Abl depletion via autophagy mediates the beneficial effects of quercetin against Alzheimer pathology across species

doi:10.21203/rs.3.rs-2586897/v1

Download PDF

Article

Abl depletion via autophagy mediates the beneficial effects of quercetin against Alzheimer pathology across species

https://doi.org/10.21203/rs.3.rs-2586897/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 14 Oct, 2023

Read the published version in Cell Death Discovery →

Version 1

posted

You are reading this latest preprint version

Alzheimer's disease is the most common age-associated neurodegenerative disorder and the most frequent form of dementia in our society. Aging is a complex biological process concurrently shaped by genetic, dietary and environmental factors and natural compounds are emerging for their beneficial effects against age-related disorders. Besides their antioxidant activity often described in simple model organisms, the molecular mechanisms underlying the beneficial effects of different dietary compounds remain however largely unknown. In the present study, we exploit the nematode Caenorhabditis elegans as a widely established model for aging studies, to test the effects of different natural compounds in vivo and focused on mechanistic aspects of one of them, quercetin, using complementary systems and assays. We show that quercetin has evolutionarily conserved beneficial effects against AD pathology: it prevents Aβ-induced detrimental effects in different C. elegans AD models and it reduces Aβ-secretion in mammalian cells. Mechanistically, we found that the beneficial effects of quercetin are mediated by autophagy-dependent reduced expression of Abl tyrosine kinase. In turn, autophagy is required upon Abl suppression to mediate quercetin’s protective effects against Aβ toxicity. Our data support the power of C. elegans as an in vivo model to investigate therapeutic options for Alzheimer disease.

Biological sciences/Neuroscience/Neural ageing

Health sciences/Medical research/Experimental models of disease

Abeta

Abl Tyr Kinase

Alzheimer

Autophagy

C. elegans

Quercetin

Aging is a complex biological process concurrently shaped by genetic, dietary and environmental factors [1]. The aging process is characterized by progressive accumulation of damage to intracellular structures with consequent decline of different physiological functions leading to time-dependent increase in frailty and probability to die. The aging population of the industrialized world has exponentially grown in the last few decades thanks to the extension of the average human lifespan. Despite being a positive trend, this is unfortunately also associated with the increased appearance of different comorbidities and disabilities, which represent a huge economic and societal burden. Aging is indeed considered one of the most important risk factors for the development and progression of a variety of disorders ranging from cancer to cardiovascular and neurodegenerative diseases. Therefore, there is an urgent need to understand the molecular mechanisms underlying the degenerative processes occurring during aging to develop targeted strategies to delay or prevent the occurrence of age-associated pathologies. Alzheimer's disease (AD) is the most common age-associated neurodegenerative disorder and the most frequent form of dementia in our society [2]. AD is ascribed to the accumulation of toxic Aβ peptide, which derives from pro-amyloidogenic proteolytic processing cleavage of the amyloid precursor protein (APP). APP is synthesized as an immature precursor protein (iAPP) and the following post-translational modification (e.g. glycosylation, phosphorylation) primarily occurring in the Golgi and trans-Golgi apparatus, influence its consequent intracellular distribution. Mature APP (mAPP) is a transmembrane protein with the C-terminus located in the cytosol and its N-terminus in the lumen of different cellular vesicular compartments or in the extracellular space. A small fraction of mAPP is transported to the plasma membrane while the rest follows three different pathways: degradation into the endosome-lysosome compartment (most common), recycling to the cellular surface or retrograde transport to the trans-Golgi apparatus. mAPP either at the cellular or vesicles surface can then follow pro- or anti-amyloidogenic processing depending on whether it is initially cleaved by α- or β-secretase respectively, leading to the formation of soluble N-terminal APPα and APPβ fragments and to membrane C-terminal-fragments (CTFs) APP-CTFα and APP-CTFβ. The first cleavage is then followed by an additional cleavage of APP-CTFα and APP-CTFβ by the γ-secretase, which ultimately leads to the production of either p3 or Aβ in the extracellular milieu or vesicles’ lumen, and to the APP intracellular domain (AICD) in the cytosolic compartment [3, 4]. Therefore, the amount of secreted Aβ peptide is a very sensitive readout correlating with disease pathology and it represents an important endpoint to evaluate the potential protective or detrimental properties of interventions for AD pathogenesis. AD has been primarily ascribed to accumulation of Aβ-fibrillar plaques in the brain but accumulating evidence are also revealing neuronal damage due to intracellular Aβ peptides and oligomeric deposits [5]. Indeed, in the past decades it became clear that intermediate Aβ-oligomers, rather than Aβ-fibrils, represent the most dangerous and neurotoxic forms of Aβ aggregates. Thus, while in the past most therapeutic strategies were revolved towards prevention of APP pro-amyloidogenic cleavage and Aβ aggregation, additional strategies nowadays point towards shifting the oligomeric to fibrillar forms to prevent their toxic effects [6, 7]. Post transcriptional modifications of both APP and Aβ have been described which influence their intracellular processing ultimately dictating their pathogenic potential [8]. In particular, phosphorylation is one of the most common post-translational modifications to regulate protein turnover and functions and, the expression and activity of both receptor tyrosine kinases (e.g. Insulin Receptor) and of non-receptor tyrosine kinases (e.g. c-Src and c-Abl) are modulated during aging and are aberrantly upregulated in age-associated neurodegenerative disorders [9–11]. In line with these observations, recent studies pointed to Abl tyrosine kinase as a promising therapeutic target for AD [12–14] but the underlying molecular mechanisms have been only partially elucidated so far.

In the last 50 years, also thanks to the exponential growth of research exploiting simple but powerful model organisms as more feasible alternatives to primate longevity studies, our knowledge of molecular mechanisms underlying the aging process has enormously improved [15, 16]. An emblematic example is represented by the nematode Caenorhabditis elegans, that, thanks to its short lifespan and evolutionarily conserved genome, metabolic and signaling pathways, became instrumental for aging research leading to the identification of most genes and interventions nowadays known to modulate the aging process [17, 18]. Different C. elegans strains overexpressing human pathogenetic Aβ peptide under muscle or neuronal specific promoters have been generated and are extensively used as alternative and powerful AD models to unravel molecular mechanisms underlying Aβ toxicity as well as for preclinical testing of potential therapeutic [19–21]. Besides classical pharmacological approaches, nutraceuticals and plant-derived natural compounds are raising interest for their potential beneficial, pro-health effects especially against chronic diseases and aging. A vast literature indicated beneficial roles for specific food components (e.g. resveratrol, curcumin, spermidine) on age-related disorders such as cancer, diabetes or cardiovascular diseases and demonstrated their pro-longevity effects in simple model organisms such as C. elegans. The protective effects of these natural polyphenols have been in many cases ascribed to their antioxidant activity. Moreover, induction of autophagy, a key process for the recycling of old or damaged cellular components, has been also in some cases identified as a common denominator of the protective effects of different dietary interventions [22–26]. Nonetheless, besides their antioxidant and pro-autophagic role, little is known about more precise molecular mechanisms underlying natural compounds pro-health effects.

Here, we exploited well-established C. elegans models for AD to test the beneficial effects of different natural compounds in vivo and focused on mechanistic aspects of one of them, quercetin, using complementary systems and assays. We found that quercetin has evolutionarily conserved beneficial effects against AD pathology: it prevents Aβ-induced detrimental effects in the different C. elegans AD models and it reduces Aβ-secretion in mammalian cells. Mechanistically, an unbiased transcriptomics approach revealed phosphorylation/dephosphorylation-related processes are over-represented in quercetin treated animals. Of note, we found that reduced expression of Abl tyrosine kinase mediates the beneficial effects of quercetin and protects against Aβ-induced toxicity in C. elegans. Importantly, we showed that Abl expression is reduced by quercetin in cellular model of AD in an autophagy-dependent manner. Accordingly, suppression of autophagy prevented the beneficial effects of quercetin against Aβ-induced toxicity in C. elegans only in the presence of Abl. Moreover, we found autophagy is also required to mediate the beneficial effects of Abl suppression against Aβ toxicity. Overall, we demonstrate that quercetin has a protective activity against AD pathological features across species and suggest a positive feedback loop between Abl depletion and autophagy induction underlies its beneficial effects. Moreover, our data support the power of C. elegans as an in vivo model to investigate therapeutic options for Alzheimer disease.

Quercetin promotes healthspan and protects against Aβ-induced pathology in C. elegans

Plant-derived compounds, such as polyphenols and carotenoids, are emerging as promising and very feasible dietary interventions to promote healthy aging and delay the development and progression of different age-associated disorders [25, 26]. Yet, the underlying molecular mechanisms beyond their beneficial effects are still poorly characterized. The nematode C. elegans offers the unique opportunity to gain insight into compounds mode of action in a multicellular system in vivo and it is widely used for dietary intervention studies. Moreover, there exist well-established C. elegans models to study the toxic effects of aggregation prone proteins, including Aβ [3, 21], and polyphenols were already shown to protect against paralysis induced by overexpression of human amyloid-beta Aβ₁₋₄₂ under muscle specific promoter [27–29] (a strain which we will refer to as mAD in this study). Here we used a C. elegans strain expressing human Aβ₁₋₄₂ under a pan neuronal promoter [30] (which we will refer to as nAD in this study) to test the protective effects of two flavonoids, quercetin and epigallocatechin gallate (EGCG), and of two carotenoids, lutein and lycopene. Compared to wild-type animals, Aβ-neuronal expression significantly reduced neuromuscular activities, such as body bends and attraction to food, as well as animals’ resistance to stress (Fig. 1A-C, black bars and lines; Table 1). However, differently from previously published findings [30], we did not observe significant differences on lifespan between wild-type and nAD C. elegans strains (Fig. 1D, black lines; Table 2). Attraction to food was much more dramatically affected than animal movement, the former likely reflecting the additive negative effects of Aβ accumulation in motor and sensory neurons (Fig. 1A, B). Interestingly, while compounds feeding from embryos improved motility to the same extent in both wild-type and nAD strains (Fig. 1A; Figure S1A), they increased attraction to food primarily in the Aβ overexpressing animals (Fig. 1B; Figure S1B). This may indicate a specific protective effect in certain type of neurons only in the compromised background. Moreover, while quercetin significantly increased lifespan and heat-shock resistance to a similar extent in wild-type and nAD strains (Fig. 1C, D; Tables 1, 2), the other compounds mainly improved these parameters in the Aβ-overexpressing strain, at least in the conditions used in this work (Figure S1C-F; Tables 1, 2). These results indicate that while all compounds display neuronal protection against Aβ overexpression (i.e. attraction to food, Figure S1G), quercetin also promotes more general or systemic beneficial effects irrespective of neuronal damage (i.e. lifespan, Figure S1H).

Table 1

Heat shock summary
	Strain	Treatment	Mean Survival (hours)	Standard Error	P vs untreated*	P vs wt	Total/Censor	N
Figure 1C	GRU101 (wt)	-	6.9	0.1			52/15	3
		Quercetin [100µM] (Q)	6.1	0.2	0.04		49/15	3
	GRU102 (nAD)	-	6.9	0.1		ns	48/12	3
		Quercetin [100µM] (Q)	7.4	0.2	0.04	0.03	52/15	3
Figure 3A	GRU101 (wt)	-	7.1	0.3			34/5	3
		Imatinib [1 µM] (STI)	7.9	0.3	0.03		33/6	3
	GRU102 (nAD)	-	5.7	0.3		0.01	34/2	3
		Imatinib [1 µM] (STI)	7.1	0.3	0.01	ns	32/4	3
Figure 3B	NV48 (wt)	-	7.2	0.2			48/4	4
		abl-1 RNAi	7.5	0.2	ns		52/4	4
	NV49 (nAD)	-	6.4	0.2		0.03	53/2	4
		abl-1 RNAi	6.9	0.2	ns	ns	59/3	4
Figure 3C	NV48 (wt)	-	7.1	0.3			45/9	4
	NV50 (abl-1 KO)	-	6.3	0.3		0.01	51/7	4
	NV49 (nAD)	-	5.7	0.3		0.002	44/2	4
	NV51 (nAD;abl-1 KO)	-	6.3	0.3		ns	43/3	4
FIG S1 D,F	GRU101 (wt)	-	7.9	0.2			50/14	3
		Lutein [100 µM]	8.8	0.1	< 0.0001		58/22	3
		Lycopene [4.6 µM]	8.7	0.1	0.003		54/18	3
		EGCG [0.64 µM]	8.8	0.1	0.0007		56/20	3
	GRU102 (nAD)	-	7.1	0.2		0.003	50/14	3
		Lutein [100 µM]	8.5	0.1	< 0.0001	0.001	54/18	3
		Lycopene [4.6 µM]	8.3	0.1	< 0.0001	ns	53/17	3
		EGCG [0.64 µM]	8.5	0.1	< 0.0001	ns	55/19	3
FIG S2A	NV48 (wt)	Imatinib [1 µM] (STI)	7.9	0.3			33/6	3
	NV49 (nAD)	Imatinib [1 µM] (STI)	7.1	0.4		ns	32/4	3
	NV51 (nAD;abl-1 KO)	Imatinib [1 µM] (STI)	7.6	0.3	ns	ns	35/6	3
*Pairwise comparisons using Log-Rank test

Table 2

Lifespan summary
	Strain	Treatment	Mean Lifespan (days)	Standard Error	P vs untreated*	P vs wt	Age at 100% mortality (days)	Total/Censor	N
Figure 1D	GRU101 (wt)	-	16.9	0.4			31	181/7	3
		Quercetin [100µM] (Q)	19.7	0.5	0.0001		35	180/10	3
	GRU102 (nAD)	-	16.1	0.3		ns	29	180/4	3
		Quercetin [100µM] (Q)	19.3	0.4	< 0.0001	ns	34	184/10	3
Figure 4A-B	NV48 (wt)	-	20.5	0.5			37	200/18	3
		Quercetin [100µM] (Q)	24.1	0.5	< 0.0001		42	200/16	3
	NV50 (abl-1 KO)	-	19.7	0.4		ns	34	200/10	3
		Quercetin [100µM] (Q)	21.9	0.5	0.0011	ns	40	200/16	3
	NV49 (nAD)	-	18.1	0.4		0.002	32	200/18	3
		Quercetin [100µM] (Q)	22.0	0.5	< 0.0001	ns	40	200/14	3
	NV51 (nAD;abl-1 KO)	-	22.6	0.5		0.0295	40	200/12	3
		Quercetin [100µM] (Q)	23.3	0.5	ns	ns	40	200/11	3
FIG S1 C, E	GRU101 (wt)	-	19.1	0.5			31	140/6	3
		Lutein [100 µM]	20.6	0.5	ns		35	140/2	3
		Lycopene [4.6 µM]	20.4	0.4	ns		31	140/6	3
		EGCG [0.64 µM]	19.5	0.4	ns		31	140/5	3
	GRU102 (nAD)	-	18.8	0.4		ns	28	140/4	3
		Lutein [100 µM]	20.5	0.5	< 0.0001	ns	33	140/4	3
		Lycopene [4.6 µM]	21.7	0.4	< 0.0001	ns	33	140/2	3
		EGCG [0.64 µM]	21.2	0.4	0.0005	0.02	31	140/1	3
*Pairwise comparisons using Log-Rank test, P adjusted using the Bonferroni method.

Quercetin treatment and Abl depletion similarly impact on phosphorylation-related processes

In search of pathways modulated by quercetin which could help protecting against Aβ toxicity we compared the gene expression profile of untreated wild-type animals with that of animals treated with pro-longevity doses of quercetin. Gene ontology analysis of the 568 genes significantly modulated by quercetin, revealed that phosphorylation and dephosphorylation processes, as well as processes associated with misfolded protein responses are among the top 20 most represented terms (Fig. 2A). Loss of protein homeostasis is one of the hallmarks of the aging process [1] and phosphorylation is one of the most common post-translational modifications to regulate protein turnover and activity. Accordingly, the expression or activity of different kinases is affected during aging and in age-associated neurodegenerative disorders [9–11]. Of note, Abl tyrosine kinase was found aberrantly upregulated in AD and its inhibition was shown to provide beneficial effects in different AD models [12–14]. We thus hypothesized quercetin protection may be mediated by Abl modulation. To address this possibility, we first analyzed the gene expression profile of an available C. elegans abl-1 (ok171) mutant strain in search of a common transcriptomic signature induced by quercetin treatment and Abl depletion. The analysis of significantly modulated genes and gene ontology processes revealed a completely different pattern of gene expression in abl-1 mutants compared to quercetin treated wild-type animals (Fig. 2A, B), which indicates a role for ABL-1 in defense and immune response against external agents. Yet, we found 171 genes (157 up and 14 down) in common between the two conditions enriched in phosphorylation-related pathways (Fig. 2C), and, for the most part, regulated in the same direction (Fig. 2D; Table 3). This analysis indicates that while quercetin treatment and Abl depletion impact on different intracellular processes, they also act through, or converge on, commonly regulated genes, suggesting quercetin may indeed promote beneficial effects via Abl suppression.

Abl suppression mediates the beneficial effects of quercetin against Aβ-induced pathology

We then addressed whether Abl suppression could indeed have, similar to mice [12], a protective role in C. elegans AD models. As described above, overexpression of neuronal Aβ decreases animals’ resistance to heat shock (Fig. 3A-C, survival time at 35°C; Table 1) and locomotion activity (Fig. 3D-F, number of body bends/minute). Remarkably, we found that pharmacological inhibition of the C. elegans Abl homolog, ABL-1, with imatinib (STI) or its genetic depletion via silencing (abl-1 RNAi) or knock-out (abl-1 KO), significantly improve survival upon heat-shock (Fig. 3A-C; Table 1) and locomotion activity (Fig. 3D-F) in the nAD strain. Moreover, according to a previous study (which used a strain expressing Aβ under a different neuronal promoter [31]), we showed here that neuronal Aβ overexpression sensitizes animals to serotonin-induced paralysis and, most importantly, this defect is also rescued by pharmacological or genetic suppression of abl-1 (Fig. 3G-I; Table 4). It is worth noting that abl-1 suppression had negligible effects in the control strain not expressing Aβ, on stress resistance, locomotion or serotonin-induced paralysis (Fig. 3A-I; Tables 1, 4).

Table 4

Serotonin assay summary
	Strain	Treatment	Mean Immobilizing time (minutes)	Standard Error	P vs untreated*	P vs wt	Total/Censor	N
Figure 3G	GRU101 (wt)	-	15.6	0.9			39/20	4
		Imatinib [1 µM] (STI)	13.7	0.8	ns		65/30	4
	GRU102 (nAD)	-	10.0	0.6		< 0.0001	52/0	6
		Imatinib [1 µM] (STI)	12.6	0.7	0.04	ns	84/30	6
Figure 3H	NV48 (wt)	-	14.4	0.6			88/41	6
		abl-1 RNAi	13.4	0.7	ns		78/29	6
	NV49 (nAD)	-	9.6	0.5		< 0.0001	76/0	6
		abl-1 RNAi	12.5	0.7	< 0.0001	ns	88/2	6
Figure 3I	NV48 (wt)	-	14.6	1.0			39/16	3
	NV50 (abl-1 KO)	-	12.9	1.2	ns	ns	31/11	3
	NV49 (nAD)	-	9.0	0.8		0.001	30/0	3
	NV51 (nAD;abl-1 KO)	-	11.7	1.0	0.02	0.01	33/5	3
FIG S2C	NV48 (wt)	-	14.6	1.0			39/16	3
		Imatinib [1 µM] (STI)	15.0	0.8	ns		51/25	4
	NV49 (nAD)	-	9.0	0.8		< 0.0001	30/0	3
		Imatinib [1 µM] (STI)	11.2	0.8	0.007	0.002	59/12	4
	NV51 (nAD;abl-1 KO)	-	11.7	1.0		0.01	33/5	3
		Imatinib [1 µM] (STI)	12.4	0.7	ns	0.009	64/16	4
*Pairwise comparisons using Log-Rank test

To further investigate the protective effect of Abl suppression against AD pathology, we then looked at another neuronal readout affected by Aβ toxicity. Namely, expression of human Aβ under a muscle specific promoter was previously shown to impair animals’ sensing and habituation (learning) ability [32]. Consistent with previous findings we observed that wild-type animals have normal chemosensory function (AWA neurons-mediated attraction towards benzaldehyde) suppressed after training with pre-exposure to the same compound (Fig. 3J-L, first two black bars). Instead, we found that similar to muscle Aβ expression also neuronal Aβ expression significantly impaired animals’ chemotaxis index and completely abolished their learning ability (Fig. 3J-L, compare wild-type and AD black bars). Pharmacological suppression of Abl activity with STI did not affect animals’ basal chemotaxis or learning activity in the wild-type strain while its genetic depletion had a mild but significant impact (Fig. 3J-L, compare pink and black plain bars). Strikingly, Abl suppression restored animals’ chemosensory function as well as learning ability in the AD strain, especially upon genetic depletion (Fig. 3J-L, compare black and pink striped bars). To verify whether STI is actually protecting against Aβ-induced pathology via ABL-1 inhibition, we then couple pharmacological and genetic suppression of Abl in the AD model. Remarkably, in support of a specific protection against Aβ-induced pathology via ABL-1 inhibition, STI did not provide additional beneficial effects in the absence of abl-1, in most of the assessed parameters affected by neuronal Aβ expression (Figure S2A-D; Tables 1, 4).

These data clearly support a protective role of Abl suppression against human Aβ toxicity. Moreover, they indicate that Abl depletion provides specific beneficial effects in the Aβ compromised background whilst not affecting neuromuscular parameters (e.g. sensory or locomotion abilities) in otherwise wild-type animals, which differs from the more generic beneficial effects promoted by quercetin (Fig. 1). In further support of a specific protective effect, abl-1 knock-out per se did not affect lifespan in the otherwise C. elegans wild-type strain (Fig. 4A; Table 2) while extending lifespan in the nAD strain (Fig. 4B; Table 2). Most importantly, while quercetin extended lifespan in both the wild-type and the nAD strain, it could not do so in the in the absence of abl-1 in none of the two strains (Fig. 4A-B; Table 2).

Table 5

Paralysis assay summary
	Strain	Treatment	Mean paralysing time (hours)	Standard Error	P vs untreated*	P vs (Q)	Total/Censor	N
Figure 4C-D	GMC101 (mAD)	-	75.4	3.2			86/8	3
		Quercetin [100µM] (Q)	109.4	2.1	< 0.0001		92/60	3
		abl-1 RNAi	93.9	2.8	< 0.0001		86/25	3
		abl-1 RNAi; Quercetin [100µM] (Q)	91.4	2.8	0.000	< 0.0001	95/27	3
		Imatinib [1 µM] STI	91.7	3.1	< 0.0001		93/34	3
		Imatinib [1 µM] STI; Quercetin [100µM] (Q)	96.3	3.0	< 0.0001	0.004	91/39	3

To further support the protective effect of quercetin against Aβ expression via Abl suppression, and exclude non-specific effects ascribed to strain background, we then moved to the C. elegans strain with muscle Aβ overexpression. Remarkably, we found that either quercetin alone or genetic or pharmacological abl-1 suppression, significantly rescued also the paralysis induced by muscle Aβ overexpression (Fig. 4C-D; Table 5). Moreover, consistent with the lifespan results in the nAD strain, the protective effect of quercetin against muscle Aβ-induced paralysis was lost in animals with genetic or pharmacological inhibition of ABL-1 (Fig. 4C-D; Table 5).

Overall, in strong support of the beneficial role of Abl suppression, data described so far clearly showed that genetic or pharmacological approaches respectively reducing Abl expression or activity, rescue different animals’ defects induced by neuronal or muscular overexpression of toxic human Aβ in C. elegans. Moreover, they revealed that quercetin provides protection against Aβ-induced toxicity via ABL-1 suppression.

Quercetin reduces Aβ secretion in mammalian cells

We then sought to address the potential beneficial effects of quercetin also in mammalian cellular models. Aβ toxic peptide derives from pro-amyloidogenic proteolytic processing cleavage of the APP. The amount of secreted Aβ peptide is therefore a very sensitive readout correlating with disease pathology and it represents an important endpoint to evaluate the potential protective or detrimental properties of interventions for AD pathogenesis. Consistent with a protective effect, quercetin treatment reduced Aβ secretion from primary murine cortical neurons (Fig. 5A). We then took advantage of cells stably expressing a wild-type variant of APP (APP695) and found that quercetin reduces both Aβ₁₋₄₀ and Aβ₁₋₄₂ secretion in a dose-dependent manner (Fig. 5B). Reduced amount of Aβ secretion may be primarily ascribed to reduced APP levels or pro-amyloidogenic cleavage or increased Aβ degradation. We thus first analyzed the expression levels of iAPP and mAPP as well as its cleaved products CTFs. Western blot analysis indicated that quercetin significantly increases the level of iAPP in a dose-dependent manner, with a consequent but not significant decrease in its mature form as well as no changes in the CTFs amount (Fig. 5C). Moreover, cycloheximide pulse-chase experiments revealed no altered degradation pattern of mAPP while showing increased stability of iAPP (Fig. 5D), indicating quercetin may impact on processes which regulate iAPP maturation and/or degradation.

Since phosphorylation by Abl was shown to influence both APP maturation and Aβ-degradation pathways [13, 14, 33] we then wondered whether Abl depletion may mediate the beneficial effects of quercetin also in mammalian cells. Interestingly, quantification of Aβ secretion from APP overexpressing cells revealed that quercetin significantly reduces the amount of secreted Aβ (Fig. 5E). This effect was strengthened by the co-treatment with STI, which alone had however negligible effects on the amount of secreted Aβ (Fig. 5E). While the lack of STI effect alone on Aβ secretion could be a dose dependent effect, this data might instead imply that Abl suppression in mammalian cells may protect against Aβ toxicity cooperating with quercetin on different Aβ related features (production/degradation/toxicity). Consistent with this possibility while quercetin alone did not affect the amount of CTFs expression, STI alone has been shown to promote APP non-amyloidogenic cleavage and alter CTFs generation [14]. Data collected so far suggest that Abl inhibition and quercetin may differentially or in parallel impact on APP processing and Aβ toxicity in mammals. Nonetheless, considering that C. elegans APP related protein (APL-1) does not contain an Aβ sequence and the available C. elegans AD models rely on transgenic expression of the human Aβ toxic peptide [3, 21], the common beneficial effects of quercetin in cells and C. elegans must involve Abl-regulated pathways impacting on Aβ levels and/or toxicity (rather than on APP processing).

Autophagy mediates quercetin-induced Abl-suppression and Aβ-protection

To further investigate the role of Abl in the protective effect of quercetin, we then assessed its expression in cells stably transfected with an empty vector or with APP^wt. Coherently with literature [10, 34] we confirmed that Abl expression is increased by APP overexpression and most notably found that quercetin significantly reduces its expression (Fig. 6A). Interestingly, quercetin did not modulate Abl transcript expression neither in mammalian cells nor in C. elegans (Figure S3A, B). The antiaging effects of other phenolic natural compounds (e.g. resveratrol, dimethoxychalcone) has been often ascribed to induction of autophagy [35, 36], the major cellular recycling pathway. Moreover, impaired autophagic flux has been found in mammalian as well as C. elegans AD models and the autophagy-regulatory gene beclin was once reported to be required for quercetin protective effect against muscle Aβ-induced paralysis in C. elegans [12, 27, 37]. Thus, we wondered whether activation of autophagy by quercetin could mediate Abl depletion and ultimately its protective effects in vitro (reduced Aβ secretion) and in vivo in C. elegans (reduced Aβ toxicity). Consistent with this possibility, using the autophagy inhibitor chloroquine (CQ) we clearly showed that quercetin induces autophagy in cells stably expressing APP (Fig. 6B). Most notably, quercetin could not reduce Abl expression upon blockage of autophagy with CQ (Fig. 6C).

In further support of quercetin protective effects being mediated by autophagy, silencing of beclin (bec-1), a central autophagy regulatory gene, in C. elegans, completely prevented quercetin beneficial effects on motility in animals overexpressing toxic Aβ in the muscle (Fig. 6D). Somewhat unexpectedly, not only bec-1 RNAi prevented the protective effects of quercetin against Aβ-induced toxicity, but it also significantly ameliorated animals’ motility in the absence of quercetin (Figure S3C). Given the autophagy blockage observed in the different AD models [12, 37], our results imply that preventing the formation of the autophagosomes (via beclin depletion) either prompt the induction of compensatory systems facilitating Aβ degradation, or prevents the accumulation of insoluble toxic aggregates or of proteins that would favor Aβ toxicity. Our results in mammalian cells (Fig. 6B, C) suggest that Abl accumulation could be at least in part responsible for the detrimental effect of autophagy blockage in the different AD models.

Furthermore, similar to what we observed in the muscle Aβ overexpressing strain (Fig. 4C-D), abl-1 knock-out suppressed the motility defect in the nAD strain thus masking the beneficial effect of quercetin (Figure S3D). Remarkably, abl-1 depletion also completely prevented the beneficial effects of bec-1 silencing against Aβ-induced toxicity (Figure S3D). This implies that autophagy activation on the one hand mediates quercetin-induced depletion of ABL-1 and, on the other hand, it participates in the protective effect elicited by ABL-1 suppression, as also recently shown by pharmacologic inhibition of Abl in AD mice [12]. In support of autophagy being a commonly regulated pathway between quercetin treatment and ABL-1 depletion, a closer analysis of the 171 genes commonly affected between the two interventions in C. elegans, revealed an enrichment of genes targeted by TFEB/hlh-30, a master regulator of the autophagy process (Figure S3E).

Overall, our in vitro cellular data coupled to the in vivo C. elegans behavioral assays, reveal that quercetin protection against Aβ toxicity is mediated by reduced Abl expression through induction of autophagy. Moreover, they support the notion that autophagy activation concurrently specifies the beneficial effects of Abl suppression. Quercetin would therefore overcome Aβ-induced blockage of autophagy counteracting the vicious cycle which favors Abl accumulation.

Plant-derived compounds, such as polyphenols and carotenoids found in food and beverage, are emerging as promising dietary interventions to promote healthy aging and delay the development and progression of different age-associated disorders [25, 26, 38]. Their anti-aging properties are being largely discovered thanks to use of short-lived model organisms such as the nematode C. elegans but the underlying molecular mechanism, besides their antioxidant activity is poorly understood [39, 40]. In this work, using C. elegans as a powerful model organism for aging studies, we initially tested the potential protective effects of four different natural compounds against aging and AD, the most prevalent age-associated disease. We found that while EGCG, lutein and lycopene primarily display protection in animals overexpressing human toxic Aβ_1-42 in the neurons, quercetin promotes more general or systemic beneficial effects irrespective of neuronal damage. In support of our findings another study showed that lycopene protects C. elegans against muscle-Aβ induced paralysis and reduces Aβ secretion from cells overexpressing a mutant form of APP (APPsw) which is known to primarily favor its amyloidogenic processing [41]. The authors also showed that lycopene reduces ROS level and apoptosis in APPsw cells only upon peroxide or copper treatment (but not in basal conditions). Interestingly, while some studies also indicated lutein and EGCG preferentially display beneficial effects in compromised C. elegans backgrounds [42, 43], others have shown the compounds increase stress resistance and extend lifespan in wild-type animals [44, 45]. These seemingly conflicting results can be explained by different exposure scenario. Indeed, bimodal dose-dependent effects have been often reported with dietary interventions [44, 46], and different bacterial types used as food source (e.g. HT115 vs OP50; dead vs alive bacteria) can clearly influence not only animals phenotypes and behaviors in basal conditions, but also compounds metabolism and therefore their ultimate biological effects on lifespan and age-associated features [47–49]. Additional parameters used for compounds feeding such as vehicles, methods and age of administration may add further variability and differentially affect animals’ phenotypes and behaviors. In this study we observed that different experimental paradigm (e.g. +/- solvent) slightly affect resistance to stress and attraction to food in the nAD strain compared to wild-type animals. Moreover, differently from the original study [30], the nAD strain, which we fed here HT115 plus vehicle, was not short lived compared to wild-type animals. Interestingly, DMSO, the most commonly used solvent used for compound feeding, has been shown to have repercussion on a broad spectrum of animals’ phenotypes including lifespan [50–52].

Quercetin is one of the most extensively investigated polyphenols for its antiaging, anticancer and anti-inflammatory properties and even some clinical trials evaluating its beneficial effect against chronic diseases have been completed [25, 38, 53, 54]. The protective effect of quercetin against different type of stressors and aging has been also recognized in different model organisms [39, 55, 56], but its protection against age-associated neuropathologies has not been actively investigated. In this study, we showed that quercetin promotes health and lifespan in a wild-type C. elegans background as well as in animals overexpressing human toxic Aβ either in neuronal or in muscle cells. C. elegans behavioral data coupled to the observation in mammalian cells overexpressing wild-type APP, indicated that quercetin’s beneficial effect against Aβ toxicity is mediated by autophagy activation. The anti-aging effects of natural compounds has been already in some cases ascribed to autophagy induction across species [26, 35, 57]. Moreover, autophagy activation was shown to protect against toxicity induced by Aβ and polyglutamine aggregates or overexpression of a mutant superoxide dismutase in the respective C. elegans disease models, namely AD [37], Huntington disease (HD) [58] and Amyotrophic Lateral Sclerosis (ALS) [59]. Interestingly, along with other degradation pathways, autophagy is involved in shaping up synaptic structure and function contributing to memory formation [60, 61], and early impairments of synaptic plasticity and neuronal connectivity have been described as the initial events underlying the memory loss and cognitive decline typically found in AD patients [62–65]. Maintenance of synaptic activity is a highly demanding process, which can be thus impaired during aging due to the well-established decline in mitochondrial function and turnover [66–69]. Synaptic alterations have been accordingly also described in a few C. elegans studies during aging [70, 71] or in neurometabolic disease models [43, 72–75] (including the nAD strain used in this work – our unpublished observation). Moreover, intracellular Aβ accumulation can induce mitochondrial dysfunction, which can then contribute to Aβ toxicity [76–78], and preservation of mitochondria integrity via mitochondrial autophagy can inhibit AD pathology across species [30, 77, 79–83]. Thus, hampered autophagy during aging or in the context of AD is expected to lead to synaptic dysfunction-induced memory loss and quercetin could help counteracting this early neuronal defect.

While the beneficial effects of quercetin against aging or stress have been already ascribed to autophagy induction, in this study we identified for the first time a specific autophagy target, Abl tyrosine kinase, necessary for its protective effect in the context of AD. Our RNA-Seq analysis indicates genes affected by quercetin are enriched in protein kinases and phosphatases. Several kinases are implicated in aging and age-associated pathologies across species (e.g. the insulin-like receptors, the target of rapamycin) [1], and protein kinase inhibitors were identified among the highest ranked drugs based on silico analysis in search of anti-aging compounds [84]. Interestingly, quercetin was shown to inhibit a panel of different cancer-relevant kinases [85] and, most notably different kinases have been also shown to orchestrate neuronal functions and synaptic plasticity. Specifically, Abl was shown to regulate neuronal biogenesis and signaling and a few evidence also suggest it may as well modulate synaptic formation and functionality [86, 87]. Consistent with its role in the nervous system, aberrant Abl expression or activity have been found in mammalian models of different neurodegenerative disease including AD [34, 88, 89]. Most notably, recent studies in cellular and mice models pointed to Abl tyrosine kinase as a promising therapeutic target for AD [12–14]. Accordingly, we now found that Abl suppression via genetic (RNAi or knock-out) or pharmacological (Imatinib) treatments, also has beneficial effects in C. elegans AD models. Moreover, we provided evidence that Imatinib works through Abl also in C. elegans, as its effect is masked in the abl-1 knock-out strain. Furthermore, we found that reduced Abl expression via autophagy induction, is necessary to mediate the protective effects of quercetin. The specific mechanisms through which quercetin-induced autophagy leads to Abl degradation remains to be identified. Nonetheless, it is interesting to note that, different from quercetin, Abl suppression alone neither impact on Aβ secretion in mammalian cells nor improved lifespan or neuromuscular parameters in wild-type C. elegans (as compare to its effect in the AD strains). While these results may be ascribed to our specific experimental conditions (e.g. cells-specific effects, compounds dosage or vehicles), they may as well imply that the two interventions, on top of their convergent activity, also cooperate to protect against Alzheimer pathology through independent mechanisms. This notion is consistent with their differential effects we observed on APP processing in mammalian cells. Moreover, it is supported by the fact that C. elegans APP related protein (APL-1) does not contain an Aβ sequence and available AD models rely on transgenic expression of the human Aβ toxic peptide [3, 21], rather than on increased pro-amyloidogenic processing of APP. Activation of different pathways may thus concur to protect against Aβ toxicity in parallel or downstream of Abl-suppression upon quercetin treatment.

Abl inhibition has been shown to impact on APP processing in mammals in different ways and especially through modulation of APP intracellular domain (AICD) phosphorylation, expression or activity, thus ultimately impacting on Aβ levels and toxicity [33, 90–93]. Also, some natural compounds, including quercetin, were sporadically reported to reduce APP pro-amyloidogenic processing [94–96]. While modulation of APP processing may not explain the beneficial effect of quercetin or Abl inhibition in C. elegans AD models, some of the enzymes involved in APP processing in mammals are conserved in nematode (e.g. Fe65/feh-1, neprilysin/nep-1 [3, 97, 98]) and, if affected by the two interventions, may still impact on Aβ degradation or toxicity. Natural compounds as well tyrosine kinases can modulate mitochondrial function and activate cytoprotective stress responses (e.g. mtUPR, Nrf2), which in turn could help protecting against Aβ toxicity [44, 78, 99–105]. Remarkably, in this work, we not only showed that autophagy is required for quercetin to reduce Abl expression, but also found that it is required downstream to Abl suppression to mediate its protection in C. elegans. In support of our study others have also described a beneficial effect of Abl inhibition in mammalian models of neurodegenerative disorders where Abl is aberrantly expressed/activated and the lysosomal/autophagic function is concurrently compromised [12, 106–108]. The exact mechanism through which Abl is impacting on autophagy remain to be fully elucidated but our analysis of the 171 genes in common between quercetin treated and Abl depleted animals pointed to genes controlled by TFEB/hlh-30, a master regulator of autophagy across species. In support of our findings, a handful of studies also described enhanced TFEB transcriptional activity by Abl inhibition in other neurometabolic disorders such as amyotrophic lateral sclerosis or Niemann-Pick type C disease [109, 110]. Follow up investigations on the gene expression uniquely or commonly modulated by quercetin and Abl suppression will shed light on specific targets required for their protection against Aβ toxicity.

In conclusion, we showed that quercetin, by stimulating autophagy, would reset an appropriate level of Abl tyrosine kinase whose abnormal expression contribute in a vicious cycle to the autophagy blockage observed in different AD models. How exactly autophagy reduces Abl expression and how in turn autophagy activation by Abl (possibly in a TFEB-dependent manner) protects against Aβ toxicity remain to be fully elucidated. Nonetheless, the exploitation of natural compounds rather than drugs reducing Abl activity, has clear advantages and may avoid the appearance of drugs side effects while promoting broader beneficial effects. Interestingly, the combination of quercetin plus dasatinib (a non-specific pharmacological inhibitor of Abl and Src tyrosine kinases) has been proposed as treatment to promote healthy aging thanks to their senolytic effect i.e. the ability of the treatments to specifically kill senescent cells [111–114]. While there is no evidence that senescent cells killing play a role in C. elegans aging, our findings suggest new mechanisms may underly the beneficial effect of combining quercetin and kinases inhibitors, which most likely go beyond their classical cell death activity. Thus, we overall provide strong support for exploiting C. elegans as an excellent in vivo model organism to identify possible AD pathogenic targets and therapeutics and disentangle their underlying mode of action.

Statistical analysis

The data analysis was done using Prism V9 software (GraphPad Software Inc., San Diego, USA) and R programming language (http://www.R-project.org). The statistical tests used for each experiment are detailed in the figures' legends.

C. elegans

C. elegans Strains and Culture Conditions

The following strains were used in this study:

GRU101: gnaIs1 [myo-2p::YFP],

GRU102: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42],

XR1: abl-1(ok171),

NV48: wild type isolated from crossing XR1 with GRU102,

NV49: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42] isolated from crossing XR1 with GRU102,

NV50: abl-1(ok171), isolated from crossing XR1 with GRU102,

NV51: gnaIs2 [myo-2p::YFP + unc-119p::Abeta1-42]; abl-1(ok171),

GMC101: dvIs100 [unc-54p::Abeta-1-42::unc-54 3'-UTR; mtl-2p::GFP]

All strains were maintained and kept synchronized by egg lay at 20 °C on Nematode Growth Media (NGM) agar supplemented with Escherichia coli OP50 unless otherwise indicated.

RNA-mediated interference (RNAi)

Genes of interest were silenced by feeding E. coli HT115(DE3) or OP50(xu363) expressing plasmids transformed for the specified gene, empty vector was used as control. Worms were treated with RNAi expressing bacteria from eggs till the end of the experiment, unless otherwise indicated.

Chemical Treatments

Quercetin (Q4951 Sigma-Aldrich), Lutein (PHR1699 Sigma-Aldrich), Lycopene (PHR1770 Sigma-Aldrich), Epigallocatechin gallate (ECGC) (E009 TransMit) where dissolved in a solution of Dimethylsulfoxid (DMSO, 276855 Sigma-Aldrich) containing 1% of Tween 80 (P1754 Sigma-Aldrich) and mixed with bacteria to the following concentrations: Quercetin 100µm, lutein µM100, lycopene 4.6 µM, ECGC 0.64 µM. Control worms were fed bacteria containing the same amount of solvent (0.5% DMSO plus 0.005% Tween 80) used to prepare the above compound. Serotonin (H9523 Sigma-Aldrich) treatment: worms were incubated in 200 µl of 10 mM Serotonin diluted in S-Basal. Imatinib (STI-57, SML1027 Sigma-Aldrich), was dissolved in H₂O and mixed with the bacteria to a final concentration of 1 µM.

Body bends

The movement of adult worms (3 days after egg-lay) was scored on 5 µl of S-Basal. Single worms were transfer into the 5µl S-basal drop and left adapt for 10-15 seconds before counting the bends for 20 seconds. At least 10 worms were counted for each replicate.

Lifespan

Age synchronized population of 60-80 worms were used to start the lifespan analysis. To avoid cross generation contamination, animals were transfer on fresh plates every day during the fertile phase afterward every other day. Animals not able to move upon pick-prodding and with no pharyngeal pumping were scored as dead Animals were scored as not moving when no sinusoid locomotory activity was observed anymore upon prodding. Survival analysis was performed in OASIS 2 [115] using the Kaplan Meier estimator. Statistical differences were evaluated using the log-rank test between the pooled population or worms and p-values were adjusted for multiple comparisons by Bonferroni method.

Heat shock response

The stress resistance of the different strains/treatments were tested by heat shock on 35°C for 10-11 hours. Around 10-15 age synchronized worms were transferred to fresh plates and incubated on 35 °C and the survival was scored manually every single hour until the whole population died. Animals not able to move upon pick-prodding and with no pharyngeal pumping were scored as dead Animals. Survival analysis was performed in OASIS 2 [115] using the Kaplan Meier estimator. Statistical differences were evaluated using the log-rank test between the pooled population or worms and p-values were adjusted for multiple comparisons by Bonferroni method.

Food Assay

7 days old worms were used to perform the assay. Briefly, the day before the experiment 6 cm petri dishes containing a modified version of NGM (2% agar, 1 mM CaaCl2, 1 mM Mg SO4), were marked with 2 dots about 4.5 cm apart, in one of the points 50µl of freshly grown op50 were seeded. Prior to proceed with the assay worms were washed 3-4 times with S-Basal and then placed on the opposite dot respect to the bacteria. The percentage of animal on food was calculated after 2 hours from placing the worms on the plate. Around 100-150 worms were used in each replicate in three independent experiments

Chemotaxis assay

3 days old worms were used for the assay on 9 cm petri dish containing: 2% agar, 1 mM CaCl2, 1 mM Mg SO4. Before to proceed with the assay, worms were starved for 2 hours either with (trained) or without Benzaldehyde [1%]. Meanwhile, 1µl of 1% Benzaldehyde and 1µl of 95% Ethanol, were spotted on the test plates along the diameter, spaced 3.5 cm from the center.

After the starvation period, 40-50 worms were placed on the geometric center of the test plates. The assay plates were incubated for 1 h and a chemotaxis index (CI) was scored manually using the following formula (CI = ([(#benzaldehyde)-(#Ethanol)]/[(#Total-#Center)]. #= number of worms of the specified spot. Each experiment was repeated three times [116].

Serotonin sensitivity assay

Worms were incubated in a solution of 10mM Serotonin (hypochloride) diluted in S-Basal. Briefly, 1 day old synchronized worms were collected, washed with S-Basal Buffer, and transferred to 96-well plates containing 200 µl of the Serotonin solution. The immobilized worms were then visually scored every 5 minutes for 20 minutes [31].

Paralysis assay

Nematodes’ eggs were left develop at 20 °C for 72 hours then upshifted at 25°C to promote the muscle expressed Abeta-1-42 aggregation. After 24 hours from the upshift at 25°C paralyzed worms were scored manually every 12 hours. Nematodes were considered paralyzed if they are unable to move their entire body, either on their own or when prompted by touch. For each assay, around 30 worms for conditions were used in 3 independent replicates. Paralysis analysis was performed in OASIS 2 [115] using the Kaplan Meier estimator. Statistical differences were evaluated using the log-rank test between the pooled population of worms and p-values were adjusted for multiple comparisons by Bonferroni method.

Relative speed measurement

To measure the relative speed, 25 seconds movies of worms crawling on plates were recorded and analysed with Fiji plugin wrMTrck [117, 118]. 3 days old worms, were recorded using a Raspberry HQ camera V1.0 2018, connected to a Zeiss SteREO nDiscovery.V8 stereomicroscope. All videos were captured using the same hardware and software settings.

The raw videos were converted to 8-bit and segmented using Fiji, then analysed using wrMTrck. For each condition, two plates containing approximately 20-25 worms were used to record the movies, and each experiment was repeated three times.

RNA-Seq

RNA extraction and processing

RNA was extracted from nematodes collected on day 3 from 2 large NGM plates seeded with HT115 transformed with the empty vector L4440. Approximately 1000 worms were collected per condition and were frozen in nuclease-free water at -80°C for further processing. Lysates were prepared using a tissue homogenizer “precellys 24” (Bertin Technologies) and 1:1 v:v 1mm glass beads (Biospec Cat. No. 11079110) were added to the worms' pellet along with lysis buffer. The samples were shaken for 30 seconds at 6000 rpm and then placed on ice for 1 minute, repeated 3 times. Total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen- 74134) according to the manufacturer’s instructions. 5 different biological replicas were used for each condition. NV48 (nAD) and NV51(abl-1 KO) were either left untreated or treated with Quercetin [100 µM] starting from eggs.

DNase digested total RNA samples used for transcriptome analyses were quantified (Qubit RNA HS Assay, Thermo Fisher Scientific, MA, USA) and quality measured by capillary electrophoresis using the Fragment Analyzer and the ‘Total RNA Standard Sensitivity Assay’ (Agilent Technologies, Inc. Santa Clara, USA). All samples in this study showed high quality RNA Quality Numbers (RQN; mean = 10.0). The library preparation was performed according to the manufacturer’s protocol using the Illumina® ‘TruSeq Stranded mRNA Library Prep’ Kit. Briefly, 350 ng total RNA were used for mRNA capturing, fragmentation, the synthesis of cDNA, adapter ligation and library amplification. Bead purified libraries were normalized and finally sequenced on the HiSeq 3000/4000 system (Illumina Inc. San Diego, CA, USA) with a read setup of SR 1x150 bp. The Illumina bcl2fastq tool (v2.20.0.422) was used to convert the bcl files to fastq files as well for adapter trimming and demultiplexing.

RNA-Seq Analysis

Data analyses on fastq files were conducted with CLC Genomics Workbench (version 20.0.4 and 21.0.4, QIAGEN, Venlo, NL). The reads of all probes were adapter trimmed (Illumina TruSeq) and quality trimmed (using the default parameters: bases below Q13 were trimmed from the end of the reads, ambiguous nucleotides maximal 2). Mapping was done against the C. elegans (WBcel235.99) (March 26, 2020) genome sequence. After grouping of samples according to their respective experimental condition, the statistical differential expression was determined using the CLC Differential Expression for RNA-Seq tool (version 2.5). The Resulting 𝑃 values were corrected for multiple testing by FDR and Bonferroni-correction. A 𝑃 value of ≤0.05 was considered significant.

Gene Ontology (GO) Analysis

In order to perform functional enrichment analysis, the lists of differential expressed genes, which resulted from the RNA-Seq analysis, were input into the on-line tool g:Profiler (doi:10.1093/nar/gkz369) with the default setting for C. elegans. The top 20 GO terms were plotted for the specified comparison, sorted by significance were plotted. DEG lists were used to find common DEG between the comparison of interest, the result was plotted as Venn diagram (https://bioinformatics.psb.ugent.be/webtools/Venn/),

The enrichment map, visible inside the Venn Diagram was plotted using Cytoscape [119] and the EnrichmentMap plugin [120] following the methods described in [121]. The genes log fold change of the Venn Diagram intersection, was plotted as heat map using the R package ComplexHeatMap [122].

Mammalian Cells

Cell culture and stable cell lines generation

Mouse primary cortical cultures (Figure 5A) were prepared from P0 brains from C57/Bl6J mice as previously described [123] under the study approval by the Landesamt für Natur, Umwelt und Verbraucherschutz (LANUV, Northrhine Westphalia, Germany, reference number Az. 84-02.05.40.14.138 and Az. 81-02.05.50.17.018). 2 x 10⁵ cells were plated in 6-well coated with poly-L-lysine (0.1 mg/ml) and containing Neurobasal medium with B27 supplement (Invitrogen).

Human embryonic kidney (HEK) 293 cells stably overexpressing human wild type APP695 (Figure 5B-D, HEK293APPwt) kindly provided by Prof. Jochen Walter, Uni Bonn [124], were grown in RPMI1640 (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (Perbio) and 100 µg/ml of penicillin/streptomycin (Invitrogen).

HEK293T cells (Figure 5E; Figure 6A-C) were grown in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 mg/ml streptomycin (Sigma-Aldrich). Stable overexpression of pIRES-empty and pIRES-APP695^WT vectors were performed by using Polyethylenimine (PEI) reagent (Tebu-bio), according to manufacturer’s instructions. Hygromicing B (Sigma-Aldrich) was use as selection antibiotic at the concentration of 200mg/ml.

Cell treatments

Primary cortical neurons (2 x 10⁵ cells/well) were treated at day 3 in vitro with Quercetin for 24 h.

HEK293T cells were seeded at the proper density and treated the day after for experiments. Quercetin 20 µM treatment was performed for 24 h; Cloroquine 10 µM treatment was performed one hour before quercetin. All the reagents were purchased from Sigma-Aldrich.

HEK293APP695wt cells were treated 24 h after seeding at 70% confluence with different concentrations of quercetin (1 – 40 µM) or imatinib (5 – 20 µM; Sigma-Aldrich) dissolved in DMSO. Control cells were treated with medium containing the highest used amount of solvent (0.1% DMSO). 24 h after treatment, conditioned media were aspirated, centrifuged at 1.200 rpm and supernatants were stored in -20°C for ELISA analysis. Subsequently, the cellular membranes were extracted and used for western blot analysis.

Western Blot analyses and Amyloid-β ELISA

To assess the turnover of APP, cells treated for 24 h with quercetin as described above and exposed to cyclohexamide (Sigma-Aldrich) [40 μg/mL] for 0 min, 30 min and 90 min. Then, cells were lysed in STEN lysis buffer (1xSTEN: 50 mM Tris, pH 7.6, 150 mM NaCl, 2 mM EDTA, 0.2% Nonidet P-40; STEN-lysis buffer, 1% Triton X-100, 1% Nonidet P-40, complete protease inhibitors in 1x STEN) on ice for 30 min and clarified by a 30-min centrifugation at 13.200 rpm.

Total cell extracts were obtained by rupturing cells in RIPA buffer (50 mM Tris–HCl, pH 8, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 10 mM NaF, 1 mM sodium orthovanadate) and protease inhibitor cocktail (Roche Applied Science) followed by centrifugation at 14'000x g for 20 min at 4°C. 30 mg protein extracts were then electrophoresed by SDS–PAGE and blotted onto nitrocellulose membrane (Bio-Rad Laboratories). Cellular membrane preparation: All procedures were carried out at 4°C. Cells were harvested and resuspended in hypotonic buffer (10 mM Tris, pH 7.3, 10 mM MgCl2,1 mM EDTA and 1 mM EGTA) for 10 min on ice. Cells were then homogenized by passing 10 times through a 21-gauge needle and centrifuged for 10 min at 100xg to pellet nuclei. The resulting supernatant was centrifuged 30 min at 16,000xg. Crude cellular membrane fractions were lysed in STEN lysis buffer (1xSTEN: 50 mM Tris, pH 7.6, 150 mM NaCl, 2 mM EDTA, 0.2% Nonidet P-40; STEN-lysis buffer, 1% Triton X-100, 1% Nonidet P-40, complete protease inhibitors in 1x STEN) and clarified by a 30-min centrifugation at 13,200 x g. Upon SDS-PAGE electrophoresis, membrane proteins were transferred to nitrocellulose membrane and detected with the corresponding antibodies.

Primary antibodies used are as follows: anti-p62 (MBL, #PM045); anti-LC3 (8E10) (MBL, #M186-3); anti-ABL (Ab-3) (Sigma-Aldrich, #OP20); anti-Vinculin (13901T) (Cell Signaling Technology, #13901); anti-GAPDH (D16H11) (Cell Signaling Technology, #5174); anti-Tubulin (Sigma-Aldrich, #T5168). The specific protein complex, formed upon incubation with specific secondary antibodies (Bio-Rad Laboratories), was identified using a iBright Imaging Systems (Thermo Fisher Scientific), after incubation with the ECL detection system (Bio-Rad Laboratories). Images were adjusted for brightness and contrast by Fiji analysis software.

APP full-length and APP C-terminal fragments were detected with APP CT antibody (Sigma). The Aβ40 and Aβ42 ELISA were performed according to the manufacturer’s manual (Wako chemicals, Germany).

Uncropped original blots are shown in the Supplemental Material file.

Real-Time PCR

RNA was extracted by using TRI Reagent (Sigma-Aldrich), in accordance with manufacturer protocol. cDNA was generated starting from 1 mg of total RNA using the SensiFAST cDNA Synthesis KIT (Bioline). Specific primer pairs were designed to amplify unique regions of genes of interest, primers sequences are listed below. RT–qPCR was performed using the SensiFAST SYBR Green Master Mix (Bioline) on a LightCycler 480 System (Roche). Data were analyzed following the 2-^DDCt method. The fold changes in mRNA levels were determined relative to the control after normalizing to the internal standard actin.

Genes	Forward	Reverse
ABL1	CCAGGTGTATGAGCTGCTAGAG	GTCAGAGGGATTCCACTGCCAA
b-actin	GGGACCTGACTGACTACCTC	ATCTTCATTGTGCTGGGTG

ACKNOWLEDGMENT

This work was possible thanks to financial support to N.V. from the German Federal Ministry of Education and Research (JPI-HDHL-NUTRICOG call, MiTyrAge Grant 01EA1602) and the German Research Foundation (DFG Grant VE366/8-1). Work from D.B. was funded by MIUR-JPI-HDHL-NUTRICOG-MiTyrAge, Associazione Italiana per la Ricerca sul Cancro (AIRC-IG2021-n.26230) and Italian Ministry of Health (RF-2016-02362022); C.C. work has been supported by MIUR-JPI-HDHL-NUTRICOG-MiTyrAge and by a FIRC-AIRC fellowship for Italy “Filomena Todini”. Work from R.S. and T.W. was funded by the German Federal Ministry of Education and Research (JPI-HDHL-NUTRICOG call, MiTyrAge Grant 01EA1603).

We would also like to thank Prof. Jose Esteban from Centro de Biología Molecular Severo Ochoa, Madrid University, who participated in the acquisition of the MiTyrAge grant; Beatrice O. Uwaifo, and Nike Bahlmann for technical support with some of the C. elegans experiments. We also would like to thank Matteo Bordi and Francesco Cecconi for kindly providing of pIRES-empty and pIRES-APP^WT constructs as well as the Caenorhabditis Genetics Center for C. elegans strains (funded by the National Institutes of Health Office of Research Infrastructure Programs: P40OD010440). GDL acknowledges the support from and ERASMUS+ stipend. Computational infrastructure and support were provided by the Centre for Information and Media Technology at Heinrich Heine University Düsseldorf.

Ethics approval

Approval to collect organs from mice, including brains for the preparation of primary cortical cultures, was obtained by the Landesamt für Natur, Umwelt und Verbraucherschutz (LANUV, reference 84-02.05.40.14.138 and Az. 81-02.05.50.17.018). Animals were maintained according to the guidelines of the Society for Laboratory Animals Science (GV-SOLAS).

Conflict of Interest Statement

The authors of this article declare that they have no conflicts of interest that could have influenced the content or conclusions of this work. They have no financial or personal relationships with any individuals or organizations that could inappropriately influence their research or conclusions.

Lopez-Otin, C., et al., The hallmarks of aging. Cell, 2013. 153(6): p. 1194-217.
Bellenguez, C., et al., New insights into the genetic etiology of Alzheimer's disease and related dementias. Nat Genet, 2022. 54(4): p. 412-436.
Alexander, A.G., V. Marfil, and C. Li, Use of Caenorhabditis elegans as a model to study Alzheimer's disease and other neurodegenerative diseases. Front Genet, 2014. 5: p. 279.
Wang, X., et al., Modifications and Trafficking of APP in the Pathogenesis of Alzheimer's Disease. Front Mol Neurosci, 2017. 10: p. 294.
Fontana, I.C., et al., Amyloid-beta oligomers in cellular models of Alzheimer's disease. J Neurochem, 2020. 155(4): p. 348-369.
Siddiqi, M.K., et al., Cytotoxic species in amyloid-associated diseases: Oligomers or mature fibrils. Adv Protein Chem Struct Biol, 2019. 118: p. 333-369.
Koike, H., et al., Significance of Oligomeric and Fibrillar Species in Amyloidosis: Insights into Pathophysiology and Treatment. Molecules, 2021. 26(16).
Song, X.J., et al., Phosphorylation and Glycosylation of Amyloid-beta Protein Precursor: The Relationship to Trafficking and Cleavage in Alzheimer's Disease. J Alzheimers Dis, 2021. 84(3): p. 937-957.
Gonfloni, S., et al., Oxidative Stress, DNA Damage, and c-Abl Signaling: At the Crossroad in Neurodegenerative Diseases? Int J Cell Biol, 2012. 2012: p. 683097.
Alvarez, A.R., et al., Activation of the neuronal c-Abl tyrosine kinase by amyloid-beta-peptide and reactive oxygen species. Neurobiol Dis, 2004. 17(2): p. 326-36.
Ho, G.J., et al., Altered p59Fyn kinase expression accompanies disease progression in Alzheimer's disease: implications for its functional role. Neurobiol Aging, 2005. 26(5): p. 625-35.
La Barbera, L., et al., Nilotinib restores memory function by preventing dopaminergic neuron degeneration in a mouse model of Alzheimer's Disease. Prog Neurobiol, 2021. 202: p. 102031.
Estrada, L.D., et al., Reduction of Blood Amyloid-beta Oligomers in Alzheimer's Disease Transgenic Mice by c-Abl Kinase Inhibition. J Alzheimers Dis, 2016. 54(3): p. 1193-1205.
Netzer, W.J., et al., Gleevec shifts APP processing from a beta-cleavage to a nonamyloidogenic cleavage. Proc Natl Acad Sci U S A, 2017. 114(6): p. 1389-1394.
Holtze, S., et al., Alternative Animal Models of Aging Research. Front Mol Biosci, 2021. 8: p. 660959.
Bulterijs, S. and B.P. Braeckman, Phenotypic Screening in C. elegans as a Tool for the Discovery of New Geroprotective Drugs. Pharmaceuticals (Basel), 2020. 13(8).
Maglioni, S., N. Arsalan, and N. Ventura, C. elegans screening strategies to identify pro-longevity interventions. Mech Ageing Dev, 2016. 157: p. 60-9.
Torgovnick, A., et al., Healthy aging: what can we learn from Caenorhabditis elegans? Z Gerontol Geriatr, 2013. 46(7): p. 623-8.
Naranjo-Galindo, F.J., et al., C. elegans as an Animal Model to Study the Intersection of DNA Repair, Aging and Neurodegeneration. Front Aging, 2022. 3: p. 916118.
Caldwell, K.A., C.W. Willicott, and G.A. Caldwell, Modeling neurodegeneration in Caenorhabditis elegans. Dis Model Mech, 2020. 13(10).
Link, C.D., C. elegans models of age-associated neurodegenerative diseases: lessons from transgenic worm models of Alzheimer's disease. Exp Gerontol, 2006. 41(10): p. 1007-13.
Monroy, A., G.J. Lithgow, and S. Alavez, Curcumin and neurodegenerative diseases. Biofactors, 2013. 39(1): p. 122-32.
Zandi, P.P., et al., Reduced risk of Alzheimer disease in users of antioxidant vitamin supplements: the Cache County Study. Arch Neurol, 2004. 61(1): p. 82-8.
Khurana, S., et al., Polyphenols: benefits to the cardiovascular system in health and in aging. Nutrients, 2013. 5(10): p. 3779-827.
Hofer, S.J., et al., Caloric Restriction Mimetics in Nutrition and Clinical Trials. Front Nutr, 2021. 8: p. 717343.
Madeo, F., et al., Caloric Restriction Mimetics against Age-Associated Disease: Targets, Mechanisms, and Therapeutic Potential. Cell Metab, 2019. 29(3): p. 592-610.
Regitz, C., L.M. Dussling, and U. Wenzel, Amyloid-beta (Abeta(1)(-)(4)(2))-induced paralysis in Caenorhabditis elegans is inhibited by the polyphenol quercetin through activation of protein degradation pathways. Mol Nutr Food Res, 2014. 58(10): p. 1931-40.
Regitz, C., et al., Resveratrol reduces amyloid-beta (Abeta(1)(-)(4)(2))-induced paralysis through targeting proteostasis in an Alzheimer model of Caenorhabditis elegans. Eur J Nutr, 2016. 55(2): p. 741-747.
Kantham, S., et al., Effect of the Biphenyl Neolignan Honokiol on Abeta42-Induced Toxicity in Caenorhabditis elegans, Abeta42 Fibrillation, Cholinesterase Activity, DPPH Radicals, and Iron(II) Chelation. ACS Chem Neurosci, 2017. 8(9): p. 1901-1912.
Fong, S., et al., Energy crisis precedes global metabolic failure in a novel Caenorhabditis elegans Alzheimer Disease model. Sci Rep, 2016. 6: p. 33781.
Wu, Y., et al., Amyloid-beta-induced pathological behaviors are suppressed by Ginkgo biloba extract EGb 761 and ginkgolides in transgenic Caenorhabditis elegans. J Neurosci, 2006. 26(50): p. 13102-13.
Dosanjh, L.E., et al., Behavioral phenotyping of a transgenic Caenorhabditis elegans expressing neuronal amyloid-beta. J Alzheimers Dis, 2010. 19(2): p. 681-90.
Eisele, Y.S., et al., Gleevec increases levels of the amyloid precursor protein intracellular domain and of the amyloid-beta degrading enzyme neprilysin. Mol Biol Cell, 2007. 18(9): p. 3591-600.
Gutierrez, D.A., et al., c-Abl kinase at the crossroads of healthy synaptic remodeling and synaptic dysfunction in neurodegenerative diseases. Neural Regen Res, 2023. 18(2): p. 237-243.
Carmona-Gutierrez, D., et al., The flavonoid 4,4'-dimethoxychalcone promotes autophagy-dependent longevity across species. Nat Commun, 2019. 10(1): p. 651.
Morselli, E., et al., Autophagy mediates pharmacological lifespan extension by spermidine and resveratrol. Aging (Albany NY), 2009. 1(12): p. 961-70.
Florez-McClure, M.L., et al., Decreased insulin-receptor signaling promotes the autophagic degradation of beta-amyloid peptide in C. elegans. Autophagy, 2007. 3(6): p. 569-80.
Pounis, G., et al., Reduced mortality risk by a polyphenol-rich diet: An analysis from the Moli-sani study. Nutrition, 2018. 48: p. 87-95.
Pallauf, K., N. Duckstein, and G. Rimbach, A literature review of flavonoids and lifespan in model organisms. Proc Nutr Soc, 2017. 76(2): p. 145-162.
Chattopadhyay, D. and K. Thirumurugan, Longevity promoting efficacies of different plant extracts in lower model organisms. Mech Ageing Dev, 2018. 171: p. 47-57.
Chen, W., et al., Lycopene attenuates Abeta1-42 secretion and its toxicity in human cell and Caenorhabditis elegans models of Alzheimer disease. Neurosci Lett, 2015. 608: p. 28-33.
Zhang, L., et al., Significant longevity-extending effects of EGCG on Caenorhabditis elegans under stress. Free Radic Biol Med, 2009. 46(3): p. 414-21.
Maglioni, S., et al., Neuroligin-mediated neurodevelopmental defects are induced by mitochondrial dysfunction and prevented by lutein in C. elegans. Nat Commun, 2022. 13(1): p. 2620.
Maglioni, S., et al., High-Content C. elegans Screen Identifies Natural Compounds Impacting Mitochondria-Lipid Homeostasis and Promoting Healthspan. Cells, 2021. 11(1).
Abbas, S. and M. Wink, Epigallocatechin gallate from green tea (Camellia sinensis) increases lifespan and stress resistance in Caenorhabditis elegans. Planta Med, 2009. 75(3): p. 216-21.
Martel, J., et al., Hormetic Effects of Phytochemicals on Health and Longevity. Trends Endocrinol Metab, 2019. 30(6): p. 335-346.
Brinkmann, V., et al., Dietary and environmental factors have opposite AhR-dependent effects on C. elegans healthspan. Aging (Albany NY), 2020. 13(1): p. 104-133.
Reinke, S.N., et al., Caenorhabditis elegans diet significantly affects metabolic profile, mitochondrial DNA levels, lifespan and brood size. Mol Genet Metab, 2010. 100(3): p. 274-82.
Xiao, R., et al., RNAi Interrogation of Dietary Modulation of Development, Metabolism, Behavior, and Aging in C. elegans. Cell Rep, 2015. 11(7): p. 1123-33.
Calahorro, F., L. Holden-Dye, and V. O'Connor, Impact of drug solvents on C. elegans pharyngeal pumping. Toxicol Rep, 2021. 8: p. 1240-1247.
AlOkda, A. and J.M. Van Raamsdonk, Effect of DMSO on lifespan and physiology in C. elegans : Implications for use of DMSO as a solvent for compound delivery. MicroPubl Biol, 2022. 2022.
Sadananda, G., J.D. Velmurugan, and J.R. Subramaniam, DMSO Delays Alzheimer Disease Causing Abeta-induced Paralysis in C. elegans Through Modulation of Glutamate/Acetylcholine Neurotransmission. Ann Neurosci, 2021. 28(1-2): p. 55-64.
Men, K., et al., Nanoparticle-delivered quercetin for cancer therapy. Anticancer Agents Med Chem, 2014. 14(6): p. 826-32.
Ishizawa, K., et al., Pharmacology in health food: metabolism of quercetin in vivo and its protective effect against arteriosclerosis. J Pharmacol Sci, 2011. 115(4): p. 466-70.
Proshkina, E., et al., Geroprotective and Radioprotective Activity of Quercetin, (-)-Epicatechin, and Ibuprofen in Drosophila melanogaster. Front Pharmacol, 2016. 7: p. 505.
Pietsch, K., et al., Quercetin mediated lifespan extension in Caenorhabditis elegans is modulated by age-1, daf-2, sek-1 and unc-43. Biogerontology, 2009. 10(5): p. 565-78.
Morselli, E., et al., Spermidine and resveratrol induce autophagy by distinct pathways converging on the acetylproteome. J Cell Biol, 2011. 192(4): p. 615-29.
Jia, K., A.C. Hart, and B. Levine, Autophagy genes protect against disease caused by polyglutamine expansion proteins in Caenorhabditis elegans. Autophagy, 2007. 3(1): p. 21-5.
Xu, H., et al., Activation of autophagy attenuates motor deficits and extends lifespan in a C. elegans model of ALS. Free Radic Biol Med, 2022. 181: p. 52-61.
Gundelfinger, E.D., et al., Organization of Presynaptic Autophagy-Related Processes. Front Synaptic Neurosci, 2022. 14: p. 829354.
Kuijpers, M., Keeping synapses in shape: degradation pathways in the healthy and aging brain. Neuronal Signal, 2022. 6(2): p. NS20210063.
Gomez-Isla, T., et al., Neuropathology of Alzheimer's disease. Handb Clin Neurol, 2008. 89: p. 233-43.
Zhang, H., et al., Role of Abeta in Alzheimer's-related synaptic dysfunction. Front Cell Dev Biol, 2022. 10: p. 964075.
Pelucchi, S., et al., Synaptic dysfunction in early phases of Alzheimer's Disease. Handb Clin Neurol, 2022. 184: p. 417-438.
Bayer, T.A. and O. Wirths, Intracellular accumulation of amyloid-Beta - a predictor for synaptic dysfunction and neuron loss in Alzheimer's disease. Front Aging Neurosci, 2010. 2: p. 8.
Todorova, V. and A. Blokland, Mitochondria and Synaptic Plasticity in the Mature and Aging Nervous System. Curr Neuropharmacol, 2017. 15(1): p. 166-173.
Palikaras, K. and N. Tavernarakis, Regulation and roles of mitophagy at synapses. Mech Ageing Dev, 2020. 187: p. 111216.
Faria-Pereira, A. and V.A. Morais, Synapses: The Brain's Energy-Demanding Sites. Int J Mol Sci, 2022. 23(7).
Palikaras, K., E. Lionaki, and N. Tavernarakis, Coordination of mitophagy and mitochondrial biogenesis during ageing in C. elegans. Nature, 2015.
Koch, S.C., A. Nelson, and V. Hartenstein, Structural aspects of the aging invertebrate brain. Cell Tissue Res, 2021. 383(3): p. 931-947.
Toth, M.L., et al., Neurite sprouting and synapse deterioration in the aging Caenorhabditis elegans nervous system. J Neurosci, 2012. 32(26): p. 8778-90.
Markert, S.M., et al., Overexpression of an ALS-associated FUS mutation in C. elegans disrupts NMJ morphology and leads to defective neuromuscular transmission. Biol Open, 2020. 9(12).
Woo, J.A., et al., Loss of function CHCHD10 mutations in cytoplasmic TDP-43 accumulation and synaptic integrity. Nat Commun, 2017. 8: p. 15558.
Brown, M.K. and Y. Luo, Bilobalide modulates serotonin-controlled behaviors in the nematode Caenorhabditis elegans. BMC Neurosci, 2009. 10: p. 62.
Diomede, L., et al., Expression of A2V-mutated Abeta in Caenorhabditis elegans results in oligomer formation and toxicity. Neurobiol Dis, 2014. 62: p. 521-32.
John, A. and P.H. Reddy, Synaptic basis of Alzheimer's disease: Focus on synaptic amyloid beta, P-tau and mitochondria. Ageing Res Rev, 2021. 65: p. 101208.
Torres, A.K., et al., Synaptic Mitochondria: An Early Target of Amyloid-beta and Tau in Alzheimer's Disease. J Alzheimers Dis, 2021. 84(4): p. 1391-1414.
Sorrentino, V., et al., Enhancing mitochondrial proteostasis reduces amyloid-beta proteotoxicity. Nature, 2017. 552(7684): p. 187-193.
LaFerla, F.M., K.N. Green, and S. Oddo, Intracellular amyloid-beta in Alzheimer's disease. Nat Rev Neurosci, 2007. 8(7): p. 499-509.
Morton, H., et al., Defective mitophagy and synaptic degeneration in Alzheimer's disease: Focus on aging, mitochondria and synapse. Free Radic Biol Med, 2021. 172: p. 652-667.
Schaefer, P.M., et al., Metabolic Characterization of Intact Cells Reveals Intracellular Amyloid Beta but Not Its Precursor Protein to Reduce Mitochondrial Respiration. PLoS One, 2016. 11(12): p. e0168157.
Fang, E.F., et al., Mitophagy inhibits amyloid-beta and tau pathology and reverses cognitive deficits in models of Alzheimer's disease. Nat Neurosci, 2019. 22(3): p. 401-412.
Ai, R., et al., A synergized machine learning plus cross-species wet-lab validation approach identifies neuronal mitophagy inducers inhibiting Alzheimer disease. Autophagy, 2022. 18(4): p. 939-941.
Ziehm, M., et al., Drug repurposing for aging research using model organisms. Aging Cell, 2017. 16(5): p. 1006-1015.
Boly, R., et al., Quercetin inhibits a large panel of kinases implicated in cancer cell biology. Int J Oncol, 2011. 38(3): p. 833-42.
Moresco, E.M. and A.J. Koleske, Regulation of neuronal morphogenesis and synaptic function by Abl family kinases. Curr Opin Neurobiol, 2003. 13(5): p. 535-44.
Woolfrey, K.M. and M.L. Dell'Acqua, Coordination of Protein Phosphorylation and Dephosphorylation in Synaptic Plasticity. J Biol Chem, 2015. 290(48): p. 28604-12.
Vargas, L.M., et al., Amyloid-beta oligomers synaptotoxicity: The emerging role of EphA4/c-Abl signaling in Alzheimer's disease. Biochim Biophys Acta Mol Basis Dis, 2018. 1864(4 Pt A): p. 1148-1159.
Schlatterer, S.D., C.M. Acker, and P. Davies, c-Abl in neurodegenerative disease. J Mol Neurosci, 2011. 45(3): p. 445-52.
Bauer, C., et al., gamma-Secretase-mediated regulation of neprilysin: influence of cell density and aging and modulation by imatinib. J Alzheimers Dis, 2011. 27(3): p. 511-20.
Kerridge, C., et al., The Abeta-clearance protein transthyretin, like neprilysin, is epigenetically regulated by the amyloid precursor protein intracellular domain. J Neurochem, 2014. 130(3): p. 419-31.
Vazquez, M.C., et al., c-Abl modulates AICD dependent cellular responses: transcriptional induction and apoptosis. J Cell Physiol, 2009. 220(1): p. 136-43.
Grimm, M.O., et al., APP intracellular domain derived from amyloidogenic beta- and gamma-secretase cleavage regulates neprilysin expression. Front Aging Neurosci, 2015. 7: p. 77.
Lin, C.L., et al., Epigallocatechin gallate (EGCG) suppresses beta-amyloid-induced neurotoxicity through inhibiting c-Abl/FE65 nuclear translocation and GSK3 beta activation. Neurobiol Aging, 2009. 30(1): p. 81-92.
Sabogal-Guaqueta, A.M., et al., The flavonoid quercetin ameliorates Alzheimer's disease pathology and protects cognitive and emotional function in aged triple transgenic Alzheimer's disease model mice. Neuropharmacology, 2015. 93: p. 134-45.
Vepsalainen, S., et al., Anthocyanin-enriched bilberry and blackcurrant extracts modulate amyloid precursor protein processing and alleviate behavioral abnormalities in the APP/PS1 mouse model of Alzheimer's disease. J Nutr Biochem, 2013. 24(1): p. 360-70.
Zambrano, N., et al., feh-1 and apl-1, the Caenorhabditis elegans orthologues of mammalian Fe65 and beta-amyloid precursor protein genes, are involved in the same pathway that controls nematode pharyngeal pumping. J Cell Sci, 2002. 115(Pt 7): p. 1411-22.
Spanier, B., et al., Caenorhabditis elegans neprilysin NEP-1: an effector of locomotion and pharyngeal pumping. J Mol Biol, 2005. 352(2): p. 429-37.
Teixeira, J., et al., Dietary Polyphenols and Mitochondrial Function: Role in Health and Disease. Curr Med Chem, 2019. 26(19): p. 3376-3406.
Salvi, M., A.M. Brunati, and A. Toninello, Tyrosine phosphorylation in mitochondria: a new frontier in mitochondrial signaling. Free Radic Biol Med, 2005. 38(10): p. 1267-77.
Pavlov, P.F., et al., Mitochondrial accumulation of APP and Abeta: significance for Alzheimer disease pathogenesis. J Cell Mol Med, 2009. 13(10): p. 4137-45.
Khandelwal, P.J., et al., Parkin mediates beclin-dependent autophagic clearance of defective mitochondria and ubiquitinated Abeta in AD models. Hum Mol Genet, 2011. 20(11): p. 2091-102.
Zhu, S., et al., Rose Essential Oil Delayed Alzheimer's Disease-Like Symptoms by SKN-1 Pathway in C. elegans. J Agric Food Chem, 2017. 65(40): p. 8855-8865.
George, M., et al., Role of Nrf2 in aging, Alzheimer's and other neurodegenerative diseases. Ageing Res Rev, 2022. 82: p. 101756.
Brinkmann, V., et al., Aryl Hydrocarbon Receptor-Dependent and -Independent Pathways Mediate Curcumin Anti-Aging Effects. Antioxidants (Basel), 2022. 11(4).
Hebron, M.L., I. Lonskaya, and C.E. Moussa, Nilotinib reverses loss of dopamine neurons and improves motor behavior via autophagic degradation of alpha-synuclein in Parkinson's disease models. Hum Mol Genet, 2013. 22(16): p. 3315-28.
Imamura, K., et al., The Src/c-Abl pathway is a potential therapeutic target in amyotrophic lateral sclerosis. Sci Transl Med, 2017. 9(391).
Karuppagounder, S.S., et al., The c-Abl inhibitor, nilotinib, protects dopaminergic neurons in a preclinical animal model of Parkinson's disease. Sci Rep, 2014. 4: p. 4874.
Zhou, D., et al., SC75741, A Novel c-Abl Inhibitor, Promotes the Clearance of TDP25 Aggregates via ATG5-Dependent Autophagy Pathway. Front Pharmacol, 2021. 12: p. 741219.
Contreras, P.S., et al., c-Abl Inhibition Activates TFEB and Promotes Cellular Clearance in a Lysosomal Disorder. iScience, 2020. 23(11): p. 101691.
Xu, M., et al., Senolytics improve physical function and increase lifespan in old age. Nat Med, 2018. 24(8): p. 1246-1256.
Zhang, P., et al., Senolytic therapy alleviates Abeta-associated oligodendrocyte progenitor cell senescence and cognitive deficits in an Alzheimer's disease model. Nat Neurosci, 2019. 22(5): p. 719-728.
Park, J. and D.W. Shin, Senotherapeutics and Their Molecular Mechanism for Improving Aging. Biomol Ther (Seoul), 2022. 30(6): p. 490-500.
Lee, S., et al., A guide to senolytic intervention in neurodegenerative disease. Mech Ageing Dev, 2021. 200: p. 111585.
Han, S.K., et al., OASIS 2: online application for survival analysis 2 with features for the analysis of maximal lifespan and healthspan in aging research. Oncotarget, 2016. 7(35): p. 56147-56152.
Kauffman, A., et al., C. elegans positive butanone learning, short-term, and long-term associative memory assays. J Vis Exp, 2011(49).
Schindelin, J., et al., Fiji: an open-source platform for biological-image analysis. Nat Methods, 2012. 9(7): p. 676-82.
Nussbaum-Krammer, C.I., et al., Investigating the spreading and toxicity of prion-like proteins using the metazoan model organism C. elegans. J Vis Exp, 2015(95): p. 52321.
Shannon, P., et al., Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res, 2003. 13(11): p. 2498-504.
Merico, D., et al., Enrichment map: a network-based method for gene-set enrichment visualization and interpretation. PLoS One, 2010. 5(11): p. e13984.
Reimand, J., et al., Pathway enrichment analysis and visualization of omics data using g:Profiler, GSEA, Cytoscape and EnrichmentMap. Nat Protoc, 2019. 14(2): p. 482-517.
Gu, Z., R. Eils, and M. Schlesner, Complex heatmaps reveal patterns and correlations in multidimensional genomic data. Bioinformatics, 2016. 32(18): p. 2847-9.
Kaech, S. and G. Banker, Culturing hippocampal neurons. Nat Protoc, 2006. 1(5): p. 2406-15.
Wahle, T., et al., GGA1 is expressed in the human brain and affects the generation of amyloid beta-peptide. J Neurosci, 2006. 26(49): p. 12838-46.

Table 3 is available in the Supplementary Files section.

There is no duality of interest

Table3GeneList.csv
Table 3. LogFC 171 common genes
SchiavietalFigureS1.pdf
SchiavietalFigureS2.pdf
SchiavietalFigureS3.pdf
SupplementaryFigureLegends.docx
Supplementalmaterial.pdf

Download PDF

Journal Publication

published 14 Oct, 2023

Read the published version in Cell Death Discovery →

Version 1

posted

You are reading this latest preprint version

Abl depletion via autophagy mediates the beneficial effects of quercetin against Alzheimer pathology across species

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Results

Quercetin promotes healthspan and protects against Aβ-induced pathology in C. elegans

Quercetin treatment and Abl depletion similarly impact on phosphorylation-related processes

Abl suppression mediates the beneficial effects of quercetin against Aβ-induced pathology

Quercetin reduces Aβ secretion in mammalian cells

Discussion

Material And Methods

Declarations

References

Table

Additional Declarations

Supplementary Files

Status:

Journal Publication

Version 1