Test materials and their treatment
The experimental material was 4-year-old European grape (Vitis Vinifera L.) ‘Yatomi Rose’, which was stored in the Grape Germplasm Resource Nursery of Henan Institute of Science and Technology. New roots, tendrils, shoots and stems, mature leaves and flowers with caps are collected in May. The skins came from grapes at 2, 3, 5, 7 and 8 weeks after flowering. Hormones and stress treatment materials were obtained from 1-year-old cuttings, which were stored in a greenhouse. Plastic pot size was 25 cm high and diameter was 30 cm. The cultivation substrate was garden soil: peat soil =1:1, placed in the plant incubator or incubator at 25-28 ℃, light intensity 3 000 lx, light duration 14 h light /10 h darkness.
Abiotic stress treatment: The control group was sprayed with sterile water, covered with white plastic bags, and the leaves were harvested at 0, 1, 2, 3, 4, 5, 7 and 9 days after treatment; Dryness treatment started when the water content of basin soil was 70%, and leaves were harvested 0, 1, 2, 3, 4, 5, 7 and 9 days after treatment; Under low temperature treatment, potted seedlings were placed in 4 ℃ light incubator, and the leaves were harvested at 0, 3, 6, 9, 12, 24, 48 and 72 h after treatment; High-salt treatment, with 0.1mol /L NaCl irrigation once, until the basin bottom solution outflow, leaves were harvested at 0, 3, 6, 9, 12, 24, 48 and 72 h after treatment.
Hormone treatment: Four to six leaves of lower tip were uniformly sprayed with 7 kinds of hormones in a spray can. The control group was sprayed with sterile water and covered with a white plastic bag. The leaves were harvested at 0, 3, 6, 9, 12, 24, 48 and 72 h after treatment. The growth regulator concentration is: 500 mmol/L IAA (purity >=99%), 120 μmol/L GA(purity >=95%), 100 μmol/L 6-BA (purity >=99%), 3mmol/L Eth (purity >=85%), 100 μmol/L ABA (purity >=99%), 100 μmol/L SA (purity >=99%), 50 μmol/L MeJA (purity >=95%) solution.
All the treated materials were immediately frozen in liquid nitrogen and stored in -80 ℃ refrigerator. All the above experiments selected ‘Yatomi Rose’ grape plants with the same growth potential. Each treatment was repeated for 3 times, and each pot was used as a replicate.
Methods
RNA extraction and reverse transcription
RNA extraction kit (OMEGA) was used to extract total RNA from European grape leaves, with DNase Ⅰ to purify DNA for 1% agarose gel electrophoresis and concentration measurement, to ensure the integrity of RNA pollution-free (OD260/280 > 1.8, OD260/280 > 2.0). The first strand of cDNA was synthesized by MMLV reverse transcriptase (PrimeScriptTMⅡ 1st Strand cDNA Synthesis Kit) (TaKaRa, Dalian, China).
Cloning of full-length VvMYB gene
According to the European Grape Pinot Gris Genomic Database, Primer 5.0 was used to design the primers:
VvMYBB1-F:5' ggccatggcggattcgggtaaagattc
VvMYBB1-R:5' ggggtcacctcaggctggggtggacgt3'
VvMYA3-F:5' gggccatggaaaataaggggaatgtgctg3'
VvMYA3-R:5' ggggtcacctcaagaagaatgaacctgcag3'
Using cDNA from the leaves of the European grape ‘Yatomi Rose’ as a template, primerstar GXL DNA Polymerase (TAKARA) was used for PCR amplification. The reaction procedure was denatured at 95 ℃ for 2 min; 94℃ denaturation for 30s, 60℃ annealing for 30s, extension for 2 min, 30 cycles; the total extension was 10 min at 72 ℃. PCR products were recovered and sent to Shanghai Sangon Biotechnology Co., Ltd for sequencing.
Subcellular localization
The sequence 3 'and 5' of VvMYBB1 gene and VvMYBA3 gene amplified by PCR contained XBAI and KPNI restriction sites and did not contain the open reading frame sequences of the stop codon. After digestion, it was inserted into the expression vector pBI221-GFP to construct pBI221-VvMYB1-GFP and pBI221-VvMYBA3-GFP.
The inner epidermis of onion scales were exfoliated and placed on hypertonic solid MS medium for 4 h at 28 ℃. Preparation of gene gun microprojectile: Weighed 0.4-0.8 mg gold powder, disinfected with 70% ethanol, and washed with sterile water; Add 50% glycerin and set aside. Add 3-5 g plasmid carrying target gene into 6 L gold powder suspension and mix; At the same time, 4 L of spermidine 0.1M and 6 L of 2.5M CaCl2 were added to vortex for 2-3min. Ice bath for 15 min. Centrifuged at 12000rpm for 10s, supernatant was discarded, and 20 L anhydrous ethanol was added for resuspended precipitation; 20µL microprojectiles were taken with pipetting gun and evenly and rapidly coated on the bearing film. Ethanol was allowed to evaporate under natural conditions. Refer to the PSD-1000 manual for the transformation of gene gun. Fluorescence microscopy (LSM510; Carl Zeiss Thornwood, NY, USA) were observed and images were collected. The green fluorescence excitation wavelength was 488nm.
Real-time quantitative PCR
Primers designed using Primer 5.0:
VvMYB1-F:gagaagaagaggataccatcattg3'
VvMYB1-R:5' ctttttcaggtgtgtgtgccagac3'
VvMYA3-F:5' cagatggtccttgattgcgggtag3'
VvMYA3-R:5' tggttttagaatgtgtttggggtt3'
VvUFGT-R:5' gatatggcagcagagatgggg3'
VvUFGT-F:5' tgcgtgagaagagcgagttta3'
VvActin-F:5' ctggattctggtgatggtgtgagt 3'
VvActin-R:5' cagcaaggtcaagacgaaggatag3'
Real-time fluorescent quantitative PCR adopts TaKaRa company SYBR® Premix Ex TaqTM Ⅱ kit, System as follows: SYBR Premix Ex TaqⅡ 10 μL, the upstream and downstream primers were 0.8 μL each, and the cDNA template was 150 ng. Finally, the cDNA template was supplemented with double steamed water to 20μL, and each treatment had three biological replicates. A two-step method was performed on a CFX96 fluorescent quantitative PCR instrument (BioRad). The procedure was denatured at 95 ℃ for 30 s. There were 40 cycles of denaturation at 95 ℃ for 10 s and annealing extension at 60℃ for 30 s. The Actin gene of grape was used as internal reference. The relative expression level was calculated by 2-△△ct method. The fluorescence values at each time point were repeated by three techniques, and the average value was taken to make the graph.