Blue light exposure promotes reactive oxygen stress, apoptosis and suppresses viability, migration and wound healing of cornea via inhibiting PI3K/AKT signaling pathway in corneal epithelial cells.

doi:10.21203/rs.3.rs-2595652/v1

Download PDF

Research Article

Blue light exposure promotes reactive oxygen stress, apoptosis and suppresses viability, migration and wound healing of cornea via inhibiting PI3K/AKT signaling pathway in corneal epithelial cells.

https://doi.org/10.21203/rs.3.rs-2595652/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Blue light (400 nm -480 nm), is a main source of eye damage emitted by light-emitting diodes (LEDs). Excessive blue light exposure has been shown to cause damage in cornea. This study aimed to investigate the effects of blue light exposure on phosphatidylinositol 3 kinase (PI3K)/AKT signaling pathway and metabolic abnormalities and tissue damage via PI3K/AKT signaling in human corneal epithelial cells (hCECs) and mice corneal tissues.

Method

The effects on blue light damage in hCECs were investigated by using qRT-PCR, WB, cell scratch assay, and cell reactive oxygen species (ROS) assay. The effects on blue light damage in vivo were investigated by using corneal fluorescein sodium staining.

Result

We revealed that blue light exposure caused the promotion of cell apoptosis, the increase of ROS and suppression of cell migration, proliferation and viability through the inhibition of PI3K/AKT/protein 70 kDa S6 Kinase (p70S6K) signaling pathway in hCECs in vitro. Furthermore, blue light exposure also induced the corneal epithelial defects and delayed corneal epithelial wound healing in mice cornea in vivo.

Conclusion

Collectively, this study suggests that PI3K/AKT signaling pathway may be an important target for the treatment of corneal epithelial damage caused by blue light exposure.

blue light

PI3K/AKT signaling

corneal epithelial cells

apoptosis

reactive oxygen species

With the wide application of artificial light sources such as light-emitting diodes (LEDs) and electronic screen, the tissue damage caused by these artificial light sources has attracted more and more attention and research. Blue light belongs to visible light and ranges from 400 nm to 480 nm wavelengths, it can be produced by the sun, LEDs and electronic screens(1). Due to the relatively high energy of blue light compared to other wavelengths of visible light, large quantities of researches have revealed that blue light exposure can lead to diverse tissue injury and dysfunctions, especially damage to the retina and cornea of the eye. Excessive blue light exposure has been shown to trigger oxidative stress, mitochondrial dysfunction, apoptosis, and inflammation, which can eventually cause a lot of eye diseases, including dry eye disease, keratitis, and electro-optic ophthalmia(2, 3). Our research team previously reported blue light exposure can impair mitochondrial dynamics and promote cell apoptosis in the retina degeneration in vivo and in vitro(4). And in human lens epithelial cells in vitro, blue light exposure can alleviate the epithelial-mesenchymal transformation through impair cell autophagy(5). Moreover, over exposure of blue light with the wavelength of 450 at 1000 lux can increase cell inflammation through activating NF-κB signaling in rat CECs in vivo, which may induce dry eye disease(6).

The Phosphoinositide 3-kinase (PI3K)/AKT signaling plays as a vital regulator in various cell metabolism, including cell proliferation, survival, migration, adhesion, apoptosis autophagy and so on. In detail, the process of PI3K/AKT signaling pathway mainly includes binding btween exogenous factors and their receptors, phosphorylation of PI3K activated by receptors, phosphorylation of AKT induced by PI3K, and activation of downstream effector factors(7, 8). The mammal target of rapamycin complex 1 is one of the vital substrates of PI3K/AKT cascade, with a substrate called protein 70 kDa S6 kinase (p70S6K), which can Phosphorylate and activate ribosomal protein S6 to promote protein synthesis(9). A lot of endogenous and exogenous toxins or injuries may inhibit the AKT signaling pathway causing corneal epithelial damage and delayed corneal epithelial wound healing in vitro and in vivo(10-12).

As a transparent structure on the anterior surface of the mammalian eye, the cornea plays three major roles, including producing refractive action, acting as a physical and mechanical barrier, and acting as an immune barrier. Corneal epithelial cells (CECs) consist of superficial squamous cells, superior central basal cells and columnar basal cells within a single layer(13). During corneal epithelium homeostasis, adult corneal epithelium maintenance is a comprehensive process including cell proliferation, migration, differentiation and apoptosis(14, 15).

Although many studies have revealed that blue light exposure can induce corneal epithelial damage, whether PI3K/AKT signaling is affected by blue light exposure, and whether its regulation of downstream factors plays a role in corneal epithelial damage, have not been thoroughly investigated. The aim of our study was to demonstrate that the inhibition of PI3K/AKT signaling pathway plays an essential role in corneal epithelial damage under blue light exposure.

2.1 Cell culture, animal culture and experimental illumination

This study used human corneal epithelial cell line (hCEC, Riken, Japan), and we cultured hCECs in MEM (Gibco) mixed with 10% fetal bovine serum (FBS, 10,099-141C, Gibco), and 1% penicillin and streptomycin (Gibco) at 37℃ with 5% CO². Due to the infeasibility and inhumanity of human exposure to monochromatic light for experiments, the 182-day-old female C57BL/6 mice used in this research were from the laboratory of Zhejiang Academy of Medical Sciences. These mice were randomly divided into two groups of eight, a negative control group and a blue light group. Food and water were provided to all mice continuously in 25°C, in 12 hours of darkness and light. Unlike the control group, the blue light group had customized LED tubes (peak 425 nm, half bandwidth 10 nm). And the irradiance of each LED is measured using a quantum light radiometer (Delta OHM, Padua, Italy) and a visual probe (Sonda LP 9021 RAD; Delta ohm). We maintained irradiance of 250 microwatts per square centimeter in vitro studies (24 or 48 hours of continuous irradiation of cells, depending on the experimental group) and 570 microwatts per square centimeter in vivo studies (from 8 a.m. to 8 p.m., for 14 days).

2.2 Western blot assay

Cell and histone proteins were collected in ice with RIPA buffer (89900, Thermo Fisher), supplemented with protease inhibitor cocktail (HY-k0010, MCE), and quantified using BCA method (P0009, Beyotime). The 20 μg protein was then transferred to a PVDF membrane (IPVH00010, Millipore) by 10% SDS-PAGE electrophoresis (161, 183, Bio-Rad) and a Trans-Blot Turbo transfer system (Bio-Rad). The membrane is plugged at room temperature with 5% skim milk and cut into different strips depending on where marked. The different strips were then incubated overnight with the specified antibody at 4℃. After about 24 hours, the membrane was tested at room temperature with an enzymo-labeled secondary antibody (1:500,7074P2, CST). Protein bands were visualized using a hypersensitive ECL kit (BL523B-2, Biosharp). The primary antibodies used were diluted with primary antibody dilution Buffer (P0023A, Beyotime) including anti-N-cadherin (1:1000, 13116, CST), anti-GAPDH (1:5000, 5174S, CST), anti-E-cad (1:1000, 3195S, CST), anti-Bax (1:1000, 41162, CST), anti- Bcl-2 (1:1000, 15071S, CST), anti- CDK2 (1:1000, 18048, CST), anti- cyclin A2 (1:1000, 4656S, CST), anti- ZO-1 (1:1000, 13663, CST).

2.3 Corneal fluorescein sodium staining

Wet the fluorescein sodium test paper (Tianjin Jingming New Technology, Tianjin, China) with PBS, apply the fluorescein sodium spot on the conjunctival sac, close the mouse's eye several times to make the dye coated evenly. The digital slit lamp analysis system (Chongqing Corneal Science and Technology, Chongqing, China) was switched to cobalt blue filter to observe the fluorescence staining of rabbit cornea, and the photos were recorded and scored. The scoring process is performed by the same person. The cornea was divided into four quadrants, and each quadrant was divided into 0~4 points depending on the staining degree and staining area. Finally, the total score was 0~16 points. 0 score: no corneal fluorescence staining; 1 part: scattered spot staining, <30 pieces; 2 marks: slightly dense punctate staining, >30, isolate; 3 marks: widespread diffuse staining, but no patchy color; 4 points: fusion, flake dyeing.

2.4 Cell counting kit-8 (CCK-8)

The hCECs were cultured per well in 96-well plates with a density of 6000 cells. After 48 hours incubation, we used CCK-8 kit (BS350A, Beyotime) following manufacturer’s instructions to detect cell viability. That was to say, the conditioned medium was replaced with a fresh serum-free medium containing 10% CCK-8, and the cells were incubated in 37°C darkness for 1 hour. Absorbance at 450 nm was detected using SpectraMax i3x microplate reader (Molecular Devices).

2.5 Cell scratch assay

The hCECs were seeded in 6-well plates (500,000 cells per well) and then cultured until the cell density was about 95% confluence. The cell was scratched with a 200 μl pipette tip, and the isolated cells and debris were removed with PBS. After cultured in serum-free MEM for 24h. And the representative images of wounds under the microscope were captured after cultured in serum-free MEM for 24 hours.

2.6 RNA extraction and qRT-PCR

Total RNA from cells was extracted and one-step reverse transcription polymerase chain reaction kit (RR036A, Takara) as employed to synthesize cDNA. AKT1 expression was measured using SYBR green reagent (RR091A, Takara) on QuantStudioTM Dx Real-Time PCR System (ABI) and GAPDH was designated as an internal reference. The sequence of primers: AKT1-F: TCCTCCTCAAGAATGATGGCA; AKT1-R: GTGCGTTCGATGACAGTGGT.

2.7 Cell reactive oxygen species (ROS) assay

According to the instructions (Beyotime, Shanghai, China), 48 hours after inoculation of hCECs into 96-well black plates with or without LY294002 and blue light (equal volume DMEM/F12), changes in intracellular ROS production levels were detected using ROS assay kits. HCECs were cleaned with DMEM/F12 and treated with 2 ', 7 '-dichlorodihydrofluorescein diacetate (DCFH-DA, 1:1000, DMEM/F12 dilution) at 37℃ for 20 min in the dark. FV3000 confocal microscope was used for observation.

2.8 Statistical analysis and figure creation.

All data are expressed as mean ± standard deviation of at least three independent experiments. Analysis of variance was performed using GraphPad Prism 8.0 software. One-way analysis of variance and t test were used to compare groups. P < 0.05 was considered statistically significant. We used Bio-render (https://app.biorender.com/) and Adobe illustrator (Adobe, CA, USA) to create figures.

3.1 Blue light inhibited cell viability and the AKT/p70S6K cascade, but promotes cell apoptosis of hCECs.

Firstly, we measured the intervention time for blue light production of hCECs using CCK-8 assay, CCK-8 assay revealed that hCECs viability was significantly decreased in 48h group, although there was no significant change in 24h group, compared with the 0h group (Figure 1B). Western blot revealed that ratio of p-AKT/AKT was significantly decreased in 48h group, and p-p70S6K/p70S6K was significantly decreased in both 24h and 48h groups (Figure 1 D-F), indicating that PI3K/AKT/p70S6K signaling was inhibited by blue light exposure. Furthermore, we further measured protein expression levels of Bax and Bcl-2. The expression levels of Bax showed a dramatic increase in 24h and 48h groups, but the expression levels of Bcl-2 only dramatically dropped in 48h group. Besides, the ratio of Bcl-2/Bax was dramatically dropped in both 24h and 48h groups (Figure 1 D and G-I). These results revealed that blue light exposure can inhibit cell viability but promote cell apoptosis of hCECs, and it also inhibit PI3K/AKT/p70S6K signaling in a time dependent manner. Collectively, 48 hours exposure of blue light showed a more stable and more significant effects than that in 24 hours. Therefore, we chose 48 hours exposure to carry out further experiments.

3.2 Blue light significantly inhibited cell viability through the inhibition of PI3K/AKT/p70S6K/CDK2/cyclin A2 cascade in hCECs.

To further study the impact of inhibition of PI3K/AKT signaling pathway, we chose LY294002, a classical inhibitor of AKT signaling, to treat hCECs. CCK-8 assay revealed that both blue light exposure and the treatment of LY294002 can decrease viability of hCECs both in 48h group and 0h group, and there are synergistic effects between these two treatments (Figure 2A). Thus, in order to more effectively demonstrated that PI3K/AKT signaling pathway was pharmacologically inhibited by LY294002, we selected 10μM LY294002 treatment for follow-up experiments. Western blot showed that compared with 0h-Dimethyl sulfoxide (DMSO) group, the ratio of p-AKT/AKT and p-p70S6K/p70S6K were dramatically decreased in 0h-LY294002, 48h-DMSO, and 48h-LY294002 groups (Figure 2, p< 0.05). These results further revealed that PI3K/AKT/p70S6K signaling was inhibited by blue light exposure in hCECs. Moreover, the protein expression levels of cyclin-dependent kinase-2 (CDK2) and cyclin A2, two substrates of PI3K/AKT signaling, were also significantly decreased in 0h-LY294002, 48h-DMSO, and 48h-LY294002 groups, compared with 0h-DMSO group (Figure 2, p< 0.05), indicating that cell proliferation of hCECs were inhibited by blue light exposure through PI3K/AKT signaling pathway. Therefore, we concluded that blue light inhibits cell viability through the inhibition of AKT/p70S6K/CDK2/cyclin A2 cascade in hCECs.

3.3 Blue light significantly inhibited migration and tight junction formation of hCECs via inhibiting PI3K/AKT signaling pathway.

Scratch assay showed that both LY294002 and 48h blue light exposure inhibited wound healing of hCECs in vitro (Figure 3A). Moreover, we further measured the expression levels of Zona occludens 1(ZO-1), E-cadherion (E-cad), N-cadherion (N-cad), and the E-cad/N-cad ratio. We found that in 0h-LY294002, 48h-DMSO, 48h-LY294002 groups, E-cad and ZO-1 protein expression were significantly increased, but the expression levels of N-cad were dramatically dropped, compared with 0h-DMSO group (Figure 3 C-F). Furthermore, the ratio of E-cad/N-cad was significantly increased (Figure 3G). These results revealed that the inhibition of PI3K/AKT signaling was critical in blue exposure-induced migration decline.

3.4 Blue light increased apoptosis of hCECs through inhibiting PI3K/AKT signaling pathway.

TUNEL assay revealed that compared with control group, both 0h-LY294002 and 48h-DMSO group dramatically promoted apoptosis of hCECs (Figure 4A-B). The protein expression levels of Bax were increased in 0h-LY294002 and 48h-DMSO groups. Moreover, the protein expression levels of Bcl-2, but the ratio of Bcl-2/Bax were dramatically decreased in 0h-LY294002, 48h-DMSO, 48h-LY294002 groups (Figure 4C-F, p<0.05). These results indicated that both LY294002 and blue light exposure can increase cell apoptosis of hCECs via inhibiting PI3K/AKT signaling pathway.

3.5 Blue light induced ROS stress accumulation hCECs and corneal epithelial damage in mouse cornea through inhibiting AKT signaling pathway.

ROS fluorescence showed that compared with control group, both 0h-LY294002 and 48h-DMSO can significantly increase ROS levels (Figure 5 A-B). Thus, we found that blue light exposure can induce activation of ROS in hCECs.

In addition, we stained and measured corneal epithelial damage in mice after blue light exposure and LY294002 treatment by corneal epithelial fluorescein sodium staining. Corneal fluorescein sodium staining experiment showed that after 14 days of blue light exposure, mouse corneal fluorescein sodium staining was 10.67 ± 1.247, which was significantly higher than that after 14 days of environment light exposure (6.67 ± 2.625). Actually, we found significant damage to the corneal epithelium in mice after 7 days of continuous eye drops of LY294002 solution or 14 days of blue light exposure, with statistically significant differences (Figure 5 C-D). Furthermore, both 7 days and 14 days of LY294002 treatment can also lead to corneal epithelial wound. These results indicated that blue light can cause corneal epithelial injury in mouse cornea through inhibiting PI3K/AKT signaling pathway.

Corneal epithelium is the most active tissue in cornea, and the injury and metabolic abnormality of corneal epithelial cells may lead to various diseases, especially keratitis and dry eye. In recent years, with the wide application of electronic screens and the increase of people's use of electronic screens and LED energy-saving lamps, blue light, which constitutes the LED light source, has increasingly become an important cause of harm to human eye health. The corneal epithelium is the first to suffer sustained photochemical and physical damage from blue light exposure. In our study, we investigated the effects of blue light exposure on cell proliferation, migration, apoptosis, ROS production, and tissue damage via the AKT/p70S6K signaling pathway in hCECs and mice cornea. In detail, by inhibiting AKT/p70S6K signaling, blue light exposure can inhibit cell proliferation, migration, and promote ROS levels and apoptosis in hCECs. Moreover, the inhibition of AKT/p70S6K signaling in mice cornea in vivo can lead to the delay of wound healing of mice corneal epithelium.

PI3K/AKT signaling has been regard as a vital regulator in cell apoptosis, viability and proliferation in corneal tissues and diseases(16). For example, upregulating PI3K/AKT signaling through the treatment of mesenchymal stem cell - derived extracellular vesicles or topical ascorbic acid can limit caspase-3 activation and endoplasmic reticulum stress-mediated apoptosis in human corneal endothelial cells(16, 17). Moreover, lipopolysaccharides inhibited the High mobility group I protein /PI3K/AKT signaling pathway, leading to the inhibition of cell viability and promotion of hCECs in vitro(18). Besides, CDK2 is considered to be an important regulatory factor of cell cycle. It binds to a variety of cyclins such as cyclin A2 in the nucleus to form CDK2-cyclins complex, which maintains and promotes cell proliferation and cell survival(19, 20). Furthermore, overactivation of AKT/CDK1 cascade was the reason of corneal epithelial progenitor cells over proliferation(21). In our study, we demonstrated that sustained blue light exposure inhibits cell activity and proliferation by inhibiting the AKT/p70S6K/CDK2/cyclin A2 signaling cascade and promotes apoptosis by inhibiting the PI3K/AKT/Bcl-2/Bax signaling cascade for the first time (Figure 2A-F).

The PI3K/AKT signaling is essential to maintain ROS balance in cornea. For example, the decline of PI3K/AKT signaling can directly facilitate the promotion of oxidative stress induced by paraquat in both corneal endothelial cells and corneal epithelial cells damage in vitro(17, 22). However, Xu et al. realized that high glucose can suppress PI3K/AKT signaling through increasing ROS in mice corneal epithelial in vivo, indicating that ROS were also the upstream regulators of the PI3K/AKT signaling pathway(23). In this study, we found that blue light-induced suppression of PI3K/AKT signaling can increase accumulation of ROS in hCECs in vitro, indicating the vital role of PI3K/AKT signaling in ROS metabolism in corneal epithelium under the blue light exposure. Actually, many previous researches showed that blue light exposure can induce apoptosis of CECs in vivo and/or in vitro(2, 24). And dysregulation of ROS stress is widely considered as an important mechanism of corneal epithelial damage caused by excessive blue light exposure(25-27). In detail, excessive ROS accumulation led to apoptosis of CECs in corneal tissue in vivo and in vitro(28, 29). Therefore, the relationship between PI3K/AKT and ROS under the exposure of blue light needs to be further studied.

The PI3K/AKT signaling pathway has been shown to regulate the cell adhesion and migration of corneal cells, particularly by regulating the structural stability of adherens junctions and tight junctions, all of which can regulate the wound healing of corneal epithelium(30-33). For example, Li et al. revealed that phosphatase and tensin homolog can inhibit cell migration and proliferation in mice corneal epithelium through suppressing PI3K/AKT signaling(31). Cadherins are transmembrane glycoproteins that are mainly involved in the connection between homologous cells and are divided into E, P and N types. E-cad was mainly distributed in various epithelial cells, and participated in cell adhesions(34). Down-regulation of E-cad reduces the strength of cell adhesion between epithelial cells, resulting in the promotion of cell motility and migration. Decreased E-cad expression usually indicates the disintegration of intercellular adhesion connections, which is highly correlated with increased cell migration in tumor cells(35). N-cad is a transmembrane protein expressed in a variety of tissues and mediate cell-cell adhesion and promoting cell migration. More specifically, increased E-cad and decreased N-cad are considered as cadherin switching, which are associated with decreased cell migration(35-37). Besides, tight junction formation can also be suppressed by diabetes-induced PI3K/AKT/ZO-1 cascade impairment(38). Our research revealed that blue light exposure caused the inhibition of cell migration in hCECs via suppressing the PI3K/AKT/E-cad signaling pathway. Furthermore, inhibition of PI3K/AKT signaling can also cause the ZO-1 downregulation, which indicated disintegration of tight junction between hCECs. We speculated that these effects were associated with the delay of wound healing of corneal epithelium under the exposure of blue light.

In conclusion, we found that blue light exposure caused the promotion of cell apoptosis, the accumulation of ROS and suppression of cell migration, proliferation and viability through the inactivation of PI3K/AKT/p70S6K signaling pathway in hCECs in vitro. Moreover, blue light exposure also induced the corneal epithelial defects and delayed corneal epithelial wound healing in mice cornea (concluded in Figure 6). Collectively, these results suggest that PI3K/AKT signaling pathway may be an important target for the treatment of corneal epithelial injury caused by blue light exposure.

Ethics approval and consent to participate

The animal experiment in this study was approved by the Animal Ethics Committee of Zhejiang University.

Consent for publication

Not applicable.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests

The authors declare that they have no competing interests.

Funding

This work was supported by the Strategic Priority Research Program of Chinese Academy of Sciences (Grant number XDA16040200), the Natural Science Foundation of Zhejiang Province (Grant number LZ19H120001), the Major Science and Technology Project of Zhejiang Province (Grant number 2018C03017), the Nature Science Foundation of China (No. 82201194), the Zhejiang Medical Health Science and technology program (Grant number WKJ-ZJ-1820), the Traditional Chinese Medicine innovative talent support program (Grant number 2023ZR106).

Authors’ contributions

KQC designed and carried out experiments and wrote manuscript. QJY and JFL conducted experiments and revised manuscript. YTX,LJ,XY,LYZ,YYW,XL,CX,SYS and XWW revised manuscript. JPT and YS designed experiments and wrote the manuscript.

Acknowledgments

None.

Fernandes-Cunha GM, et al. (2017) Immobilization of Growth Factors to Collagen Surfaces Using Pulsed Visible Light. Biomacromolecules18: 3185-3196.
Ouyang X, et al. (2020) Mechanisms of blue light-induced eye hazard and protective measures: a review. Biomed Pharmacother130: 110577.
Zhao ZC, Zhou Y, Tan G, Li J. (2018) Research progress about the effect and prevention of blue light on eyes. International journal of ophthalmology11: 1999-2003.
Wang L, et al. (2023) Long-term blue light exposure impairs mitochondrial dynamics in the retina in light-induced retinal degeneration in vivo and in vitro. Journal of photochemistry and photobiology. B, Biology240: 112654.
Zhang D, et al. (2022) Blue light attenuates TGF-β2-induced epithelial-mesenchymal transition in human lens epithelial cells via autophagy impairment. BMC ophthalmology22: 456.
Nan L, et al. (2023) Influence of Light-EmittingDiode-Derived Blue Light Overexposure on Rat Ocular Surface. Journal of ophthalmology2023: 1097704.
Manning BD, Toker A. (2017) AKT/PKB Signaling: Navigating the Network. Cell169: 381-405.
Chen K, et al. (2022) The role of the PI3K/AKT signalling pathway in the corneal epithelium: recent updates. Cell death & disease13: 513.
Chen KQ, Wei BH, Hao SL, Yang WX. (2022) The PI3K/AKT signaling pathway: How does it regulate development of Sertoli cells and spermatogenic cells? Histology and histopathology37: 621-636.
Liu Z, et al. (2020) Trehalose Induces Autophagy Against Inflammation by Activating TFEB Signaling Pathway in Human Corneal Epithelial Cells Exposed to Hyperosmotic Stress. Invest Ophthalmol Vis Sci61: 26.
Hwang SB, et al. (2020) Protective Effects of Cyclosporine A Emulsion Versus Cyclosporine A Cationic Emulsion Against Desiccation Stress in Human Corneal Epithelial Cells. Cornea39: 508-513.
Vitoux MA, et al. (2020) Benzalkonium chloride-induced direct and indirect toxicity on corneal epithelial and trigeminal neuronal cells: proinflammatory and apoptotic responses in vitro. Toxicol Lett319: 74-84.
Finburgh EN, et al. (2023) Role of FGF10/FGFR2b Signaling in Homeostasis and Regeneration of Adult Lacrimal Gland and Corneal Epithelium Proliferation. Invest Ophthalmol Vis Sci64: 21.
Tavakkoli F, et al. (2023) Corneal stem cells niche and homeostasis impacts in regenerative medicine; concise review. European journal of ophthalmology: 11206721221150065.
Buono L, et al. (2021) Mesenchymal Stem Cell-Derived Extracellular Vesicles Protect Human Corneal Endothelial Cells from Endoplasmic Reticulum Stress-Mediated Apoptosis. Int J Mol Sci22.
Hsueh YJ, et al. (2020) Topical Ascorbic Acid Ameliorates Oxidative Stress-Induced Corneal Endothelial Damage via Suppression of Apoptosis and Autophagic Flux Blockage. Cells9.
Li X, Sun M, Long Y. (2020) Cyanidin-3-O-Glucoside Attenuates Lipopolysaccharide-Induced Inflammation in Human Corneal Epithelial Cells by Inducing Let-7b-5p-Mediated HMGA2/PI3K/Akt Pathway. Inflammation43: 1088-1096.
Lee JG, Jung E, Heur M. (2018) Fibroblast growth factor 2 induces proliferation and fibrosis via SNAI1-mediated activation of CDK2 and ZEB1 in corneal endothelium. J Biol Chem293: 3758-3769.
Kong Y, et al. (2020) Wilms' tumor 1-associating protein contributes to psoriasis by promoting keratinocytes proliferation via regulating cyclinA2 and CDK2. International immunopharmacology88: 106918.
Li S, et al. (2022) Sleep deprivation induces corneal epithelial progenitor cell over-expansion through disruption of redox homeostasis in the tear film. Stem Cell Reports17: 1105-1119.
Yang L, et al. (2016) Substance P Inhibits Hyperosmotic Stress-Induced Apoptosis in Corneal Epithelial Cells through the Mechanism of Akt Activation and Reactive Oxygen Species Scavenging via the Neurokinin-1 Receptor. PLoS One11: e0149865.
Xu KP, Li Y, Ljubimov AV, Yu FS. (2009) High glucose suppresses epidermal growth factor receptor/phosphatidylinositol 3-kinase/Akt signaling pathway and attenuates corneal epithelial wound healing. Diabetes58: 1077-1085.
Jin R, et al. (2022) Melatonin Type 2 Receptor Activation Regulates Blue Light Exposure-Induced Mouse Corneal Epithelial Damage by Modulating Impaired Autophagy and Apoptosis. Int J Mol Sci23.
Li Y, et al. (2021) Blue Light Induces Impaired Autophagy through Nucleotide-Binding Oligomerization Domain 2 Activation on the Mouse Ocular Surface. Int J Mol Sci22.
Marek V, et al. (2018) Blue light phototoxicity toward human corneal and conjunctival epithelial cells in basal and hyperosmolar conditions. Free radical biology & medicine126: 27-40.
Lee JB, et al. (2014) Blue light-induced oxidative stress in human corneal epithelial cells: protective effects of ethanol extracts of various medicinal plant mixtures. Invest Ophthalmol Vis Sci55: 4119-4127.
Zhang X, Qiu J, Huang F, Shan K, Zhang C. (2022) Type 2 Diabetes Mellitus Makes Corneal Endothelial Cells Vulnerable to Ultraviolet A-Induced Oxidative Damage Via Decreased DJ-1/Nrf2/NQO1 Pathway. Invest Ophthalmol Vis Sci63: 25.
Zhang ZN, et al. (2022) Effects of Nickel at Environmentally Relevant Concentrations on Human Corneal Epithelial Cells: Oxidative Damage and Cellular Apoptosis. Biomolecules12.
Cao Q, Li Y, Li Y, Li L. (2021) miR-151-5p alleviates corneal allograft rejection by activating PI3K/AKT signaling pathway and balancing Th17/Treg after corneal transplantation via targeting IL-2Rɑ. Annals of translational medicine9: 1410.
Li J, et al. (2020) PTEN Inhibition Facilitates Diabetic Corneal Epithelial Regeneration by Reactivating Akt Signaling Pathway. Translational vision science & technology9: 5.
Wang M, et al. (2022) The Therapeutic Roles of Recombinant Hsp90α on Cornea Epithelial Injury. Invest Ophthalmol Vis Sci63: 30.
Nam SM, Maeng YS. (2019) Wound Healing and Mucin Gene Expression of Human Corneal Epithelial Cells Treated with Deproteinized Extract of Calf Blood. Current eye research44: 1181-1188.
Li L, et al. (2012) E-cadherin plays an essential role in collective directional migration of large epithelial sheets. Cell Mol Life Sci69: 2779-2789.
Huang H, Wright S, Zhang J, Brekken RA. (2019) Getting a grip on adhesion: Cadherin switching and collagen signaling. Biochimica et biophysica acta. Molecular cell research1866: 118472.
Walshe J, Richardson NA, Al Abdulsalam NK, Stephenson SA, Harkin DG. (2018) A potential role for Eph receptor signalling during migration of corneal endothelial cells. Experimental eye research170: 92-100.
Wheelock MJ, Shintani Y, Maeda M, Fukumoto Y, Johnson KR. (2008) Cadherin switching. J Cell Sci121: 727-735.
Jiang QW, et al. (2019) Diabetes inhibits corneal epithelial cell migration and tight junction formation in mice and human via increasing ROS and impairing Akt signaling. Acta Pharmacol Sin40: 1205-1211.

Download PDF

Version 1

posted

You are reading this latest preprint version

Blue light exposure promotes reactive oxygen stress, apoptosis and suppresses viability, migration and wound healing of cornea via inhibiting PI3K/AKT signaling pathway in corneal epithelial cells.

Status:

Version 1

Abstract

Figures

1. Background

2. Method

3. Result

4. Discussion

5. Conclusion

Declarations

References

Status:

Version 1