Ssrp1 Promotes Lung Cancer Progression By Blocking The Wnt Pathway and Is Negatively Regulated By Mirna-28-5p

doi:10.21203/rs.3.rs-254306/v1

Download PDF

Research

Ssrp1 Promotes Lung Cancer Progression By Blocking The Wnt Pathway and Is Negatively Regulated By Mirna-28-5p

https://doi.org/10.21203/rs.3.rs-254306/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Background: Structure-specific recognition protein 1 (SSRP1) plays important roles in the development of various tumors. Numerous reports have described the effects of microRNAs (miRNAs) on lung cancer apoptosis, metastasis and proliferation. However, the relationship between SSRP1 and miRNAs in the development of lung cancer remains unclear. Therefore, the purpose of our study was to explore the functions of SSRP1 in the occurrence and development of lung cancer.

Methods: First, we analyzed the expression of SSRP1 in human lung cancer tissues and normal tissues, and the relationship between SSRP1 gene expression and overall survival through the UALCAN and GEPIA browsers. Second, we conducted experiments in vivo and vitro to demonstrate the roles and mechanisms of SSRP1 in the occurrence and development of lung cancer and its relationship with miR-28-5p.

Results: Our study demonstrated over-expression of SSRP1 in tissue sections from patients with lung cancer and in lung cancer cell lines, as validated by bioinformatics analysis. The over-expression of SSRP1 was found to be associated with lung cancer development and low overall survival rates. Silencing of SSRP1 by siRNA inhibited lung cancer proliferation, migration and invasion by blocking the WNT signaling pathway in vitro and vivo. We also verified SSRP1 was negatively regulated by miR-28-5p，as predicted by a variety of miRNA-related databases. Further studies showed that miR-28-5p mediated suppression of SSRP1 inhibited lung cancer cell proliferation.

Conclusion: Therefore, our data suggested that SSRP1 promotes lung cancer progression by blocking the WNT pathway and is negatively regulated by miRNA-28-5p.

Cancer Biology

SSRP1

lung cancer

WNT signaling

microRNA-28-5p

Lung cancer has the highest morbidity and mortality rate among cancers in China and worldwide [1], and severely endangers human health. In early phases, lung cancer is mostly asymptomatic, and most patients are in advanced stages when they are diagnosed, thus resulting in a 5-year overall survival rate of only approximately 16% [2]. The mechanisms underlying lung cancer are complicated, and the exact molecular mechanisms are not completely clear [3-5]. Therefore, exploring the molecular mechanisms underlying the occurrence, development, invasion and metastasis of lung cancer, and providing novel ideas and new targets for further treatment of lung cancer has become a research hotspot.

Structure-specific recognition protein-1 (SSRP1) is a subunit of the facilitates chromatin transcription (FACT) complex, which is involved in DNA replication, transcription and repair. SSRP1 is associated with the cell differentiation stage. SSRP1 is highly expressed in highly proliferative and undifferentiated cells [6]. The expression of SSRP1 is significantly higher in multiple types of human tumor cells than in normal cells, including non-small lung cancer, gliomas, osteoblasts and hepatocellular cancer [7-10]. In several cancers, high expression of SSRP1 is associated with high-grade, less-differentiated and metastasized tumors, and SSRP1 has consequently been considered a potential marker of poor prognosis and an anti-cancer target for inhibiting tumors [11, 12]. Our previous study has also found that SSRP1 knockdown significantly inhibits proliferation, invasion and migration, and promotes apoptosis in colorectal tumors [13]. Josephine et al. have reported that inhibition of SSRP1 decreases resistance to Erlotinib in non-small cell lung cancer [7]. The crucial role of SSRP1 in tumors prompted us to determine whether SSRP1 might participate in the development of lung cancer.

MicroRNAs (miRNAs) are 18–25 nt endogenous non-coding RNAs that down-regulate gene expression by binding the 3¢ untranslated regions (UTRs) of target mRNAs and subsequently inhibiting translation [14]. MiRNAs participate in cellular processes including proliferation, apoptosis and tissue morphogenesis [15, 16]. Many miRNAs have been shown to regulate the expression of genes with tumor-associated functions, and to play important roles in promoting or inhibiting tumorigenesis [17]. MicroRNA-28-5p (miR-28-5p) has been verified to have tumor suppressor activity in several types of tumors, such as hepatocellular carcinoma, prostate cancer and natural killer/T-cell lymphoma [18-20]. Moreover, Cheng Wang et al. have found that miR-28-5p suppresses human renal carcinoma cell lines’ proliferation and migration [21]. Liang Ma et al. have shown that miR-28-5p inhibits the migration of breast cancer cells [22]. Studies have shown that the miR-28-5p/CAMTAN2 axis regulates colorectal cancer progression through the WNT/β-catenin signaling pathway [23], and SSRP1 is regulated negatively by miR-28-5p [24]. However, the relationship and role of miR-28-5p, SSRP1 and WNT/β-catenin signaling in the development of lung cancer were not elucidated. In this study, we aimed to explore the expression and the detailed functions and channels of SSRP1 in the proliferation, migration and invasion of lung cancer, and to identify the upstream miRNA regulating SSRP1 in lung cancer, to assess whether SSRP1 might be used as a criterion for the diagnosis and prognosis of lung cancer patients.

Bioinformatics

The analysis of bioinformatic data on the expression level of SSRP1 in human lung cancer and corresponding normal tissues and the relationship between SSRP1 gene expression and overall survival rate in patients with lung cancer were assessed through the UALCAN (http://ualcan.path.uab.edu/index.html) and GEPIA (http://gepia.cancer-pku.cn/index.html) browsers.

Cell culture and human tissue specimens

The human lung cancer cell lines A549, NCI-H446, H1299 and PC9, murine cells (LLC) and the normal human lung epithelial cell B2B were obtained from the Department of Respiratory Medicine, First Hospital of Jilin University (Changchun, Jilin, China) and Basic Medical School of Jilin University (Changchun, Jilin, China). Cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 5.5 mmol/l D-glucose and supplemented with 10% FBS (BI, Israel), 100 U/ml penicillin and 100 mg/ml streptomycin. The cells were cultured in a 37 °C incubator with 5% CO₂. Five tissue samples from lung cancer patients (mean age, 58.2±6.85 years, ranging from 49 to 68; three female patients and two male patients) were collected at the First Hospital of Jilin University from September 2018 to May 2019. Patients receiving radiotherapy or chemotherapy were excluded from our study. Patients whose tissue samples were used in this research had provided written informed consent under an IRB-approved protocol. This study was approved by the local institutional review board of the First Hospital of Jilin University. The study methodologies conformed to the standards set by the Declaration of Helsinki.

Transient transfection

The siRNA was purchased from Genepharma (Suzhou, China). The sequences of siRNAs were as follows: siSSRP1-1, sense, 5¢-GCCAUGUCUACAAGUAUGATT-3¢ and antisense, 5¢-UCAUACUUGUAGACAUGGCTT-3¢; siSSRP1-2, sense, 5¢-CCCAGAAUGGUGUUGUCAAATT-3¢ and antisense, 5¢-UUUGACAACACAUUCUGGGTT-3¢; and negative control, sense, 5¢ CACGCAGAACGTGAACACC 3¢ and antisense, 5¢ GGCAGTAGATAACGTGAGGGA 3¢. NCI-H446 and H1299 cells were transfected with siRNA in 96-well plates or 6-well plates for 48–72 h. The Interferin transfection agent (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used according to the manufacturer’s protocol.

Cell viability, proliferation and colony formation assays

NCI-H446 and H1299 cells were plated on 96-well plates at a concentration of 1 × 10⁴ cells/well to determine cell viability with a Cell Counting Kit-8 (CCK-8; MCE, New Jersey, USA) at 24, 48 and 72 h after transfection. The OD450 was measured with a FLUO star Omega reader (BMG LABTECH, Ortenberg, Germany). Cell growth was assessed by counting at 24, 48, and 72 h after transfection at a concentration of 5 × 10⁴ cells/well in six-well plates. A total of 100 cells/well were cultured in six-well plates for colony formation assays. At 5–7 days after transfection, the colonies were fixed with 4% paraformaldehyde and then dyed with 0.2% crystal violet. Finally, colony formation was measured with an IX71 inverted fluorescence microscope (Olympus, Shinjuku, Tokyo, Japan).

Cell cycle analyses

Cells were collected with 0.25% trypsin and washed twice with cold PBS, then fixed with 70%–75% frozen ethanol at −20 °C for 1 h or fixed overnight at 4 °C. Subsequently, cells were washed once with cold PBS and then resuspended in 200–500 µl cold PBS. Then, 20 µl RNase A solution was added, and samples were incubated in a 37 °C water bath for 30 min. Finally, 400 µl PI stain solution (BestBio, Shanghai, China) was mixed gently and incubated for 30–60 at 4 °C in the dark. The results were detected with an Accuri C6 flow cytometer (Becton Dickinson, Franklin Lakes, New Jersey, USA).

Apoptosis analyses

NCI-H446 and H1299 cells were plated on six-well plates at a concentration of 1 × 10⁵ cells/well. Transfection experiments were performed the following day. Cells were harvested after 48 h and washed twice with PBS. Cells were resuspended in 400 µl 1× buffer, then stained with 5 µl Annexin-V-FITC and 5 µl PI (50 μg/ml) with an Annexin V FITC Apop Dtec Kit (BD Biosciences, San Jose, CA, USA) in the dark for 15 min at room temperature, and detected with an Accuri C6 flow cytometer (Becton Dickinson, Franklin Lakes, New Jersey, USA).

Cell migration and invasion assays

Cell migration assays were conducted with Transwell chambers (Corning Costar, Cambridge, MA, USA) with an 8-mm pore size. The lower chamber was filled with DMEM containing 20% FBS, and the upper chamber contained cells resuspended in serum-free DMEM, at a concentration of 5 × 10⁴ cells per well. After cultivation under 5% CO₂ for 48 h at 37 °C, the bottom surfaces of the polycarbonate membranes in the upper chamber were wiped with cotton swabs to remove residual cells, and cells were counted visually under an IX71 inverted fluorescence microscope (Olympus, Shinjuku, Tokyo, Japan) after staining with 0.1% crystal violet dye. Matrigel (BD Biosciences, San Jose, CA, USA) was also used in the Transwell chambers before cells were cultured in the invasion assays. Cell migration and invasion were determined by counting five random fields under an optical microscope. The data are presented as mean ± standard deviation.

Western blot analyses

Cells and tissues were harvested and lysed in RIPA buffer for 30 min at 4–8 °C. Proteins were detected and quantified with a BCA protein assay kit (Thermo Fisher Scientific, Inc., MA, USA). Protein samples (30–50 μg) were separated with 12% SDS-PAGE and transferred to polyvinylidene fluoride membranes. Nonspecific binding was blocked with 5% low-fat milk with Tween-20 for 2 h at room temperature. Subsequently, the membranes were incubated overnight at 4 °C with the following primary antibodies: anti-SSRP1 (Proteintech, Chicago, IL, USA), anti-p21 (Proteintech, Chicago, IL, USA), anti-CyclinD1 (Proteintech, Chicago, IL, USA), anti-GSK3β (Proteintech, Chicago, IL, USA), anti-p-GSK3β (Ser9) (Proteintech, Chicago, IL, USA), anti-β-catenin (Proteintech, Chicago, IL, USA), anti-Lamin B1 (Proteintech, Chicago, IL, USA), anti-β-actin (Proteintech, Chicago, IL, USA) and anti-cleaved caspase3 (Cell Signaling Technology, Beverly, Massachusetts, USA). Lamin B1, encoded by the LMNB1 gene, is composed of a two-dimensional matrix of proteins located next to the inner nuclear membrane, which has been highly conserved during evolution. Therefore, Lamin B1 is often used as a nuclear protein internal control. The membranes were scanned for statistical analysis by enhanced chemiluminescence with a gel image processing system (Tanon, Shanghai, China).

Nuclear extraction

A nuclear and cytoplasmic protein extraction kit was purchased from Beyotime (Beyotime Biotechnology Inc., Nantong, China). Specific experimental steps were performed according to the manufacturer’s protocol.

Animal experiments

The study was approved by the Animal Research Ethics Committee of Jilin University. The siRNA used in vivo was synthesized by Genepharma (Suzhou, China) and dissolved in PBS buffer. The dose of siRNA in nude mice was 0.5 mg/kg.

Ten BALB/c male nude mice (18–22 g) were purchased from Beijing Vital River Laboratory Animal Technology and housed under a 12/12 h light/dark cycle in an air-conditioned room at 22 ± 2 °C, and were given free access to food and water. All animal experiments were performed in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, with the approval of the Scientific Investigation Board of the College of Basic Medicine, Jilin University. Ten nude mice were randomly divided into two groups equally (five mice per group). A 100 µl subcutaneous injection containing 1 × 10⁶ NCI-H446 cells was delivered into the upper right back in mice in each group. When the tumor size reached 3–5 mm, siSSRP1 or negative control (NC, used with isodose PBS) was inoculated into the xenograft tumor by multi-point injection every 3 days. Tumor volume was calculated with the following formula: V = (length) × (width)²/2. After 28 days, mice were killed by intraperitoneal administration of barbiturates (240 mg/kg) followed by cervical dislocation. Tumor tissue was removed and frozen at −80 °C for protein analysis or fixed in 4% paraformaldehyde for hematoxylin-eosin (H&E) staining and immunofluorescence staining.

H&E staining and Immunohistochemistry

Tissues were fixed in 4% paraformaldehyde solution for at least 4 h at room temperature, and this was followed by dehydration, dipping in wax, paraffin embedding and cutting into sections. The sections were then H&E stained. For immunohistochemistry, sections were incubated with serum or BSA for 30 min at room temperature, and then were incubated with diluted primary antibody for 2 h and then with secondary antibody. The samples were observed under a BX53 fluorescence microscope (Olympus, Shinjuku, Tokyo, Japan).

Online searches of miRNA-related databases

The miRNA-related databases used in this research were as follows: TargetScan (http://www.targetscan.org/), DIANA-microT (http://www.microrna.gr/microT), miRDB (http://www.mirdb.org/), miRWalk (http://www.ma.uni-heidelberg.de/apps/zmf/mirwalk/) and starBase (http://starbase.sysu.edu.cn/).

Luciferase reporter assays

After co-transfection of fluorescein reporter vector and miR-28-5p mimics into HCT15 cells for 48 h, detection of luciferase activity was performed with a Dual Luciferase Reporter Gene Assay Kit (Beyotime Biotechnology Inc., Nantong, China) according to the manufacturer’s instructions.

Statistical analyses

Data analysis was performed on at least three independent experimental groups, and the results are expressed as mean ± standard deviation. Statistical analyses were performed in SPSS version 17.0. Comparison of the two sets of data was performed with unpaired Student's t-test. One-way ANOVA was followed by Dunnett’s test to compare more than two sets. Differences were considered significant at *p < 0.05 and **p < 0.01, vs. the NC group.

SSRP1 expression is upregulated in lung cancer and is associated with overall survival rate

To determine the role of SSRP1 in lung cancer, we analyzed the expression of SSRP1 in human tumor tissues from the online UALCAN browser and found that SSRP1 expression was upregulated in both human lung squamous cell carcinoma (LUSC) and lung adenocarcinoma (LUAD) samples (Fig. 1A and 1B, p < 0.01), compared with normal samples. The GEPIA browser also showed that the mean expression level of SSRP1 was higher in LUAD and LUSC than in the corresponding normal tissues (Fig 1C, p < 0.01). Overall survival rate analysis showed that lung cancer patients with high expression of SSRP1 showed a low overall survival rate, as compared with patients with low expression of SSRP1 (Fig. 1D, p < 0.05). Immunohistochemistry results showed that the SSRP1 levels were higher in grade I-IV lung cancer than normal lung tissues. Furthermore, the SSRP1 levels in high-grade lung cancer were significantly higher than those in lower grade lung cancer (Fig. 1E). Moreover, western-blotting indicated that SSRP1 was up-regulated in a panel of human lung cancer cell lines (A549, NCI-H446, H1299, PC9) and murine cells (LLC), as compared with normal human lung epithelial cells (B2B), and the effects were significant in NCI-H446 and H1299 cell lines (Figs. 1F and 1G). According to the statistical data, we chose the NCI-H446 and H1299 cell lines for subsequent experiments. The results indicated that SSRP1 is overexpressed in lung cancers, thus suggesting that SSRP1 might be associated with the development of lung cancer.

SSRP1 inhibition represses lung cancer cell proliferation

To explore the function of SSRP1 in lung cancer, we used RNAi technology to silence the expression of SSRP1 in lung cancer cells and observed whether SSRP1 might affect lung cancer progression.

First, SSRP1 protein levels in NCI-H446 and H1299 cells significantly decreased (Figs. 2A and 2B) after SSRP1 siRNA transfection for 48 h. CCK8 assays demonstrated that SSRP1 siRNA did not decrease the cell viability of normal human lung epithelial cells (B2B) (Fig. 2C). Compared with that of lung cancer cells transfected with negative control (NC), the viability of NCI-H446 and H1299 cells transfected with SSRP1 siRNA at OD 450 nm showed different degrees of decline after siRNA transfection for 24, 48 and 72 h (Figs. 2D and 2E). In addition, the number of NCI-H446 and H1299 cells (Figs. 2F and 2G) decreased significantly after SSRP1 siRNA transfection on the basis of cell counting assays. Likewise, colony formation assays showed that the colony formation ability of NCI-H446 and H1299 cells (Figs. 2H and 2I) was significantly inhibited after SSRP1 siRNA transfection. These data revealed that blocking the expression of SSRP1 represses the proliferation of lung cancer cells.

SSRP1 affects the cell cycle and apoptosis in lung cells

To further explore the regulatory role of SSRP1 in lung cancer cell proliferation, we examined cell cycle and apoptosis in lung cancer cells by flow cytometry. NCI-H446 and H1299 cells treated with SSRP1 siRNA for 48 hours showed significant G0/G1 phase arrest, as compared with cells treated with NC (Fig. 3A). Simultaneously, the percentage of apoptotic cells in NCI-H446 and H1299 cells transfected with SSRP1 siRNA was markedly higher than that in the NC group (Figs. 3B and 3C). Thus, knockdown of SSRP1 inhibited lung cancer cell cycle progression from G0/G1 phase to S phase and induced lung cancer cell apoptosis.

Downregulation of SSRP1 inhibits migration and invasion of lung cancer cells

We additionally explored the effects of SSRP1 on migration and invasion in lung cancer cells. Transwell assays showed that downregulation of SSRP1 with SSRP1 siRNA transfection significantly impaired migration (Figs. 4A and 4B) and invasion (Figs. 4C and 4D) in both NCI-H446 and H1299 cells. Therefore, SSRP1 silencing inhibited migration and invasion of lung cancer cells.

SSRP1 inhibition blocks lung cancer growth in vivo

Next, we used the NCI-H446 cells to construct a lung cancer xenograft model to explore the role of SSRP1 in lung cancer in vivo. The xenograft model construction and administration method were as shown in Fig. 5A. Animal experiment results revealed that the tumor size and volume in siSSRP1 group were much smaller than those in the NC group (Figs. 5B and 5C). However, the body weight did not show a significant difference between the groups (Fig. 5D), thus indicating that SSRP1 siRNA did not cause any damage to the bodies of the mice.

Immunohistochemistry showed that the expression of SSRP1 in the siSSRP1 group was markedly downregulated (Fig 5E). As an index of cell proliferation, proliferating cell nuclear antigen (PCNA) expression was inhibited in the siSSRP1 group (Fig 5E), compared with the NC group. Bcl-2 in the siSSRP1 group was markedly downregulated (Fig 5E), and the expression of Bax in the siSSRP1 group was clearly upregulated (Fig 5E), as compared with that in the NC group. MMPs play a key role in matrix remodeling [25] and are associated with tumor invasion [26]. We found that the expression of matrix metalloproteinase (MMP)-2 and MMP-9 was inhibited in the siSSRP1 group. However, no organ toxicity was observed by H&E staining (Fig 5F).

Furthermore, SSRP1 silencing increased the expression of the cell cycle regulator p21 and the pro-apoptotic factor Bax, but decreased the expression of Cyclin D1 and Bcl2 in NCI-446 and H1299 cells (Figs. 5G and 5H). The results above demonstrated that SSRP1 inhibition blocked lung cancer growth both invitro and in vivo.

SSRP1 affects lung cancer cell activity by inhibiting the WNT signaling pathway

The WNT pathway is considered the classical signaling pathway regulating tumor proliferation and metastasis [27]. To determine whether the WNT signaling pathway participates in SSRP1 regulation of lung cancer growth, we used western blotting to detect alterations of critical proteins in the WNT signaling pathway. Western blotting showed that SSRP1 knockdown inhibited expression of p-GSK3β and β-catenin, which are critical proteins in the WNT signaling pathway (Figs. 6A and 6B), in total protein extract from NCI-446 and H1299 cells, and p-GSK3β and β-catenin were also downregulated in nucleoprotein (Figs. 6C and 6D) from NCI-446 and H1299 cells. In addition, protein expression of p-GSK3β and β-catenin was inhibited in the siSSRP1 group in the xenograft model of lung cancer (Figs. 6E and 6F). Therefore, SSRP1 silencing may block proliferation and promote apoptosis by blocking the WNT signaling pathway.

Upregulation of SSRP1 in lung cancer is associated with miR-28-5p

MiRNAs are associated with the initiation and progression of cancer [28]. We previously confirmed that SSRP1 expression affects lung cancer progression. To investigate whether miRNAs regulate SSRP1 and whether SSRP1 affects the development of lung cancer, we used four miRNA-related databases to predict miRNAs that might regulate SSRP1 (Fig. 7A). The predictive results revealed that SSRP1 miRNA contains a potential miR-28-5p seed sequence within its 3¢UTR (Fig. 7B). To further confirm whether SSRP1 is the target gene of miR-28-5p, we generated a luciferase expression plasmid containing the wild-type or mutant SSRP1 3¢UTR (report-SSRP1-wt and report-SSRP1-mut, respectively). Luciferase activity results indicated that miR-28-5p overexpression suppressed report-SSRP1-wt-expressed luciferase, whereas report-SSRP1-mut was unaffected under the same conditions (Fig. 7C). To determine whether miR-28-5p negatively regulates SSRP1, we constructed miR-28-5p mimics and inhibitors (Figs. 7D and E) and used them to transfect NCl-446 and H1299 cells. When the expression of miR-28-5p was upregulated, the expression of SSRP1 was inhibited in both cell lines (Figs. 7F and G). In addition, the expression of miR-28-5p was downregulated, and the expression of SSRP1 was upregulated in both cell lines (Figs. 7H and I). In conclusion, SSRP1 is negatively regulated by miR-28-5p in lung cancer.

MiR-28-5p inhibits lung cancer proliferation by regulating the expression of SSRP1

To further determine whether miR-28-5p participates in the progression of lung cancer by regulating SSRP1 expression, we used miR-28-5p mimic and inhibitor to detect the influence of miR-28-5p on NCl-446 cell proliferation. Compared with that of cells transfected with NC miRNA, the cell viability of NCl-446 cells at 450 nm OD decreased after miR-28-5p mimic transfection for 48 and 72 h (Fig. 8A)—results opposite from those observed for the miR-28-5p inhibitor (Fig. 8B). In addition, the cell numbers and colony formation ability of NCl-446 cells decreased significantly after miR-28-5p mimic transfection (Figs. 8C, 8D and 8E) and increased after miR-28-5p inhibitor transfection (Figs. 8F, 8G and 8H). These results showed that miR-28-5p inhibits the progression of lung cancer by inhibiting the expression of SSRP1.

FACT, a heterodimer consisting of two subunits, SSRP1 and suppressor of Ty16, plays a crucial role in transcription and DNA replication, recombination and repair [29, 30]. SSRP1 is thought to be involved in the development of several cancers and to have different roles in different cancers. SSRP1 knockdown increases the sensitivity of HCC cells to doxorubicin, 5-Fluorouracil and cisplatin, and SSRP1 is negatively regulated by miR-497 in hepatic cancer [8]. Reports have indicated that SSRP1 silencing inhibits colorectal cancer proliferation, migration and invasion via the AKT pathway, and the lncRNA LOC101927746 acts as a competing endogenous RNA that suppresses miR-584-3p and then activates its target gene SSRP1, thus inhibiting the growth of colorectal cancer [13, 31]. However, SSRP1 inhibition suppresses the activity of the phosphorylation of the MAPK signaling pathway and consequently blocks the proliferation and metastasis of glioma cells [10] . FACT is also both a marker and a target of aggressive breast cancer cells [32]. In non-small cell lung cancer, knockdown of SSRP1 decreases cancer cell growth and overcomes resistance to Erlotinib by modulating the nuclear factor-kappa B signaling pathway [7]. However, the detailed function of SSRP1 in the lung cancer proliferation, metastasis and invasion remains unclear.

Bioinformatics analysis showed that SSRP1 was over-expressed in both LUSC and LUAD. Moreover, SSRP1 expression was higher in patients with high-grade lung cancer than in patients with low-grade lung cancer and in normal samples. The overall survival rate of patients was negatively correlated with the expression of SSRP1. Meanwhile, the expression of SSRP1 was significantly higher in a series of lung cancer cells, especially in NCl-H446 and H1299 cells, than in normal human lung epithelial cells. These results suggest that SSRP1 might regulate the development of lung cancer, and that SSRP1 overexpression might predict a high clinical grade of lung cancer and low survival rate of lung cancer patients.

To further explore the function of SSRP1 in lung cancer, we silenced SSRP1 by using siRNA to detect the effects of SSRP1 inhibition on lung cancer in vivo and vitro. First, we used several methods, including CCK-8, colony formation assays and FACS flow cytometric analysis, to validate that SSRP1 knockdown inhibited cell viability and proliferation and induced apoptosis in NCl-H446 and H1299 cells. Decreased expression of SSRP1 weakened the growth and volume of lung cancer cell xenograft tumors. The immunohistochemistry results in lung cancer cell xenograft tumors showed that SSRP1 silencing inhibited the growth of lung cancer and induced apoptosis in vivo. These results indicated that the down-regulation of SSRP1 inhibited lung cancer cell proliferation and stimulated anti-apoptosis function.

Furthermore, we explored the function of SSRP1 in lung cancer invasion and metastasis. NCl-H446 and H1299 cell migration and invasion ability were both inhibited after SSRP1 knockdown. Similarly, the immunohistochemistry results in lung cancer cell xenograft tumors showed that down-regulation of SSRP1 weakened migration and invasion ability in vivo. Furthermore, SSRP1 knockdown did not result in toxicity in organs including the heart, liver, spleen, lung and kidney.

On the basis of preliminary results, SSRP1 may have potential value in the lung cancer diagnosis and therapy, and further studies on SSRP1 are urgently needed.

Wnt/β-catenin signaling is an evolutionarily conserved pathway that plays crucial role in embryogenesis, development and homeostasis. When the Wnt pathway is active, Gsk3 is bound to β-catenin and translocates into cell nucleus as a transcription factor. Then the pathway stimulates the expression of downstream genes including cyclin D1 and cyclin-dependent kinase inhibitor CDKN1A (p21), alters cell cycle progression, and plays a role in tumorigenesis [27, 33]. After wnt/β-catenin signaling is inhibited, the expression of Bcl2 increases and the expression of Bax decreases, and the changes in the expression of the aforementioned genes ultimately promote apoptosis. In this study, we found that blocking SSRP1 gene expression inhibited not only the expression of p-Gsk3β, β-catenin, cyclin D1 and p21 in total cell protein, but also the expression of p-Gsk3β and β-catenin in the nucleus in NCl-H446 and H1299 cells. These results showed that Wnt/β-catenin signaling might be activated in lung cancer cells and SSRP1 inhibition represses lung cancer growth by blocking the WNT signaling pathway, in agreement with findings from a previous study on colorectal cancer [24].

MiRNAs negatively regulate target gene expression by binding the mRNA 3´UTR regions of target genes, which encode proteins and participate in a variety of cellular physiological process in tumors [28]. Numerous studies have suggested roles of miRNAs in anti-tumor therapy [34-36], thus prompting us to speculate that a certain miRNA may regulate the entire process of lung cancer progression by regulating the expression of SSRP1. Given the above findings, we used four RNA-related databases to predict the possible binding of miRNAs to SSRP1 and identified miR-28-5p as a miRNA that might regulate SSRP1 expression. The potential target site of SSRP1 3'UTR binding to miR-28-5p is located at 335–342. MiR-28-5p has been reported to regulate colorectal cancer by inhibiting SSRP1 expression [24], and miR-28-5p inhibits the migration and invasion of gastric cancer cells by suppressing AKT phosphorylation [37]. MiR-28-5p was transfected to verify changes in target gene expression in luciferase reporter assays, which revealed that SSRP1 was a target gene of miR-28-5p and was negatively regulated by miR-28-5p. Transfection of miR-28-5p mimics resulted in the downregulation of SSRP1 and also inhibited the proliferation of lung cancer cells, thus reflecting the findings of SSRP1 inhibition by siRNA. However, transfection of miR-28-5p inhibitor reversed this effect. Importantly, the diagnostic ability of miR-28-5p combined with SSRP1 was stronger than that of miR-28-5p or SSRP1 alone, and also stronger than that of the tumor markers used in the clinic. These data may provide new potential diagnostic and therapeutic targets for lung cancer in the future and highlight the clinical relevance of this study. However, further research to clarify the molecular mechanism of the interaction between miR-28-5p and SSRP1 is required. Our study demonstrates the roles of SSRP1, miR-28-5p and the WNT signaling pathway in lung cancer growth.

In conclusion, our study reported that silencing of SSRP1 by siRNA inhibited lung cancer proliferation, migration and invasion by blocking the WNT signaling pathway, however, miR-28-5p mediated suppression of SSRP1, thus influencing lung cancer growth via the WNT signaling pathway.

SSRP1: Structure-specific recognition protein 1; FACT: Facilitates chromatin transcription; miRNAs: MicroRNAs ; UTRs: Untranslated regions; miR-28-5p: MicroRNA-28-5p; DMEM: Dulbecco's modified Eagle's medium ; NC: Negative control; LUSC: Human lung squamous cell carcinoma ; LUAD: Lung adenocarcinoma; PCNA: Proliferating cell nuclear antigen.

Acknowledgements

Not applicable.

Authors’ contributions

SJ, LP and LZ designed the research. SJ and QW performed the experiments and prepared the images. YJ and BG analyzed the bioinformatic data. SJ, QW, BG, YJ and LW analyzed and interpreted the experimental data. SJ prepared the original manuscript. LP and LZ reviewed and edited the manuscript. All authors read and approved the final manuscript.

Funding

The present study was funded by the Fundamental Research Funds for the Central Universities, JLU, the National Natural Science Foundation of China (grant no. 81773217 to L.Z.), the Research Fund for International Cooperation Project of the Jilin Provincial Science and Technology Department (grant no. 20190701065GH to L.Z.) and the Jilin Province Health Technology Innovation Project (grant no. 230 to L.Z.). This work was also supported by the National Science and Technology Major Project (grant no. 2017ZX10103004 to LP.P.) and Jilin provincial Department of Finance (grant no. 2018SCZWSZX-021 to LP.P.). This work was also supported by Jilin Province Health Project (grant no. 2020SCZT057 to SN.J.).

Availability of data and materials

The raw data supporting the conclusions of this manuscript will be made available by the authors, without undue reservation, to any qualified researchers.

Ethics approval and consent to participate

The present study was approved by the Ethical Committee of the First Hospital of Jilin University [grant no: 2017-444]. All patients provided written informed consent.

Patient consent for publication

Not applicable.

Declaration of competing interest

The authors declare no potential conflicts of interest.

Author details

¹Department of Respiratory Medicine, The First Hospital of Jilin University, 71 Xinmin Street, Changchun, Jilin 130021,P.R.China. ²Department of Hepatopancreatobiliary Medicine, The Second Hospital of Jilin University, Changchun, P. R. China. ³Key Laboratory of Pathobiology, Ministry of Education, and Department of pathophysiology, College of Basic Medical Sciences, Jilin University, 126 Xinmin Street, Changchun, Jilin 130021,P.R.China. ⁴Department of Hepatobiliary and Pancreatic Surgery, The First Hospital of Jilin University, Changchun, P.R. China. ⁵Department of Plastic Surgery, China-Japan Union Hospital of Jilin University, Changchun, P.R. China.

Miller KD, Goding Sauer A, Ortiz AP, Fedewa SA, Pinheiro PS, Tortolero-Luna G, et al. Cancer Statistics for Hispanics/Latinos, 2018. CA Cancer J Clin. 2018;68(6):425-45.
Siegel R, Naishadham D, Jemal A. Cancer statistics, 2012. CA Cancer J Clin. 2012;62(1):10-29.
Brennan P, Hainaut P, Boffetta P. Genetics of lung-cancer susceptibility. The Lancet Oncology. 2011;12(4):399-408.
Dempke WC, Suto T, Reck M. Targeted therapies for non-small cell lung cancer. Lung Cancer. 2010;67(3):257-74.
Rodriguez-Canales J, Parra-Cuentas E, Wistuba, II. Diagnosis and Molecular Classification of Lung Cancer. Cancer Treat Res. 2016;170:25-46.
Garcia H, Fleyshman D, Kolesnikova K, Safina A, Commane M, Paszkiewicz G, et al. Expression of FACT in mammalian tissues suggests its role in maintaining of undifferentiated state of cells. Oncotarget. 2011;2(10):783-96.
Dermawan JKT, Gurova K, Pink J, Dowlati A, De S, Narla G, et al. Quinacrine Overcomes Resistance to Erlotinib by Inhibiting FACT, NF-kappa B, and Cell-Cycle Progression in Non-Small Cell Lung Cancer. Molecular Cancer Therapeutics. 2014;13(9):2203-14.
Ding Q, He K, Luo T, Deng Y, Wang H, Liu H, et al. SSRP1 Contributes to the Malignancy of Hepatocellular Carcinoma and Is Negatively Regulated by miR-497. Mol Ther. 2016;24(5):903-14.
Hossan T, Nagarajan S, Baumgart SJ, Xie W, Magallanes RT, Hernandez C, et al. Histone Chaperone SSRP1 is Essential for Wnt Signaling Pathway Activity During Osteoblast Differentiation. Stem Cells. 2016;34(5):1369-76.
Liao J, Tao X, Ding Q, Liu J, Yang X, Yuan FE, et al. SSRP1 silencing inhibits the proliferation and malignancy of human glioma cells via the MAPK signaling pathway. Oncol Rep. 2017;38(5):2667-76.
Gurova KV, Garcia H, Miecznikowski J, Omilian AR, Morrison C. Level of SSRP1 in Cancer as a Prognostic Marker of Aggressive Disease. American Journal of Clinical Pathology. 2013;140:152-.
Garcia H, Miecznikowski Jeffrey C, Safina A, Commane M, Ruusulehto A, Kilpinen S, et al. Facilitates Chromatin Transcription Complex Is an “Accelerator” of Tumor Transformation and Potential Marker and Target of Aggressive Cancers. Cell Reports. 2013;4(1):159-73.
Wang Q, Jia S, Jiao Y, Xu L, Wang D, Chen X, et al. SSRP1 influences colorectal cancer cell growth and apoptosis via the AKT pathway. Int J Med Sci. 2019;16(12):1573-82.
Pedroza-Torres A, Romero-Cordoba SL, Justo-Garrido M, Salido-Guadarrama I, Rodriguez-Bautista R, Montano S, et al. MicroRNAs in Tumor Cell Metabolism: Roles and Therapeutic Opportunities. Front Oncol. 2019;9:1404.
Mendell JT. MicroRNAs: critical regulators of development, cellular physiology and malignancy. Cell Cycle. 2005;4(9):1179-84.
Kloosterman WP, Plasterk RH. The diverse functions of microRNAs in animal development and disease. Dev Cell. 2006;11(4):441-50.
Marques AC, Tan J, Ponting CP. Wrangling for microRNAs provokes much crosstalk. Genome Biol. 2011;12(11):132.
Zhou SL, Hu ZQ, Zhou ZJ, Dai Z, Wang Z, Cao Y, et al. miR-28-5p-IL-34-macrophage feedback loop modulates hepatocellular carcinoma metastasis. Hepatology. 2016;63(5):1560-75.
Ng SB, Yan J, Huang G, Selvarajan V, Tay JL, Lin B, et al. Dysregulated microRNAs affect pathways and targets of biologic relevance in nasal-type natural killer/T-cell lymphoma. Blood. 2011;118(18):4919-29.
Fazio S, Berti G, Russo F, Evangelista M, D’Aurizio R, Mercatanti A, et al. The miR-28-5p Targetome Discovery Identified SREBF2 as One of the Mediators of the miR-28-5p Tumor Suppressor Activity in Prostate Cancer Cells. Cells. 2020;9(2).
Wang C, Wu C, Yang Q, Ding M, Zhong J, Zhang C-Y, et al. miR-28-5p acts as a tumor suppressor in renal cell carcinoma for multiple antitumor effects by targeting RAP1B. Oncotarget. 2016;7(45):73888-902.
Ma L, Zhang Y, Hu F. miR‑28‑5p inhibits the migration of breast cancer by regulating WSB2. International Journal of Molecular Medicine. 2020;46(4):1562-70.
Luan XF, Wang L, Gai XF. The miR-28-5p-CAMTA2 axis regulates colon cancer progression via Wnt/beta-catenin signaling. J Cell Biochem. 2019.
Wu W, He K, Guo Q, Chen J, Zhang M, Huang K, et al. SSRP1 promotes colorectal cancer progression and is negatively regulated by miR-28-5p. J Cell Mol Med. 2019;23(5):3118-29.
Kessenbrock K, Plaks V, Werb Z. Matrix metalloproteinases: regulators of the tumor microenvironment. Cell. 2010;141(1):52-67.
Yadav L, Puri N, Rastogi V, Satpute P, Ahmad R, Kaur G. Matrix metalloproteinases and cancer - roles in threat and therapy. Asian Pac J Cancer Prev. 2014;15(3):1085-91.
Taciak B, Pruszynska I, Kiraga L, Bialasek M, Krol M. Wnt signaling pathway in development and cancer. J Physiol Pharmacol. 2018;69(2).
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281-97.
Kumari A, Mazina OM, Shinde U, Mazin AV, Lu H. A role for SSRP1 in recombination-mediated DNA damage response. J Cell Biochem. 2009;108(2):508-18.
Marciano G, Da Vela S, Tria G, Svergun DI, Byron O, Huang DT. Structure-specific recognition protein-1 (SSRP1) is an elongated homodimer that binds histones. J Biol Chem. 2018;293(26):10071-83.
Huang H, Cai L, Li R, Ye L, Chen Z. A novel lncRNA LOC101927746 accelerates progression of colorectal cancer via inhibiting miR-584-3p and activating SSRP1. Biochem Biophys Res Commun. 2019;509(3):734-8.
Fleyshman D, Prendergast L, Safina A, Paszkiewicz G, Commane M, Morgan K, et al. Level of FACT defines the transcriptional landscape and aggressive phenotype of breast cancer cells. Oncotarget. 2017;8(13):20525-42.
Nayak G, Odaka Y, Prasad V, Solano AF, Yeo EJ, Vemaraju S, et al. Developmental vascular regression is regulated by a Wnt/beta-catenin, MYC and CDKN1A pathway that controls cell proliferation and cell death. Development. 2018;145(12).
Fang Z, Zhang L, Liao Q, Wang Y, Yu F, Feng M, et al. Regulation of TRIM24 by miR-511 modulates cell proliferation in gastric cancer. J Exp Clin Cancer Res. 2017;36(1):17.
Kalhori MR, Arefian E, Fallah Atanaki F, Kavousi K, Soleimani M. miR-548x and miR-4698 controlled cell proliferation by affecting the PI3K/AKT signaling pathway in Glioblastoma cell lines. Sci Rep. 2020;10(1):1558.
Mei J, Xu R, Hao L, Zhang Y. MicroRNA-613: A novel tumor suppressor in human cancers. Biomedicine & Pharmacotherapy. 2020;123.
Xiao F, Cheng Z, Wang P, Gong B, Huang H, Xing Y, et al. MicroRNA-28-5p inhibits the migration and invasion of gastric cancer cells by suppressing AKT phosphorylation. Oncol Lett. 2018;15(6):9777-85.

Download PDF

Version 1

posted

You are reading this older preprint version

Read the latest preprint version →

Ssrp1 Promotes Lung Cancer Progression By Blocking The Wnt Pathway and Is Negatively Regulated By Mirna-28-5p

Status:

Version 1

Abstract

Figures

Background

Materials And Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Status:

Version 1