Cell lines and culture conditions
TE-1, Kyse510, Kyse450, Kyse140, Eca109, and Eca109/CDDP cells were grown in RPMI-1640 media (Gibco, 22400089, USA) containing 10% fetal bovine serum (Excell Bio, FND500, New Zealand), 100 U/mL penicillin/streptomycin (Gibco, 15140122, USA). Add 1µg/mL CDDP (HANSOH PHARMA, China) to Eca109/CDDP cell medium to maintain its resistance to chemotherapy drugs.
Flow cytometry analysis of cell apoptosis
Cells were incubated with CDDP for 24 hours, then harvested and washed with cold PBS prior to staining with AnnexinV Alexa Fluor647/PI (FXP023-100, 4A Biotech, China). Apoptosis was measured by flow cytometry using a FACSCanto analyzer (BD, USA).
Cell viability analysis
The effect of chemotherapeutic drugs on the viability of ESCC cells was measured using CCK-8 (CK04-3000T, Dojindo, Japan). In brief, ESCC cells were plated into 96-well cell culture dishes (Excell Bio) at 3000 cells/per well 24 hours before the experiment and treated with varying amounts of CDDP or 5-Fu (Shanghai Xudong Haipu Pharmaceutical Co.,Ltd, China) for 24 hours or 48 hours and then incubated in CCK-8 for 4 hours. Absorbance (450 nm) was readed using an Elx800 microplate reader (BioTek, USA). Cells incubated with medium only were used as the negative control, with medium only wells used as the blank control.
Cell transfection with overexpression and knockdown Lentiviral vectors
The human RPS15A gene sequence was obtained from GenBank (NM_001019, transcript variant 2). Lentiviral vectors were constructed by Cyagen Biosciences. The target sequence that interfered with RPS15A is CCGGTTTCTCACTGTGATGAT with the EGFP-T2A-Puro plasmid. The over-expression RPS15A vector carrying the CDS sequence was derived from GenBank (NM_001030009.1, CDS sequence is conservative) with the EGFP-T2A-Puro maker too. Cyagen Biosciences provided the transfection strategy manual. The fluorescence was observed 48 hours after lentiviral transfection, and the CCK-8 method was used to screen the concentration of Puromycin that did not affect the survival of the lentivirus-transfected cells. The knockdown and overexpression efficiency were then measured.
Colony formation assay
ESCC cells were treated with trypsin to form suspensions of single cells and then 40,000 cells/well were plated into 6-well cell dishes (NEST biotechnology, China) with varying concentrations of CDDP. Following 168 hours of incubation, Giemsa was used to stain the cells, and colonies were counted.
In vitro tumorsphere formation assays
ESCC cells were treated with trypsin to generate a suspension of single cells, washed twice in ice-cold PBS, and then 10,000 cells/well were placed into 6-well plates (3471, Corning). A total of 3 ml tumor-sphere medium supplemented with B27 (12587010, Gibco), basic fibroblast growth factor (PHG0266, Gibco), and EGF (PHG0311L Gibco) were added to the plates for 1 week and the number of tumorspheres were counted. The data are presented as a percentage ratio of the amount of tumorspheres over the initial amount of cells seeded.
Side population (SP) assay
Single ESCC cells were incubated in 10 µg/mL Hoechst 33342 (FXP138-500, 4A Biotech) at room temperature for 90 minutes with gentle agitation every 10 minutes. The isotype control sample used was100 µM verapamil (S4202, Selleck Chemicals). The PI staining solution was then added to the samples, and after gently mixing, the samples were incubated in the dark for 15 minutes. After passing the samples through a 70 µm cell strainer (352350, Corning) to get rid of clumped cells, the single cells were analyzed using flow cytometry.
Quantitative real-time PCR
Trizol reagent (DP424, Tiangen, China) was used to extract total RNA which was then then reverse-transcribed into cDNA using the PrimerScript Master mix (RR036A, Takara, China) using the product manual. Gene expression was assessed by quantitative PCR (q-PCR) using TB GreenTM premix Ex TaqTM Ⅱ (TaKaRa, RR820A) and a C1000 Thermal Cycler (CFX96 Real-Time System, Bio-Rad). The expression levels of β-actin or GAPDH mRNA were used as internal controls. The primer pairs we used are listed below:
RPS15A
|
F-5'-CTCCAAAGTCATCGTCCGGTT-3'
|
R-5'-TGAGTTGCACGTCAAATCTGG-3'
|
MDR1
|
F-5'-TCTATGGTTGGCAACTAACACT-3'
|
R-5'-CTCCTGAGTCAAAGAAACAACG-3'
|
CD44
|
F-5'-CGGACACCATGGACAAGTTT-3'
|
R-5'-GAAAGCCTTGCAGAGGTCAG-3'
|
CD133
|
F-5'-TGGATGCAGAACTTGACAACGT-3',
|
R-5'-ATACCTGCTACGACAGTCGTGGT-3'
|
Oct-4
|
F-5'-CTGGGTTGATCCTCGGACCT-3'
|
R-5'-CCATCGGAGTTGCTCTCCA-3'
|
Sox2
|
F-5'-GCCGAGTGGAAACTTTTGTCG-3'
|
R-5'-GGCAGCGTGTACTTATCCTTCT-3'
|
Nanog
|
F-5'-TTTGTGGGCCTGAAGAAAACT-3'
|
R-5'-AGGGCTGTCCTGAATAAGCAG-3'
|
β-Actin
|
F-5'-CCTCGCCTTTGCCGATCC-3'
|
R-5'-GGATCTTCATGAGGTAGTCAGTC-3';
|
GAPDH
|
F-5'-GAGTCAACGGATTTGGTCGT-3'
|
R-5'-GACAAGCTTCCCGTTCTCAG-3'
|
Western blot analysis
Trident RIPA Lysis Buffer (GTX400005, GeneTex, USA) was used to prepare cell lysates from harvested cells. SDS-PAGE was used to separate the proteins, which were then transferred onto PVDF membranes (Millipore, MA, USA) as previously described.[17] The membranes were treated overnight at 4℃ with primary antibodies, washed and incubated with secondary antibodies for 2 hours at 25℃. The fluorescence intensity of target proteins was detected using an Enhanced Chemiluminescence Minescence Kit (4 A Biotech, Beijing, China) with β-Actin or GAPDH as the loading control. Antibodies against p-gp (13342), MRP-1 (72202), Caspase-3 (14220), PARP (9532), c-Caspase-3 (9664), c-PARP (5625), Bcl-2 (3498), CD44 (37259), CD133 (64326), Oct-4 (75463), Sox2 (23064), Nanog (4903), Erk1/2 (4695), mTOR (2983), p38 (8690), AKT (4691), β-Actin (4970), GAPDH (5174), Anti-rabbit IgG HRP (8889) and Anti-mouse IgG HRP (8890) were obtained from Cell Signaling Technology, USA (CST; Beverly, MA). Anti-RPS15A antibody (AP4804a) was purchased from ABGENT, USA. All the antibodies were diluted according to the product manuals.
Statistical analysis
The data are presented as means ± standard deviations of triplicate experiments. Differences between two treatment groups were assessed using a two-tailed unpaired Student's t-test; three or more groups were evaluated using one-way multiple comparison ANOVAs. P<0.05 was regarded as statistically significant.