Patient samples and cell lines
All of the human samples were obtained with informed consent from patients with CCA. A total of 60 CCA samples in this study were collected from The 2nd Affiliated Hospital of Harbin Medical University (Heilongjiang Province, China). There were no patients who had received preoperative chemotherapy before this study. This research was approved by the Institute’s Research Ethics Committee of The 2nd Affiliated Hospital of Harbin Medical University and conducted in accordance with the ethical guidelines of the World Medical Association Declaration of Helsinki. All written informed consents had been collected from each patient before surgery.
HCCC-9810, CCLP1 and RBE cells were obtained from the Cell Bank of Type Culture of Chinese Academy of Sciences (Shanghai, People’s Republic of China). The other CCA cells including QBC939, HuCCT1, KMBC and human intrahepatic biliary epithelial cells (HIBEC) were preserved in our laboratory. These cells were cultured in RPMI-1640 (Gibco, Grand Island, NY, USA) or DMEM (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (Invitrogen Life Technologies, Carlsbad, CA, USA) in a humidified atmosphere at 37°C and 5% CO2.
Cell proliferation assays
CCLP1 and HCCC-9810 cells were seeded into 96-well plates at a density of 10 × 104 cells/well 48 hours after transfection. Cell viability was evaluated by cell counting kit-8 (CCK-8, Beyotime, Beijing, China) at 24h, 48h, 72h and 96h. OD value was quantified by a microplate reader at 450 nm.
CCLP1 and HCCC-9810 cells were seeded in 6-well plates at the density of 500 cells / well 48 hours after transfection and then cultured at 37℃ in a 5% CO2 humidified atmosphere. The medium was changed every 4 days. After 14 – days’ culture, the medium was removed and cells were washed twice with PBS. Then cells were fixed in methanol for 20 minutes and stained with 0.1% crystal violet (Beyotime, Beijing, China) for 30 min at room temperature, washed again and photographed.
Cell transfection
Two siRNA targeting linc00473 (si-linc00473-1 and si-linc00473-2) and scrambled negative control (si-NC) were synthesized by RiboBio (Guangzhou, China). The sequences of si-linc00473 were as follows (5’-3’): si-linc00473-1: GCGCCGGGAGAUGCAUCACGAUGAA; si-linc00473-2: CCCUGUCUGCAAAGAUCCAGUUUAA. miR-506 mimics/inhibitor was purchased from GenePharma (Shanghai, China). CCLP1 and HCCC-9810 cells were transfected with 100nM siRNA using LipofectamineTM3000 (Thermo Fisher Scientific, USA) according to the manufacturer’s instruction. The mRNA expression level of LINC00473 was detected by qRT-PCR. The overexpression experiments were performed as previously described [13].
qRT-PCR analysis and Subcellular fractionation address
Total RNA was isolated from the cell lines using Ttizol reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instruction. One microgram of total RNA was reversely transcribed into first-strand cDNA according to the protocol of Transcriptor First Strand cDNA Synthesis Kit (Roche, Germany) [14], PCR was carried out using FastStart Universal SYBR Green Master Kit (Roche, Germany) according to the instruction in BIO-RAD C1000 Thermal Cycler. All special primers are listed in Additional file 1. The PARIS Kit (Life Technologies, Carlsbad, CA, USA) was used to separate nuclear and cytosolic fractions following the manufacturer’s instruction. Each sample was analyzed at least in triplicate.
Wound-healing assay and Transwell assay
CCLP1 and HCCC-9810 were plated in each well of the 12-well plates and incubated to form 80-90% confluence. Then a scratch was performed with pipette tips. Fresh serum-free medium was changed. The wound closing procedure was observed for 24h, and images were photographed.
Transwell chambers with 8 μm pores (Costar, Corning, NY, USA) were used to perform the invasion assay. Matrigel (BD Biosciences, New Jersey, USA) was coated on the top side of the insert membrane. The upper chamber was added with 200ul serum-free medium and seeded 5 × 104 cells while the lower chamber was placed with 600 ul medium with 5% FBS. The chambers were maintained at 37 ℃, 5% CO2 for 24 hours. After that, the cells on the top side of the insert membrane were removed by cotton swabs. The inserts were then fixed in methanol for 20 minutes and stained with 1% crystal violet for 30 minutes. The cells on the bottom of the membrane were calculated under a microscope and photographed. All experiments were performed in triplicate.
Western blot assay
Whole-cell lysate preparation and western blot analysis were performed as previously described [15]. An equal amount of protein from each condition was subjected to electrophoresis on 10% SDS-PAGE and subsequently transferred to polyvinylidene difluoride membrane, which was then blocked with 5% BSA in TBST (TBS containing 0.1% Tween-20) at room temperature for one hour. Incubation was conducted with primary antibodies at 4℃ overnight followed by secondary antibodies at room temperature for one hour. The membranes were washed 3 times with washing buffer (PBS containing 0.1% Tween) for 10 min after each incubation. Images were then captured using Densitometry (Quantity One software; Bio-Rad). Anti-DDX5 were obtained from CST (Danvers, USA). Anti-GAPDH were obtained from Beyotime (Beijing, China).
Dual-luciferase reporter assay
The sequences containing the wild-type (WT) or mutated (MUT) region DDX5 and linc00473 were synthesized by GenePharma (Shanghai, China) and inserted into a pmirGLO-Report luciferase vector. For the luciferase reporter assay, miR-506 mimics and the respective reporter plasmids were transfected into cells using Lipofectamine 3000 according to the manufacturer’s protocol. After 24 hours, the Renilla and Firefly luciferase activities were determined using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s instructions.
RNA-binding protein immunoprecipitation (RIP) assay
miR-506 mimics or miRNA was transfected into HCCC-9810 and CCLP1 cells. And the cells were lysed and collected in a RIP lysis buffer kit (Millipore, USA). Human anti-Ago2 (Millipore, USA) or mouse anti-IgG (Millipore, USA) were then conjugated with RNAs magnetic beads. Then the expression levels of purified RNA were determined by qRT-PCR.
The immunohistochemistry (IHC) assay
IHC analysis was performed as previously described [16]. For this staining, after heat-induced epitope retrieval, paraffin-embedded sections were incubated with 3% H2O2, and blocked for another 60 minutes with 3% normal serum buffer. Sections were incubated with primary antibodies overnight at 4 °C. Elite ABC Staining Kit and DAB Peroxidase Substrate Kit (Vector Laboratories, Inc., Burlingame, CA) were used to visualize the staining according to the manufacturer’s instructions. Primary antibodies used are listed below: DDX5 (CST, Danvers, USA).
Xenograft mice model
To evaluate the growth potential of CCA cells in vivo, 2 × 106 stable linc00473-overexpressed CCLP1 cells were re-suspended in 10 μL of DMEM medium and then drawn into a 20 μL Hamilton syringe with a 30-gauge needle and injected subcutaneously into the BALB/C nude mice (each group five mice, 6 weeks). Xenograft was measured every 3 days and tumor volume was calculated. All mice were sacrificed at the end of 21 days and the tumor weight was measured. All animal experiments were approved by the Animal Care and Use Committee of The 2nd Affiliated Hospital of Harbin Medical University.
Microarray and TCGA Dataset Analysis
The gene expression profiles of CCA that was downloaded from The Cancer Genome Atlas (TCGA) data portal (https://tcga.xenahubs.net/download/TCGA.CHOL.sampleMap/HiSeqV2.gz) were a Level 3 gene expression profile (level 3 data), and this gene expression profile was measured by the University of North Carolina TCGA genome characterization center. Package limma of the R statistical software was used to perform data analysis. The Fold change > 2 and FDR < 0.05 were set as the cut-offs to screen for differentially expressed genes.
Statistical analysis
The data were analyzed applying Statistical Program for Social Sciences 19.0 software (SPSS, Chicago, IL, USA) and GraphPad Prism 5.0 (GraphPad Software, LaJolla, CA, USA). Data were presented as mean ± SD and comparisons were calculated by Student’s t-test (two-sided, unpaired). Spearman’s rank correlation coefficients were used to calculate correlations between the mRNA levels. The Kaplan-Meier method was used to plot survival curves. All experiments were repeated at least three times. p < 0.05 was considered to indicate a statistically significant difference.