, inhibit miR-183-5p retarded migration and invasion processes of PCa cells and increase the expression of TET1 protein. By constructing a luciferase reporter vector, we determined that TET1 was a direct target of miR-183-5p.

MiR-183-5p is located on chromosome 7q31-34, which is a member of the miR-183-96-182 cluster.

This cluster includes miR-183, miR-96 and miR-182, the three members have highly homologous sequence. The miR-183-96-182 cluster was originally identified as a sensory organ-specific miRNA cluster, including hearing, vision and olfaction [29–32]. However, recent studies have demonstrated that the miR-183-96-182 cluster was involved in oncogenesis and cancer progression[33]. Among them, miR-183-5p was reported highly expressed in renal cell carcinoma, non-small cell lung cancer and breast cancer, and promoted malignant progress, even resulting in radioresistance [34–37]. Consistent with above, miR-183-5p was found overexpression in PCa tissues and it positively regulated serum levels of PSA, which functioned as an oncogene in PCa [13, 19]. This conclusion was further supported by our findings in this study, but there were still some findings not in accord with the expectation. We found up-regulation of miR-183-5p promoted the migration and invasion of PCa cells, but did not affect cell proliferation. However, Larne et al. found that overexpression of miR-183 induced cell growth in PCa cells[13]. We suspect that this may be due to distinct biological effects of miR-183-5p and miR-183-3p.

Two mature miRNAs, deriving from 3’ and 5’ ends of the same pre-miRNA, may induce different effect in proliferation, migration and invasion[38]. Ling et al. reported that phoenixin-14 regulated proliferation and apoptosis of vascular smooth muscle cells by activating KCNQ1OT1/miR-183-3p/CTNNB1 pathway, which partly confirmed our speculation[39]. Nevertheless, it is true that more research is needed to definite the biological functions of the miR-183 hairpin RNA products, respectively, in order to obtain a better understanding of the regulatory mechanism of miR-183 in PCa.

TET1 has been recognized as a tumor suppressor in a variety of human cancer, because it is down-regulated together with 5-hmC depletion[40, 41]. It had been verified that the protein and mRNA levels of TET1 were decreased in PCa, and low TET1 mRNA levels correlated significantly with a wore metastasis-free survival[42]. In addition, TET1 deficiency facilitated tumor growth and metastasis in PCa [43]. These results implied that TET1 might participate in the pathogenesis of PCa. Carolina et al. showed that miR-183-5p could strengthen the ability of PCa cells to adhesion via repression of ITGB1 expression[20]. Here we found that overexpression of miR-183-5p enhanced the malignant phenotype of PCa cells by inhibiting TET1 expression. Our studies have further confirmed that miRNAs and their target genes did not have a one-to-one correspondence, at times, one miRNA would target different mRNAs, and one target mRNA would be regulated by serval miRNAs in the same human tumor.

Briefly, miR-183-5p promotes the migration and invasion of PCa cells, and high expression of miR-183 is associated with poor prognosis of PCa patients. In addition, miR-183-5p targeting TET1 may be a new potential biomarker for PCa.

Acknowledgements

We thank Dr. Guanghua Luo for his assistance during the operation of the experiments.

Author contributions

Qianfeng Zhuang and Zhen Chen designed the study. Kai Wang and Minchao Qin carried out the experiments. Yuehua Feng performed the statistical analysis, and wrote the first draft of the manuscript. All authors commented on previous versions of the manuscript, and approved the final manuscript.

Funding

This work was supported by Changzhou Applied Basic Research Project (No: CJ20200114) and (No: CJ20200093).

Conflicts of interest

The authors declare that there are no conflicts of interest.

Ethical approval and consent to participate

The protocol of the present study was approved by the Ethics Committee of the Third Affiliated Hospital of SooChow University (IRB#2020-0014). All recruited patients provided written informed consent. This study and all relevant procedures were carried out in accordance with the relevant guidelines and regulations.

Data availability statement

There are no restrictions on data availability. Please contact the corresponding author for access to data.

Consent for publication

Not applicable.

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: a cancer journal for clinicians 2018, 68(6):394-424.
Birnbaum MD, Zhao N, Moorthy BT, Patel DM, Kryvenko ON, Heidman L, Kumar A, Morgan WM, Ban Y, Reis IM et al: Reduced Arginyltransferase 1 is a driver and a potential prognostic indicator of prostate cancer metastasis. Oncogene 2019, 38(6):838-851.
Pan J, Zhao J, Ni X, Gan H, Wei Y, Wu J, Zhang T, Wang Q, Stephen JF, Wang B et al: The prevalence and prognosis of next-generation therapeutic targets in metastatic castration-resistant prostate cancer. Molecular oncology 2022.
Tan G, Jiang L, Li G, Bai K: ESTAT3 Inhibitor AG-490 Inhibits the Growth of Prostate Cancer by miR-503-5p Both In Vivo and In Vitro. Technology in cancer research & treatment 2020, 19:1533033820948062.
Jia Z, Li W, Bian P, Liu H, Pan D, Dou Z: LncRNA MCM3AP-AS1 Promotes Cell Proliferation and Invasion Through Regulating miR-543-3p/SLC39A10/PTEN Axis in Prostate Cancer. OncoTargets and therapy 2020, 13:9365-9376.
Zhang D, Liu X, Zhang Q, Chen X: miR-138-5p inhibits the malignant progression of prostate cancer by targeting FOXC1. Cancer cell international 2020, 20:297.
Sun Y, Chen G, He J, Huang ZG, Li SH, Yang YP, Zhong LY, Ji SF, Huang Y, Chen XH et al: Clinical significance and potential molecular mechanism of miRNA-222-3p in metastatic prostate cancer. Bioengineered 2021, 12(1):325-340.
Liang X, Li H, Fu D, Chong T, Wang Z, Li Z: MicroRNA-1297 inhibits prostate cancer cell proliferation and invasion by targeting the AEG-1/Wnt signaling pathway. Biochemical and biophysical research communications 2016, 480(2):208-214.
Ye Y, Yuan XH, Wang JJ, Wang YC, Li SL: The diagnostic value of miRNA-141 in prostate cancer: A systematic review and PRISMA-compliant meta-analysis. Medicine 2020, 99(22):e19993.
Zhong J, Liu Y, Xu Q, Yu J, Zhang M: Inhibition of DIXDC1 by microRNA-1271 suppresses the proliferation and invasion of prostate cancer cells. Biochemical and biophysical research communications 2017, 484(4):794-800.
Coradduzza D, Cruciani S, Arru C, Garroni G, Pashchenko A, Jedea M, Zappavigna S, Caraglia M, Amler E, Carru C et al: Role of miRNA-145, 148, and 185 and Stem Cells in Prostate Cancer. International journal of molecular sciences 2022, 23(3).
Fujii T, Shimada K, Tatsumi Y, Fujimoto K, Konishi N: Syndecan-1 responsive microRNA-126 and 149 regulate cell proliferation in prostate cancer. Biochemical and biophysical research communications 2015, 456(1):183-189.
Larne O, Ostling P, Haflidadottir BS, Hagman Z, Aakula A, Kohonen P, Kallioniemi O, Edsjo A, Bjartell A, Lilja H et al: miR-183 in prostate cancer cells positively regulates synthesis and serum levels of prostate-specific antigen. European urology 2015, 68(4):581-588.
Yan R, Li K, Yuan D, Wang H, Chen W, Zhu K, Dang C: miR-183-5p promotes proliferation and migration in hepatocellular carcinoma by targeting IRS1 and its association with patient survival. The International journal of biological markers 2020:1724600820951572.
Li Y, Zeng Q, Qiu J, Pang T, Ye F, Huang L, Zhang X: MiR-183-5p Promotes Proliferation, Metastasis and Angiogenesis in Breast Cancer Cells through Negatively Regulating Four and a Half LIM Protein 1. Journal of breast cancer 2020, 23(4):355-372.
Guo R, Qin Y: LEMD1-AS1 Suppresses Ovarian Cancer Progression Through Regulating miR-183-5p/TP53 Axis. OncoTargets and therapy 2020, 13:7387-7398.
Paziewska A, Mikula M, Dabrowska M, Kulecka M, Goryca K, Antoniewicz A, Dobruch J, Borowka A, Rutkowski P, Ostrowski J: Candidate diagnostic miRNAs that can detect cancer in prostate biopsy. The Prostate 2018, 78(3):178-185.
Song CJ, Chen H, Chen LZ, Ru GM, Guo JJ, Ding QN: The potential of microRNAs as human prostate cancer biomarkers: A meta-analysis of related studies. Journal of cellular biochemistry 2018, 119(3):2763-2786.
Ueno K, Hirata H, Shahryari V, Deng G, Tanaka Y, Tabatabai ZL, Hinoda Y, Dahiya R: microRNA-183 is an oncogene targeting Dkk-3 and SMAD4 in prostate cancer. British journal of cancer 2013, 108(8):1659-1667.
Oliveira-Rizzo C, Ottati MC, Fort RS, Chavez S, Trinidad JM, DiPaolo A, Garat B, Sotelo-Silveira JR, Duhagon MA: Hsa-miR-183-5p Modulates Cell Adhesion by Repression of ITGB1 Expression in Prostate Cancer. Non-coding RNA 2022, 8(1).
Waseem M, Ahmad MK, Serajuddin M, Bhaskar V, Sankhwar SN, Mahdi AA: MicroRNA-183-5p: A New Potential Marker for Prostate Cancer. Indian journal of clinical biochemistry : IJCB 2019, 34(2):207-212.
Larne O, Martens-Uzunova E, Hagman Z, Edsjo A, Lippolis G, den Berg MS, Bjartell A, Jenster G, Ceder Y: miQ--a novel microRNA based diagnostic and prognostic tool for prostate cancer. International journal of cancer 2013, 132(12):2867-2875.
Rasmussen KD, Helin K: Role of TET enzymes in DNA methylation, development, and cancer. Genes & development 2016, 30(7):733-750.
Guo X, Li M: LINC01089 is a tumor-suppressive lncRNA in gastric cancer and it regulates miR-27a-3p/TET1 axis. Cancer cell international 2020, 20:507.
Ahn H, Lee HJ, Lee JH, Cho HD, Oh MH, Son JW, Jang SH: Clinicopathological correlation of PD-L1 and TET1 expression with tumor-infiltrating lymphocytes in non-small cell lung cancer. Pathology, research and practice 2020, 216(11):153188.
Bao B, Teslow EA, Mitrea C, Boerner JL, Dyson G, Bollig-Fischer A: Role of TET1 and 5hmC in an Obesity-Linked Pathway Driving Cancer Stem Cells in Triple-Negative Breast Cancer. Molecular cancer research : MCR 2020.
Wu J, Li H, Shi M, Zhu Y, Ma Y, Zhong Y, Xiong C, Chen H, Peng C: TET1-mediated DNA hydroxymethylation activates inhibitors of the Wnt/beta-catenin signaling pathway to suppress EMT in pancreatic tumor cells. Journal of experimental & clinical cancer research : CR 2019, 38(1):348.
Su PH, Hsu YW, Huang RL, Chen LY, Chao TK, Liao CC, Chen CW, Wu TI, Mao SP, Balch C et al: TET1 promotes 5hmC-dependent stemness, and inhibits a 5hmC-independent epithelial-mesenchymal transition, in cervical precancerous lesions. Cancer letters 2019, 450:53-62.
Lumayag S, Haldin CE, Corbett NJ, Wahlin KJ, Cowan C, Turturro S, Larsen PE, Kovacs B, Witmer PD, Valle D et al: Inactivation of the microRNA-183/96/182 cluster results in syndromic retinal degeneration. Proceedings of the National Academy of Sciences of the United States of America 2013, 110(6):E507-516.
Weston MD, Tarang S, Pierce ML, Pyakurel U, Rocha-Sanchez SM, McGee J, Walsh EJ, Soukup GA: A mouse model of miR-96, miR-182 and miR-183 misexpression implicates miRNAs in cochlear cell fate and homeostasis. Scientific reports 2018, 8(1):3569.
Mahmoudian-Sani MR, Forouzanfar F, Asgharzade S, Ghorbani N: Overexpression of MiR-183/96/182 Triggers Retina-Like Fate in Human Bone Marrow-Derived Mesenchymal Stem Cells (hBMSCs) in Culture. Journal of ophthalmology 2019, 2019:2454362.
Fan J, Jia L, Li Y, Ebrahim S, May-Simera H, Wood A, Morell RJ, Liu P, Lei J, Kachar B et al: Maturation arrest in early postnatal sensory receptors by deletion of the miR-183/96/182 cluster in mouse. Proceedings of the National Academy of Sciences of the United States of America 2017, 114(21):E4271-E4280.
Ma Y, Liang AJ, Fan YP, Huang YR, Zhao XM, Sun Y, Chen XF: Dysregulation and functional roles of miR-183-96-182 cluster in cancer cell proliferation, invasion and metastasis. Oncotarget 2016, 7(27):42805-42825.
Wang H, Ma Z, Liu X, Zhang C, Hu Y, Ding L, Qi P, Wang J, Lu S, Li Y: MiR-183-5p is required for non-small cell lung cancer progression by repressing PTEN. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2019, 111:1103-1111.
Cheng Y, Xiang G, Meng Y, Dong R: MiRNA-183-5p promotes cell proliferation and inhibits apoptosis in human breast cancer by targeting the PDCD4. Reproductive biology 2016, 16(3):225-233.
Kara M, Kaplan M, Bozgeyik I, Ozcan O, Celik OI, Bozgeyik E, Yumrutas O: MTUS1 tumor suppressor and its miRNA regulators in fibroadenoma and breast cancer. Gene 2016, 587(2):173-177.
Miao F, Zhu J, Chen Y, Tang N, Wang X, Li X: MicroRNA-183-5p promotes the proliferation, invasion and metastasis of human pancreatic adenocarcinoma cells. Oncology letters 2016, 11(1):134-140.
Lv Y, Yang H, Ma X, Wu G: Strand-specific miR-28-3p and miR-28-5p have differential effects on nasopharyngeal cancer cells proliferation, apoptosis, migration and invasion. Cancer cell international 2019, 19:187.
Ling C, Hu X, Luo L, Liang C, Wang H, Chen C: Phoenixin-14 regulates proliferation and apoptosis of vascular smooth muscle cells by modulation of KCNQ1OT1/miR-183-3p/CTNNB1 axis. Environmental toxicology and pharmacology 2021, 86:103655.
Shirai K, Nagae G, Seki M, Kudo Y, Kamio A, Hayashi A, Okabe A, Ota S, Tsutsumi S, Fujita T et al: TET1 upregulation drives cancer cell growth through aberrant enhancer hydroxymethylation of HMGA2 in hepatocellular carcinoma. Cancer science 2021, 112(7):2855-2869.
He B, Chen J, Song W, Bai Y: miR-646/TET1 mediated demethylation of IRX1 promoter upregulates HIST2H2BE and promotes the progression of invasive ductal carcinoma. Genomics 2021, 113(3):1469-1481.
Spans L, Van den Broeck T, Smeets E, Prekovic S, Thienpont B, Lambrechts D, Karnes RJ, Erho N, Alshalalfa M, Davicioni E et al: Genomic and epigenomic analysis of high-risk prostate cancer reveals changes in hydroxymethylation and TET1. Oncotarget 2016, 7(17):24326-24338.
Hsu CH, Peng KL, Kang ML, Chen YR, Yang YC, Tsai CH, Chu CS, Jeng YM, Chen YT, Lin FM et al: TET1 suppresses cancer invasion by activating the tissue inhibitors of metalloproteinases. Cell reports 2012, 2(3):568-579.

No competing interests reported.

file.pdf

Download PDF

Journal Publication

published 09 Jul, 2023

Read the published version in BMC Urology →

Editorial decision: Major revision
11 May, 2023
Reviews received at journal
29 Apr, 2023
Reviewers agreed at journal
22 Apr, 2023
Reviews received at journal
03 Mar, 2023
Reviewers agreed at journal
03 Mar, 2023
Reviewers invited by journal
20 Feb, 2023
Editor assigned by journal
07 Feb, 2023
Editor invited by journal
07 Feb, 2023
Submission checks completed at journal
07 Feb, 2023
First submitted to journal
28 Jan, 2023

You are reading this latest preprint version

MiR-183-5p Promotes Migration and Invasion of Prostate Cancer by Targeting TET1

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

PCa tissues samples

Bioinformatic analyses

Cell lines and transfection

CCK-8 assay

Cell migration and invasion assay

Wound healing assay

Luciferase reporter assay

Western blot analysis

Total RNA extraction and real-time PCR (qRT‐PCR)

Statistically analysis

Results

Up-regulated expression of miR-183-5p in PCa tissues

MiR-183-5p mimic transfection promotes migration and invasion of PCa cell lines

MiR-183-5p targets TET1 in prostate cancer

Upregulation of TET1 partially reversed the effects of miR-183-5p in PCa cell lines

Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1