Zinc deficiency alters metabolism-related organ crosstalk via changing insulin levels

doi:10.21203/rs.3.rs-2566572/v1

Zinc is one of the essential trace elements that plays an important role in the biological processes in human beings. Zinc deficiency, therefore, is known to cause several biofunctional disorders. Zinc plays an important role in stabilizing the pancreatic insulin secretion. Insulin not only exerts a hypoglycemic effect, but also regulates glucose and lipid metabolisms in insulin-target organs. It, thus, regulates various metabolic diseases, as well. Zinc levels, in vivo, are reportedly related to metabolic diseases, for instance, zinc levels have been reported to regulate glucose and lipid parameters. However, no study, thus far, has explained the relationship of zinc with glucose and lipids on the basis of the concentration of insulin. In this study, a zinc-deficient rat model was developed to analyze how insulin levels, insulin-regulated glucose and lipid metabolisms, and their crosstalk are regulated. The findings from this study will help to clarify the role of zinc in insulin-regulated metabolic diseases.

Zinc

Insulin

Lipid metabolism

Pancreas

Adipose tissue

Diabetes mellitus

Zinc is an essential trace element of the human physiology and plays an important role in health and disease. Zinc deficiency can cause a wide range of health problems, including decreased immune function [1], delayed wound healing [2], and growth retardation [3]. Zinc is reportedly essential for the pancreas and for the regulation of blood glucose concentrations [4]. The reasons for this are attributed to the fact that insulin forms complexes with zinc ions for storage as crystals [5], and that zinc is also involved in transporting insulin granules [5].

Insulin lowers blood glucose by enhancing glucose uptake into the adipose tissue and the muscle cells via GLUT4 [6]. Insulin not only regulates the hypoglycemic process but also regulates the glucose and lipid metabolism in various other organs [6]. For instance, an increase in blood glucose concentration in the liver leads to insulin secretion; this insulin acts on the liver to inhibit gluconeogenesis, thereby suppressing the increase in the blood glucose concentration [6].

Insulin is also known to be involved in the lipid metabolism. In the liver, insulin upregulates the expression of SREBP1c, a master regulator of lipid metabolism [7]. High levels of insulin increase lipid synthesis in the liver. Fatty liver has often been reported in diabetic patients with hyperinsulinemia, a complication of fatty liver disease [7].

In the adipose tissue, insulin acts to inhibit lipolysis. For instance, in type-2 diabetes mellitus, insulin depletion induces lipolysis by hormone-sensitive lipase, which breaks down triglycerides in the adipose tissue and releases free fatty acids (FFAs) and glycerol into the blood, resulting in hyper-free fatty acidemia and weight loss[8]. It has also been shown that elevated levels of FFAs in the blood can cause functional abnormalities in other organs, called lipotoxicity[8], and chronic exposure of the pancreas to lipotoxicity can impair insulin secretion [9–11]. Thus, insulin is involved in the progression of metabolic diseases, including type-2 diabetic pathology, by altering the metabolism of various target organs and affecting organ crosstalk [12].

Several reports have indicated the possibility of in vivo zinc levels regulating metabolic diseases. For instance, zinc levels were found reduced in patients with type 2 diabetes [13, 14], and zinc supplementation reportedly helped improve the glycemic parameter [15]. It is also clear that the administration of zinc to fatty liver-induced mice prevents fatty liver and liver damage [16].

However, no study, so far, has explored in detail the relationship between reduction in zinc levels and the induction of metabolic abnormalities in vivo, the role of insulin as its mediator, and the metabolic changes caused in insulin-target organs.

In this study, we aimed to examine how insulin levels in the blood are altered in zinc-deficient rats and how the metabolism in the target organs is regulated by insulin and by the interactions between organs. The finding from this study will help to clarify the role of zinc in insulin-mediated progression of metabolic disorders.

2.1.1 Animal Studies

Male Sprague-Dawley rats (5 weeks of age) were obtained from Japan SLC, Inc. (Tokyo, Japan). All the rats were maintained in a temperature-controlled (23℃) facility with a 12-h light/dark cycle and were given free access to water. The rats were placed on the test diet after one week of acclimation. The control and zinc-deficient diets were obtained from the Oriental Yeast Co. Ltd. (Tokyo, Japan). The composition of each diet is given in Table 1–3. Two separate studies were conducted.

In the first study, the rats, aged 5 weeks, were divided into three groups: normal diet-fed group (ZnC), zinc-deficient diet-fed group (ZnD), and zinc-supplemented diet-fed group (ZnDC). The ZnC and the ZnD groups received diets with different zinc content (0.01% and 0.00%, respectively) for 6 weeks each. The ZnDC received a zinc-deficient diet for 6 weeks and was then switched to the ZnC diet for 4 weeks. Each group was assigned 6–8 rats. Rats that had died before autopsy were not included in the analysis.

In the second study, the ZnC group and the ZnD group were administered the respective diets for 6 weeks each, and oral glucose tolerance test (OGTT) and intraperitoneal insulin tolerance test (IPITT) were performed during the administration period. Each group was assigned 4–6 rats. Rats that had died before autopsy were not included in the analysis.

During the study period, all the rats were fed equally, 17 g of the diet per day, to ensure no bias existed in the amount of nutrients ingested, except for zinc. The rats were fasted for 12 h before harvesting the blood for subsequent blood measurements. The pancreas, fat, muscle, and brown adipose tissues were rapidly frozen in liquid nitrogen for RNA isolation and histology. All animal experiments were conducted in accordance with the protocols and guidelines of the Animal Experimentation and Ethics Committee of the Jikei University School of Medicine, Tokyo, Japan.

Table 1

Nutrientional content of the diet
Ingredients	/100g
Diet composition
Protein	20.00
Glucose	10.00
Corn oil	10.00
Powdery cellulose	2.00
Cornstarch	48.70
α - Cornstarch	5.00
Minerals	3.13
Vitamins	1.17
Total	100.00

Table 2

Mineral composition of the diet
Mineral composition
Ingredients	/100g
NaCl	17.750
K₂HPO₄	34.160
MgSO₄	5.280
CaHPO₄	7.960
CaCO₃	31.790
Fe - citrate	2.910
KI	0.084
MnSO_4・5H₂O	0.028
CuSO_4・5H₂O	0.032
CoCl_2・6H₂O	0.006
Total	100.000

Table 3

Vitamin composition of the diet
Vitamin composition
Ingredients	/100g
Vitamin A	0.1709
Vitamin D3	0.0027
Vitamin E	1.8800
Vitamin B1	0.0860
Vitamin B2	0.0513
Vitamin B6	0.0342
Vitamin B12	0.1700
Vitamin K3	0.0028
Biotin	0.0342
Folic acid	0.0043
Pantothenate calcium	0.1368
Nicotinic acid	0.2137
Choline chloride	12.8000
Powdery cellulose	84.4136
Total	100.0000

2.2 mRNA Expression Analysis by Quantitative RT-PCR (qPCR)

Total RNA was extracted from the tissue samples using the TRIzol® Reagent (Invitrogen, Tokyo, Japan). The cDNA was synthesized from the total RNA using the Prime Script RT Reagent Kit (Takara Bio Inc., Shiga, Japan). Expression levels in the synthesized cDNA were analyzed using real-time PCR with THUNDERBIRD® SYBR® qPCR Mix (TOYOBO, Osaka, Japan). The primer sequences used are listed in Table 4.

Table 4

Primer sequences used for qPCR analysis
	Forward Primer (5'→3')	Reverse Primer (5'→3')
18s	GCTCTAGAATTACCACAGTTATCCAA	AAATCAGTTATGGTTCCTTTGGTC
Acc	GCACGAGATTGCTTTCCTAG	GCTTCCGCTCCAGGGTAGAGT
Atgl	CACTTTAGCTCCAAGGATGA	TGGTTCAGTAGGCCATTCCT
Fas	CTTGGGTGCCGATTACAACC	GCCCTCCCGTACACTCACTC
G6pase	AACGTCTGTCTGTCCCGGATCTAC	ACCTCTGGAGGCTGGCATTG
Hsl	CACACAGCATGGATTTACGCA	ACCTGCAAAGACGTTGGACAG
Pepck	CTCACCTCTGGCCAAGATTGGTA	GTTGCAGGCCCAGTTGTTGA
Scd-1	ACCCATCCGGTGAGACAGGA	GGGGCACCTTCTTCATCTTC
Srebf1	GGAGCCATGGATTGCACATT	AGGAAGGCTTCCAGAGAGGA

2.3 Oral glucose tolerance test (OGTT) and intraperitoneal insulin tolerance test (IPITT)

Both the OGTT and the IPITT were performed on animals that were fasted for 12 h. For OGTT, glucose (Otsuka Glucose Injection, Tokyo, Japan) was administered by gavage at a dose of 2 g/kg. For IPITT, insulin (Humulin N; Eli Lilly Japan, Kobe, Japan) was injected at a dose of 0.75 units/kg. Glucose was quantified using the LAB Gluco (Bio-Medical Science. Tokyo, Japan).

2.4 Plasma measurements

Plasma non-esterified fatty acids (NEFA) were determined by enzymatic assay kits from LabAssay™ series (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan). Serum insulin was quantified using an ELIZA kit (Morinaga Co., Kanagawa, Japan). Plasma zinc and copper concentrations were measured using ACCURSAUTO zinc and QUICK AUTO NEO copper kit (Shino-Test Corporation, Kanagawa, Japan), respectively.

2.5 Immunohistochemistry

Pancreatic and adipose tissues were harvested and immediately fixed in 10% Formaldehyde Neutral Buffer Solution (Nakalai Tesque, Kyoto, Japan). The pancreatic sections were analyzed using immunohistochemistry. The pancreatic sections (6 µm) were incubated overnight at 4°C with each type of antibody shown in Table 5. After overnight incubation, the sections were washed and incubated with Dako EnVision™+ Dual Link System-HRP (Agilent, CA, USA) at 23℃ for 1 h. The sections were developed using 3, 3'-Diaminobenzidine (DAB), counterstained with hematoxylin, and examined using an Olympus BX53 microscope (Olympus, Tokyo, Japan). The markers and antibodies used have been listed in Table 5. Several markers were used to identify the immune cell types—Cd11b/c: dendritic cells, Cd163: M2-type macrophages, Cd169: M1-type macrophages, Cd68: total macrophages and myeloperoxidase: neutrophils. Collagen I and α-SMA were used to determine fibrosis, and insulin to identify pancreatic β cells.

Table 5

Markers and antibodies used for immunostaining
Marker	Source	Supplier	Diluation, Incubation
Cd11b/c	Mouse monoclonal to Cd11b/c	Abcam PLC, Cambridge, UK	1:100, O/N
Cd163	Mouse monoclonal to Cd163	BMA Biomedicals Ltd., Augst, Switzerland	1:100, O/N
Cd169	Mouse monoclonal to Cd169	BMA Biomedicals Ltd., Augst, Switzerland	1:100, O/N
Cd68	Rabbit polyclonal to Cd68	BMA Biomedicals Ltd., Augst, Switzerland	1:60, O/N
CollagenⅠ	Rabbit polyclonal to CollagenⅠ	Abcam PLC, Cambridge, UK	1:1, O/N
Insulin	Rabbit polyclonal to Insulin	Bioss, MA, USA	1:100, O/N
Myeloperoxidase	Rabbit polyclonal to Myeloperoxidase	Abcam PLC, Cambridge, UK	1:100, O/N
αSMA	Mouse monoclonal to αSMA	BioGenex, CA, USA	1:10, O/N

2.6 Statistical analysis

Values are reported as mean ± SEM. Statistical differences were determined by either one-way ANOVA or Student’s t-test using GraphPad Prism 9. Statistical significance is displayed as follows: *p < 0.05, **p < 0.01, ***p < 0.001 for ZnC vs. ZnD, ZnC vs. ZnDC, or ZnD vs. ZnDC. And ns stands for not statistically significant.

3.1 Zinc-deficiency depresses blood insulin levels

The male Sprague-Dawley rats were divided into three groups on the basis of the diet: ZnC (normal diet) group, ZnD (zinc deficient diet) group, and ZnDC (zinc deficient diet followed by normal diet) group (Fig. 1a). We first evaluated serum zinc and copper levels in these rats. In the ZnD group, low zinc levels were observed, reflecting the zinc content of the feed (Fig. 1b). No differences were observed in the copper levels among the three groups (Fig. 1c), but when measured as the ratio of copper to zinc, there was an increase in the ratio of Cu/Zn in the ZnD group (Fig. 1d). The serum insulin levels in the ZnD group were lower than those observed for the ZnC group. However, the serum insulin levels in the ZnDC group did not get restored despite zinc supplementation (Fig. 1e). No significant change was observed in the pancreatic weight among the three groups (Fig. 1f).

3.2 Zinc-deficiency decreases pancreatic beta cell levels via pancreatic inflammation

Next, we focused on the pancreatic islets of Langerhans βcells, which are responsible for insulin secretion. The distribution of the pancreatic β cells was quantified using immunostaining. As a corollary to the amount of insulin in the blood, the number of pancreatic β cells in the ZnD group had decreased. In the ZnDC group, the number of β cells, same as the insulin level, were also not restored(Figure 2a and b). Our next focus was inflammation as a reason for the decrease in pancreatic β cells, and we studied the distribution of immune cells. We first analyzed macrophage infiltration using Cd11b/c and Cd68 markers. Previous studies have reported that Cd11b and Cd68 are expressed in inflamed pancreas [17, 18]. We observed that these markers were distributed widely in the pancreas of the ZnD group (Fig. 2a, c, and d).

Furthermore, the ratio of M1-type macrophages, working in the pro-inflammatory direction, to M2-type macrophages, working in the anti-inflammatory direction, was dominant in the pancreas of the ZnD group (Fig. 2a, e, f, and g). Neutrophil counts, which are indicative of inflammatory levels, had also increased in the ZnD group (Fig. 2a and h).

3.3. Zinc deficiency has no effect on glucose tolerance or insulin resistance, but alters lipid metabolism in the liver.

In an earlier study, we have shown that zinc deficiency induces pancreatic dysfunction at the histological level. Next, we performed an animal experiment using model rats that were fed a normal or zinc-deficient diet (Fig. 3a). During the course of the study, we observed the effects insulin deficiency induced on glucose intolerance and insulin resistance (Fig. 3a). First, we evaluated the gain in body weight and the weight of metabolically relevant organs to explore changes in metabolic parameters. The results showed decreased body weight for the ZnD group (Fig. 3b), and the weight loss was found associated with a significant reduction in the weight of the white adipose tissue (Fig. 3b). The effects on glucose tolerance and insulin sensitivity were determined by performing the OGTT and an IPITT tests. The OGTT and IPITT results showed that the zinc-deficient diet did not induce glucose intolerance or insulin resistance (Fig. 3c and d). Also, no difference was observed in the area under the curve (AUC) (Fig. 3c and d). Zinc deficiency altered the pancreatic function but had no effect on the development of glucose metabolism or the development of insulin resistance. Next, we studied the liver glucose metabolism. It has been reported that glucose tolerance is affected by gluconeogenesis in the liver [19].We measured the glycogenic rate-limiting enzymes[20]: phosphoenolpyruvate carboxykinase (Pepck) and glucose 6-phosphatase (G6pase)using qPCR. The results showed suppressed glycogenesis in the ZnD group (Fig. 3e). Hepatic lipid synthesis genes are known to be regulated by insulin. We found that the expression of SREBP1c, the master regulator of lipid metabolism, and its downregulated genes, acetyl-CoA carboxylase (Acc), fatty acid synthase (Fas), and stearoyl-CoA desaturase 1 (Scd-1), were significantly downregulated in the zinc-deficient group. These results reflected the insulin levels (Fig. 3e).

3.4 Zinc-deficiency causes metabolic changes in the insulin-target organs.

Next, we turned our attention to the insulin-target organs. Zinc deficiency resulted in weight loss over the course of the treatment period (Fig. 3a). This finding is consistent with that of a previous study [1]. In particular, we observed a significant reduction in the adipose tissue (Figure. 3b), and the next step was to evaluate the reason for this decrease in the WAT weight. We measured hormone-sensitive lipase (Hsl) and adipose tissue triglyceride lipase (Atgl), the enzymes that induce lipolysis. These lipolysis genes were found up-regulated in the zinc-deficient group. Hsl and Atgl, which control lipolysis [21], are regulated by insulin and are known to be inhibited by insulin secretion. These results suggested that lipolysis may have been accelerated by insulin deficiency, indicating a lipolysis feedback (Fig. 4a). We also observed that the free fatty acid levels in the blood tended to increase with increasing zinc deficiency. These results reflected an increase in the levels of the lipolytic enzymes (Fig. 4b). In contrast, fatty acid synthesis was found promoted in the WAT (Fig. 4a).

In this study, we found that dietary zinc deficiency and reduced zinc levels in rats resulted in decreased insulin secretion. Consequently, the decrease in insulin level led to changes in metabolism and inter-organ crosstalk.

The decrease in insulin levels due to zinc deficiency may be attributed to the morphological changes in insulin-secreting β cells, as determined by immunohistochemical analysis. The result that zinc deficiency causes morphological changes in pancreatic β cells and attenuates insulin secretion is supported not only by the fact that the number of pancreatic β cells was found reduced under zinc deficiency but also by the fact that the numbers did not return to normal on zinc supplementation.

Insulin levels and pancreatic β cell numbers did not return to normal in the ZnDC group. We believe that these are related to the histological changes in the β cells, and may be attributed to a decrease or atrophy of the β cells at the histological level in the ZnD group after 6 weeks of zinc deprivation. It was also observed that the histological changes induced here were not restored to normal after 4 weeks of zinc supplementation, and concomitantly, the insulin levels were also not restored. Although it has been shown that zinc is involved in insulin secretion and storage in the pancreas, it is not clear whether chronically low zinc levels, in vivo, could result in histological changes in the pancreatic β cells. The results of this study provided new insights.

A possible explanation for the β cell morphological changes caused by zinc deficiency could be the induction of inflammation in the β cells. Previous studies have reported that inflammation causes β cell dysfunction. In the present study, we observed that the expression of myeloperoxidase and the ratio of M1-type macrophages with pro-inflammatory effects, to M2-type macrophages with anti-inflammatory effects, were upregulated in the pancreas of zinc-deficient rats. These results suggested that inflammation may be promoted. Chronic inflammation is known to lead to fibrosis, although we found no change in fibrosis (Supplementary Figure a-c).

It may also be considered possible that due to the deficiency of zinc, the pancreatic β cells may have degenerated because zinc is necessary for the formation of the crystal structure of insulin.

We also focused on the cause of pancreatic inflammation and lipotoxicity may be considered a possibility. The influx of FFA due to lipolysis or an increase in inflammatory cytokines, due to adipocyte hypertrophy, resulting in impairment of β cell function[11] may also be involved in this process.

It has been reported that the Cd11b and F4/80 markers are expressed in type 2 diabetic mice fed a high-fat diet, and their expression leads to the induction of inflammatory cytokines, resulting in impaired glucose tolerance [22]. It has also been reported that administration of FFA: palmitic acid, via intravenous infusion in mice causes decreased insulin secretion and dysfunction of pancreatic β cells. This mechanism involves FFAs inducing the secretion of chemokines via pancreatic TRL4, causing Cd11b-positive and Lyc6-positive M1-type macrophages to accumulate and cause inflammation[9].

In our study, FFA levels in the blood of the zinc-deficient models tended to increase, and the expression of Cd11b and M1 macrophage markers were also observed to increase in the pancreas. These findings are similar to the condition in which the pancreatic islet function is impaired, suggesting that fatty acids may cause pancreatic inflammation. Zinc deficiency induces lipolysis in the WAT. This is a condition similar to diabetics [23], as it has been reported that when insulin secretion is impaired in patients with diabetes, lipolysis is accelerated, and weight loss occurs. The increase in fat-derived fatty acids and the spillover of inflammation into β cells may be explained as a phenomenon mediated by metabolic abnormalities caused by insulin deficiency[9].

Changes in the lipid metabolism in the adipose tissue also explain the previously reported weight loss in zinc-deficient diets. Previous studies have shown that zinc deficiency in model rats results in weight loss despite no change in food intake [24]. This study provides the evidence that zinc deficiency induces weight loss by regulating insulin-mediated lipolysis.

In this study, lipid synthesis was found enhanced in the adipose tissues, such as Acc, Fas, Sad-1, and Srebf1. This could be interpreted as an imbalance in the lipid metabolism due to the dysfunction of adipocytes [25]. Increased lipolysis and lipogenesis are also associated with adipose tissue dysfunction.

Development of glucose intolerance or insulin resistance was not observed in the results, despite the reduction in pancreatic β cells and insulin secretion.

This lack of glucose intolerance may be related to the mechanism of glucose production in the liver [26]. It has been reported that gluconeogenesis in the liver is enhanced during the pathogenesis of diabetes mellitus. In our study, we did not observe an increase in gluconeogenesis in the liver. The reason for this may be that GLUT2 is an insulin-independent receptor [27], and thus, glucose uptake into the liver occurs even in the absence of insulin. The feedback mechanism of glucose metabolism in the liver, which senses increased glucose concentration, may suppress gluconeogenesis and maintain blood glucose concentration. In fact, in the PCR analysis, the expression of pepck, an enzyme involved in gluconeogenesis, decreased in the presence of zinc deficiency, supporting the above argument.

As for the reason why insulin resistance could not be confirmed, we suppose that the reason was visceral fat accumulation, which is the cause of insulin resistance. Normally, insulin resistance increases with adipose tissue gain, and lipid accumulation is part of the mechanism for inducing insulin resistance [28]. In the present study, WAT weight was markedly reduced. We believe that this did not lead to a condition that would induce insulin resistance. Since a diet high in fat promotes fat accumulation and is associated with insulin resistance, it would be interesting to determine how insulin resistance changes when the zinc content is varied using a diet high in fat.

In conclusion, our study revealed that zinc deficiency decreases insulin secretion, which is further morphologically regulated at the pancreatic β cell level. We also found that lowered insulin levels induced by zinc deficiency altered glucose and lipid metabolism in insulin-target organs and their crosstalk. These findings suggest that zinc plays a role in insulin-regulated diseases.

Acknowledgements:

We appreciate the assistance of the Department of Pathology, Jikei University School of Medicine.

Funding: This work was supported by JSPS KAKENHI (JP21K17276).
Competing interests: The authors declare no competing interests.
Author contributions: The study was conceived and designed by A.N., T.K., M.S., A.N., T.K., and Y.S. performed the experiments. A.N., T.K., Y.S., and M.S. wrote the manuscript and all authors provided critical comments on the manuscript.
Data availability: Not applicable.

Ethics approval: The animal experiments have been approved by the Animal Experiments and Ethics Committee of The Jikei University School of Medicine (approval number: 2021-059). An ARRIVE checklist is included with this article.

Consent to participate: Not applicable.
Consent to publish: Not applicable.

Kido T, Ishiwata K, Suka M, Yanagisawa H (2019) Inflammatory response under zinc deficiency is exacerbated by dysfunction of the T helper type 2 lymphocyte-M2 macrophage pathway. Immunology 156:356-372. https://doi.org/10.1111/imm.13033
Lansdown ABG, Mirastschijski U, Stubbs N, Scanlon E, Ågren MS (2007) Zinc in wound healing: theoretical, experimental, and clinical aspects. Wound Repair Regen 15:2-16. https://doi.org/10.1111/j.1524-475X.2006.00179.x
Cole CR, Lifshitz F (2008) Zinc nutrition and growth retardation. Pediatr Endocrinol Rev 5:889-896
Li YV (2014) Zinc and insulin in pancreatic beta-cells. Endocrine 45:178-189. https://doi.org/10.1007/s12020-013-0032-x
Dodson G, Steiner D (1998) The role of assembly in insulin’s biosynthesis. Curr Opin Struct Biol 8:189-194. https://doi.org/10.1016/s0959-440x(98)80037-7
Saltiel AR, Kahn CR (2001) Insulin signalling and the regulation of glucose and lipid metabolism. Nature 414:799-806. https://doi.org/10.1038/414799a
Utzschneider KM, Kahn SE (2006) Review: the role of insulin resistance in nonalcoholic fatty liver disease. J Clin Endocrinol Metab 91:4753-4761. https://doi.org/10.1210/jc.2006-0587
Kershaw EE, Hamm JK, Verhagen LAW, Peroni O, Katic M, Flier JS (2006) Adipose triglyceride lipase: function, regulation by insulin, and comparison with adiponutrin. Diabetes 55:148-157. https://doi.org/10.2337/diabetes.55.01.06.db05-0982
Eguchi K, Manabe I, Oishi-Tanaka Y, Ohsugi M, Kono N, Ogata F, Yagi N, Ohto U, Kimoto M, Miyake K, Tobe K, Arai H, Kadowaki T, Nagai R (2012) Saturated fatty acid and TLR signaling link β cell dysfunction and islet inflammation. Cell Metab 15:518-533. https://doi.org/10.1016/j.cmet.2012.01.023
Lee YE, Kim JW, Lee EM, Ahn YB, Song KH, Yoon KH, Kim HW, Park CW, Li G, Liu Z, Ko SH (2012) Chronic resveratrol treatment protects pancreatic islets against oxidative stress in db/db mice. PLOS ONE 7:e50412. https://doi.org/10.1371/journal.pone.0050412
Oh YS, Bae GD, Baek DJ, Park EY, Jun HS (2018) Fatty acid-induced lipotoxicity in pancreatic beta-cells during development of type 2 diabetes. Front Endocrinol (Lausanne) 9:384. https://doi.org/10.3389/fendo.2018.00384
Romero A, Eckel J (2021) Organ crosstalk and the modulation of insulin signaling. Cells 10:2082. https://doi.org/10.3390/cells10082082
Takao T, Yanagisawa H, Suka M, Yoshida Y, Onishi Y, Tahara T, Kikuchi T, Kushiyama A, Anai M, Takahashi K, Wakabayashi Sugawa S, Yamazaki H, Kawazu S, Iwamoto Y, Noda M, Kasuga M (2022) Synergistic association of the copper/zinc ratio under inflammatory conditions with diabetic kidney disease in patients with type 2 diabetes: the Asahi Diabetes Complications Study. J Diabetes Investig 13:299-307. https://doi.org/10.1111/jdi.13659
Sun Q, van Dam RM, Willett WC, Hu FB (2009) Prospective study of zinc intake and risk of Type 2 diabetes in women. Diabetes Care 32:629-634. https://doi.org/10.2337/dc08-1913
Wang X, Wu W, Zheng W, Fang X, Chen L, Rink L, Min J, Wang F (2019) Zinc supplementation improves glycemic control for diabetes prevention and management: a systematic review and meta-analysis of randomized controlled trials. Am J Clin Nutr 110:76-90. https://doi.org/10.1093/ajcn/nqz041
Qi Y, Zhang Z, Liu S, Aluo Z, Zhang L, Yu L, Li Y, Song Z, Zhou L (2020) Zinc supplementation alleviates lipid and glucose metabolic disorders induced by a high-fat diet. J Agric Food Chem 68:5189-5200. https://doi.org/10.1021/acs.jafc.0c01103.
Venkatesan V, Madhira SL, Malakapalli VM, Chalasani M, Shaik SN, Seshadri V, Kodavalla V, Bhonde RR, Nappanveettil G (2013) Obesity, insulin resistance, and metabolic syndrome: a study in WNIN/Ob rats from a pancreatic perspective. BioMed Res Int. 2013:617569. https://doi.org/10.1155/2013/617569
Ehses JA, Perren A, Eppler E, Ribaux P, Pospisilik JA, Maor-Cahn R, Gueripel X, Ellingsgaard H, Schneider MK, Biollaz G, Fontana A, Reinecke M, Homo-Delarche F, Donath MY (2007) Increased number of islet-associated macrophages in Type 2 diabetes. Diabetes 56:2356-2370. https://doi.org/10.2337/db06-1650
Hatting, M., Tavares, C. D. J., Sharabi, K., Rines, A. K., & Puigserver, P. (2018). Insulin regulation of gluconeogenesis. Annals of the New York Academy of Sciences, 1411(1), 21–35. https://doi.org/10.1111/nyas.13435
Im SS, Kim MY, Kwon SK, Kim TH, Bae JS, Kim H, Kim KS, Oh GT, Ahn YH (2011) Peroxisome proliferator-activated receptor α is responsible for the up-regulation of hepatic glucose-6-phosphatase gene expression in fasting and db/db mice. J Biol Chem 286:1157-1164. https://doi.org/10.1074/jbc.M110.157875
Yang A, Mottillo EP (2020) Adipocyte lipolysis: from molecular mechanisms of regulation to disease and therapeutics. Biochem J 477:985-1008. https://doi.org/10.1042/BCJ20190468
Westwell-Roper CY, Ehses JA, Verchere CB (2014) Resident macrophages mediate islet amyloid polypeptide–induced islet IL-1β production and β-cell dysfunction. Diabetes 63:1698-1711. https://doi.org/10.2337/db13-0863
American Diabetes Association (2010) Diagnosis and classification of diabetes mellitus. Diabetes Care 33(Suppl 1): S62-S69. https://doi.org/10.2337/dc10-S062
Kido T, Hachisuka E, Suka M, Yanagisawa H (2021) Interleukin-4 administration or zinc supplementation is effective in preventing zinc deficiency-induced hemolytic anemia and splenomegaly. Biol Trace Elem Res 199:668-681. https://doi.org/10.1007/s12011-020-02172-1
Saponaro C, Gaggini M, Carli F, Gastaldelli A (2015) The subtle balance between lipolysis and lipogenesis: A critical point in metabolic homeostasis. Nutrients 7:9453-9474. https://doi.org/10.3390/nu7115475
Boden G, Chen X, Stein TP (2001) Gluconeogenesis in moderately and severely hyperglycemic patients with type 2 diabetes mellitus. Am J Physiol Endocrinol Metab 280:E23-E30. https://doi.org/10.1152/ajpendo.2001.280.1.E23
Panahi M, Rodriguez PR, Fereshtehnejad SM, Arafa D, Bogdanovic N, Winblad B, Cedazo-Minguez A, Rinne J, Darreh-Shori T, Hase Y, Kalaria RN, Viitanen M, Behbahani H (2020) Insulin-independent and dependent glucose transporters in brain mural cells in CADASIL. Front Genet 11:1022. https://doi.org/10.3389/fgene.2020.01022
Samuel VT, Petersen KF, Shulman GI (2010) Lipid-induced insulin resistance: unravelling the mechanism. Lancet 375:2267-2277. https://doi.org/10.1016/S0140-6736(10)60408-4

No competing interests reported.

Supplementaryfigure.docx

Zinc deficiency alters metabolism-related organ crosstalk via changing insulin levels

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1.1 Animal Studies

2.2 mRNA Expression Analysis by Quantitative RT-PCR (qPCR)

2.4 Plasma measurements

2.5 Immunohistochemistry

2.6 Statistical analysis

3. Results

3.1 Zinc-deficiency depresses blood insulin levels

3.2 Zinc-deficiency decreases pancreatic beta cell levels via pancreatic inflammation

3.4 Zinc-deficiency causes metabolic changes in the insulin-target organs.

4. Discussion

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1