2.1 Cell lines and culture
Human NSCLC cell lines (H460, A549, H1299, PC9, H1975) and 293T cells were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Human normal bronchial epithelial cell line BEAS-2B was a gift from Dr. Y. Sun (Nanjing Medical University, Jiangsu, China). All the above cell lines were maintained in RPMI-1640 (Gibco-Invitrogen) or DMEM (Gibco-Invitrogen, CA, USA) supplemented with 10% fetal bovine serum (VACCA, Shanghai, China) and penicillin (100 U/ml)–streptomycin (100 μg/ml) less than 15 passages, and authenticated by Biowing Biotech (Shanghai, China). These cell lines were cultured in a humid incubator (5% CO2, 37℃).
2.2 Lentivirus production
The PAICS knockdown and the scramble control lentiviral plasmids (shPAICS-1 or shPAICS-3, shNC) were obtained from Tsingke Biotechnology (Beijing, China). 293T cells were seeded into several 15-cm dishes (5 × 106 cells/dish) for 24 h before transfection. When the cell density reaches 60%–70%, a mixture containing 13.32 μg of shPAICS/shNC Plasmid, 6.66 μg of pMD2.G, and 9.99 μg of pSPAX2 was transfected to each 15-cm dish 293T cells. The cells were replenished with a fresh medium after 18 h post-transfection. After another 48 h, the supernatant containing the lentivirus was collected and filtered through a 0.45-μm low protein binding membrane. Subsequently, the virus was stored at -80℃.
2.3 Stable cell line generation
A549, H460, H1299, 2B, PC9 and H1975 cells were infected with lentivirus and selected by puromycin to generate stable shPAICS cells. The knockdown status was validated by western blot analysis.
2.4 CRISPR/Cas9 screening with LentiCRISPRv2 library
Genome-wide CRISPR knockout screening was performed as described. As the GeCKO v2.0 library contains 123411 sgRNAs targeting 19050 genes, about 1.6×108 NCI-H460, A549 and BEAS-2B cells need to be infected to achieve 300-fold coverage at a multiplicity of infection of 0.3-0.5. Cells were seeded in 12-well plates for 24 h and then infected with lentivirus by centrifuging at 2000 rpm for 2 h at 37℃ in the presence of 8 μg/ml polybrene to increase transduction efficiency. After the spin, cells were replenished with fresh media (without polybrene) and cultured for another 24 h. Then, those cells were cultured in 15-cm dishes to an appropriate density. Puromycin was then added into cells for 7 days at 1 μg/ml for A549 and BEAS-2B, and 2 μg/ml for NCI-H460 cells. 4 × 107 cells were harvested and stored at -80℃ for subsequent genomic DNA (gDNA) isolation (as Day 0). Meanwhile, other 4 × 107 cells were cultured every 3 days to maintain adequate sgRNA library complexity. On the 14th day, 4 × 107 cells were collected for gDNA isolation and next-generation sequencing (as Day 14). MAGeCKFlute was used to analyze and identify candidate genes.
2.5 Cell proliferation assay
Cell proliferation was assessed using the Cell Counting Kit-8 (CCK8, Yeasen, Shanghai, China). A549, H460, H1299, 2B, PC9 and H1975 cells (1 × 103 cells/well) were seeded into a 96-well plate and severally cultured for 24, 48 and 72 h. The absorbance was measured at 450 nm using a multi-function microplate reader (Fluoroskan Ascent FL analyzer) after cells were incubated with CCK8 at 37℃ for 3 h.
2.6 Colony formation assay
A549, H460, H1299, 2B, PC9 and H1975 cells (500 cells/well) were seeded into 12-well plates and incubated for 14 days at 37℃ with 5% CO2 in a humidified incubator. After incubation, the culture medium was discarded, and cells were washed with PBS. Finally, the cells were fixed with 4% paraformaldehyde and stained with a Giemsa Stain solution. Finally, all colonies were manually scored.
2.7 Cell cycle analysis and apoptosis assay
For analysis of the cell cycle, H1299, A549 and H460 cells were seeded in six-well plates and incubated with different treatments. Cells were washed twice in ice-cold PBS and fixed in 75% cold ethanol overnight at 4℃. After removing the ethanol, the fixed cells were washed with pre-cold PBS twice, treated with 0.1 mg/ml RNase A at 37◦C in the dark for 30 min, and stained with 50 μg/ml of propidium iodide (PI) (SigmaAldrich, St Louis, USA) solution in the dark for 5 min. Finally, the stained cells were analyzed with a FACS Calibur flow cytometer.
For apoptosis assay, H1299, A549 and H460 cells in the logarithmic growth phase were seeded in six-well plates, then incubated at 37℃ and 5% CO2 condition. After incubation, the cells were rinsed with pre-cold PBS twice and then stained with Annexin V and PI according to the manufacturer' 's instructions. A flow cytometer was used to analyze the stained cells within 1 h.
2.8 Western blot
Proteins were extracted from A549, H460, H1299, 2B, PC9 and H1975 cells by RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) containing 0.1M PMSF and protease inhibitors (Roche, Basel, Switzerland). Proteins were quantified by the BCA Protein Assay Kit (Yeasen, Shanghai, China). Proteins were fractionated by SDS-PAGE, and then transferred to PVDF membranes (Merck Millipore, MA, USA), and blocked with 3% bovine serum albumin for 2 h at room temperature (RT). The membranes were probed with primary antibodies at 4℃ overnight. The following primary antibodies were used for immunoblotting: PAICS (ProteinTech, no. 12967-1-AP), GAPDH (ProteinTech, no. 60004-1-lg), CyclinE (Santa-Cruze, no. sc-377100), CyclinD1/CDK2/CDK6 (Cell Signaling Technology, Cell Cycle Regulation Antibody Sampler Kit, no. 9932T), Phospho-Rb (Cell Signaling Technology, no. 8516S). Then, the membranes were washed by TBST (1×) and incubated with a corresponding horseradish peroxidase-conjugated secondary antibody for 2 h at RT. The immunoreactive bands were visualized using an ECL kit (Beyotime, Shanghai, China) and analyzed using Imager software (Tanon, Shanghai, China).
2.9 Immunofluorescence assay
A549, H460, H1299 and 2B cells cultured on confocal dishes were fixed with 4% paraformaldehyde (Sigma) for 15 min at RT and permeabilized with 0.1% Triton X-100 for 15 min at 37℃. After blocking with 10% goat serum for 1 h at RT, cells were incubated with the primary antibodies against PAICS Rabbit IgG (ProteinTech, 1:100 dilution) at 4℃ overnight. The next day, cells were incubated with corresponding secondary antibodies against Cy3 Anti-Rabbit IgG (Absin, 1:100 dilution) combined with FITC-γH2AXMouse IgG (Biolegend, 1:100 dilution) at RT for 90 min. 4′,6-diamidino-2-phenylindole (DAPI, Yeasen Biotechnology) was then applied to stain the nuclei. Finally, the images of immunofluorescence were obtained with the confocal laser-scanning microscope (Carl Zeiss, Jena, Germany).
2.10 RNA isolation and qRT-PCR
Total RNA was extracted from H460 and H1299 cells by Trizol reagent (Invitrogen) and used to synthesize cDNA with the PrimeScriptTM RT reagent Kit (TaKaRa, Dalian, China) according to the manufacturer' s instructions. qRT-PCR was performed on an ABI 7900HT PCR sequencer (Applied Biosystems, Massachusetts, USA) using TB Green® Premix Ex Taq™ II (TaKaRa). Primers sequences used for qRT-PCR were as follows: FANCI, forward: 5′-CCACCTTTGGTCTATCAGCTTC-3′, reverse: 5′- CAACATCCAATAGCTCGTCACC-3′. GAPDH, forward: 5′-TGCACCACCAACTGCTTAGC -3′, reverse: 5′- GGCATGGACTGTGGTCATGAG -3′. MSH2, forward: 5′-CACTGTCTGCGGTAATCAAGT-3′, reverse: 5′- CTCTGACTGCTGCAATATCCAAT-3′. XRCC2, forward: 5′- TGCTTTATCACCTAACAGCACG-3′, reverse: 5′-TGCTCAAGAATTGTAACTAGCCG -3′. FANCD2, forward: 5′-AAAACGGGAGAGAGTCAGAATCA-3′, reverse:5′-ACGCTCACAAGACAAAAGGCA-3′. GTF2H2C: forward: 5′- TTCCGGCTGAGAGTCCTTCT -3′, reverse:5′- TCCTCCTTCCCTATGAGCCC -3′. Fold changes in mRNA expression were calculated using 2-ΔΔCt and standardized based on GAPDH.
2.11 Tumor xenograft model
Mice were housed and handled according to institutional guidelines complying with local legislation. All experiments with animals were approved by the animal experiment committee of Nanjing Medical University. All BALB/C mice were purchased from Jiangsu GemPharmtech co., Ltd (Nanjing, China) and were adapted to the environment for a week before the experiment. To determine the role of PAICS in vivo, H1299 cells (5 × 106 cells/mouse) with stable knockdown of PAICS and the corresponding control were injected subcutaneously into the mice (18 mice/group). Tumor size was measured every five days and calculated using the following formula: volume = (length × width2) × 0.5. After seven weeks, eight mice/group were sacrificed, and tumors were removed, weighed, and fixed for immunohistochemistry detection of Ki67 (Servicebio, GB111499). Once the tumor volume reached 2000 mm3, mice were sacrificed by cervical dislocation and recorded as dead.
2.12 Tissue microarray and IHC
Lung cancer (HLugA180Su02) was purchased from Outdo Biotech (Shanghai, China). Patients who lacked paired non-tumor tissues or had tissue flaking, or failed to follow up were excluded. IHC staining was performed as previously described. PAICS antibody (ProteinTech, no. 12967-1-AP) was used as the primary antibody.
2.13 Gene expression analysis using publicly available datasets
Gene expression levels of PAICS in tumors and adjacent normal samples were obtained from UALCAN (http://ualcan.path.uab.edu), Gepia (http://gepia2.cancer-pku.cn/#analysis) and TNMplot (https://tnmplot.com/analysis/). The Kaplan-Meier analysis was performed with the data downloaded from Kaplan-Meier Plotter (http://kmplot.com/analysis/). CancerSEA (http://biocc.hrbmu.edu.cn/CancerSEA/) which depicts single-cell functional status maps was used to analyze the roles of PAICS. Protein-Protein Interaction Networks were analyzed by String (https://cn.string-db.org/). The ‘Top KEGG Enrichment’ terms were analyzed with the R analysis (R version 4.2.2) using the TCGA database.
2.14 RNA sequencing analysis and gene annotation
Whole RNA was extracted the same as qRT-PCR. RNA samples were subjected to RNA sequencing (RNA-seq) analysis on the BGISEQ-500 system by Beijing Genomics Institute (BGI), China.
2.15 Statistical analysis
Statistical analysis was performed using GraphPad Prism software (9.0, GraphPad Software, Inc.). Each experiment was repeated three times. Data are presented as the mean ± standard deviation. Unpaired Student' s t-test was used for two-group comparisons, and one-way ANOVA followed by Tukey' 's post hoc test was used for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.