Chemicals, strain and culture conditions
Carvacrol 98% (Merck, Germany; CAS number: 499-75-2, HS code 29071900, ECNO: 270-889-6) as the major constituent of the thyme extract was purchased from Merck Company, Germany.
Aflatoxin B1were purchased from LiBion Company Belgium.MCF7 cell line was obtained from Pastor Institute (Tehran, Iran).Aloe vera powder was obtained from Barij essence company, Iran. Thyme collected from the Esko City in East Azarbaijan Province.
Aspergollus flavus (PTCC5004) and A. parasiticus (PTCC5018) was purchased from research collection (Asr Enghelab, Iran). A. flavus and A. parasiticuswere subculture on Trypticase Soy Agar (TSA) (Merck, Germany) medium, then, were cultured on Sabouraud Dextrose Agar (SDA) (Merck, Germany) and incubated at 25 ˚C for 5 to7 days. The spores were washed with 0.1% (v/v) Tween-80and adjusted to 5 × 104 spores/mL using a haemocytometer for the following culture.
Plant Material And Preparation Of Extract
Plant extraction was performed using percolation method described by Khajeh et al (Khajeh 2016). briefly, the 50 gm of air-dried powdered were mixed with 500 mL of methanol 96% ethanol and the volume was then adjusted to 500 ml with distilled water in an Erlenmeyer flask (1,000 mL), the flask was shaken frequently by shaker at room temperature (130 rpm) for 3 days. The obtained extract was filtered using Whatman (No.4), and the crude extract was collected. The solvent was separated and concentrated from the extract using a rotary evaporator; the extract was sterilized with a 0.45-µm pore size syringe filter. Finally, the dry weight of Thyme and Aloe vera extracts were measured. In this study, performed the concentrations of 212.33–0.41 mg/ml for Thyme and 78.17 − 0.15 mg/ml for Aloe vera extract respectively for the experiment.
The Preparation Of Nanoencapsulation Of Carvacrol Structure
For constructing nano-encapsulated, the β-cyclodextrin was used [18]. Hence carvacrol (9.8 mg/mL), β-cyclodextrin (1mg), and dimethylformamide (5,6 mL) were solved in pure water (60mL). Then, the obtained solution was kept in toluene 4,2-diisocyanatefor 4 days at70 ˚C. Then the remaining dimethylformamide was removed by washing with acetone. Nanocarvacrol powder cross-linked polymer was obtained.125 mg/ml of nanocarval was dissolved in distilled water and used. The synthesized Nano-encapsulated were characterized by fourier-transform infrared spectroscopy (FTIR) (Nicolet, USA)and dynamic light scattering (DLS, 90Plus PALS)techniques.
Anti-fungal Activity Of Compounds
The MIC is defined as the lowest concentration of an antimicrobial agent that inhibits the growth of a microorganism. MIC was determined according to a broth microdilution method[19]. For this work, different concentrations in range of the Thyme (212.33–0.41 mg/ml)and Aloe vera extract (78.17 − 0.15 mg/ml), besids, carvacrol(9.8-0.019 mg/ml) and Nano-encapsulated(120 − 0.23 mg/ml) were prepared. Briefly, 100 µL of different concentrations of each compounds containing in RPMI medium were added to separate well of sterile 96-well microtiter plates. Also, 5 × 104 spores/mL of A. flavus and A.parasiticus in a shaking incubator at 28°C for 72 h. Each experiment was repeated three times in an independent manner. After this period, MIC was read visually and noted as the lowest concentration of each commons that prevented visible microbial growth in plate was introduced as MIC of these compounds.
Cytotoxicity Assay (Mtt Assay)
The cytotoxic effect of the Thyme and Aloe vera extract, carvacrol and nano-encapsulated was assessed by colorimetric MTT (Sigma,USA) assay [20]. In this proposed, cell line MCF7culture in DMEM cell culture medium supplemented with 10% fetal bovin serum (FBS), 50 µl penicillin / streptomycin, and L-glutamin incubated at 37 0C in 5% CO2 for 24 h. Then, the density of 1×104cells/ml were seeded into each well of microtiter plates (tissue culture grade, 96 wells, flat bottom, Corning. USA) containing determined MIC concentration of Thyme and Aloe vera extract, carvacrol and nano-encapsulated. Also, using the untreated cells as control group. Viability of cells was tested by using MTT (5 mg/ml, Sigma-Aldrich, USA) at 570 nm using ELISA reader (Star Sate, Germany). Cell viability percentage was calculated compared to control group. The cell viability was calculated by the following formula:
Cell viability = OD Test/ OD control × 100
Rna Isolation And Rt-qpcr
In order to evaluate the effect Thyme and Aloe vera extract, carvacrol and nano-encapsulated on the relative expression of aflatoxin biosynthetic genes (aflR and ver 1), real-time PCR was performed. A. flavus (PTCC5004) or A. parasiticus(PTCC5018)was treated with the MIC concentrations of Thyme (6.63mg/mL), Aloe vera (9.77 mg/ml), carvacrol (0.038mg/mL), and nano-encapsulated carvacrol (3.75 mg/mL) in 10mlSabouraud Dextrose broth (sigma, USA) and incubated in a shaking incubator at 30°C for 72 h. Total RNA was extracted from each sample according to kit protocol (Invitrogen, Mulgrave, VIC, Australia)).The RNA was quantified by measuring the absorbance at 260 and 280 nm using a Nanodrop (Nanodrop, Thermo Fisher Scientific, USA).
Q Pcr Analysis
cDNA was synthesized as manufacturer’s recommendation using cDNA synthesis kit (Parstos, Tehran, Iran). The PCR primer used to amplify and identify of aflR and ver1geneswere designed by all-ID design software, and the housekeeping gene β-actin was used as internal control. The primer sequence was used in this study are shown in Table 1.For confirming the correct size of amplicons and the absence of non-specific bands, the agarose gel electrophorese was done. The Real-time PCR reactions were performed using SYBR green master mix AMPLIQON (Real Q plus 2 x master mixes Green High Rox)in an ABI Prism7500 sequence detection system(Applied Biosystems, USA) was employed as the reference gene for normalization of aflR and ver1 genes expression level. The 2 –ΔΔCT method was used to determine the expression level relative to the internal control[19].
Table 1
The genes sequences which used in this study
Genes | Sequence | Amplification size | Accession No. |
Ver1 | F: 3’CCAATGCGGCCGTTGT’5 R: 3’TGAGAAAAACGACGAATGAA’5 | 55bp | M91369.1 |
aflR | F: 3’GGCTGGTCAGGAGCAAAAGC’5 R: 3’CCCCGAATTCCGAATCG’5 | 56bp | MG720232.1 |
Act1 | F: 3’TGCTCTCGTTATCGACAATGGT’5 R: 3’CATCGTCACCGGCGAAA’5 | 59bp | Xm629054-1 |
F: Forward; R: Reverse |
Aflatoxin Extraction And Hplc Analysis
Standard and calibration preparation
Aflatoxin B1were purchased fromLiBion Company Belgium.The working solution was prepared in methanol (Sigma) and diluted withultrapure water (with3:2 ratio).
Sample Preparation
10 mL of chloroform was added to the culture medium and mixed in a separatory funnel for 20 min. Gradually, the produced aflatoxin and chloroform were separated. Then, chloroform extract was concentrated by Rotary Evaporator device (Heidolph, Germany) in vacuum condition at 42°C. In the next step, 3 µl of methanol with HPLC purity (≥ 99.9%) was added and subsequently, the sample was passed through a0.2 𝜇m microfilter. The analysis of compounds was carry out by a Waters 2695 HPLC (Waters Corporation, Milford, Mass., USA) that consists of Waters 2475 fluorescence detector with 365nm excitation and 430 emission wavelengths, a postcolumn derivation system, and a C18 column (250×4.6 mm, 10µm particle size).The mobile phase by acetic acid: methanol: acetonitrile: water (1 : 20 : 20:60v/v/v/v)was pumped at a flow rate of 1 µL/min. The amount of aflatoxins B1 was calculated by comparison of under-curved area of unknown samples with authentic standards manipulated in the same manner.
Statistical Analyses
All obtained data of the fungal growth, AFB1 contents, and cytotoxicity were expressed as means ± standard deviation (SD) of at least three independent experiments. The statistical differences between the groups were analyzed by one-way ANOVA with Tukey's post hoc test by GraphPad Prism software, version 5.01. (USA, San Diego). P ≤ 0.05 was considered statistically significant.