Quercetin-loaded Solid Lipid Nanoparticles Effectively Inhibit the Growth of Invasive Breast Cancer Cell Line MDA-MB 231

doi:10.21203/rs.3.rs-2635092/v1

Download PDF

Research Article

Quercetin-loaded Solid Lipid Nanoparticles Effectively Inhibit the Growth of Invasive Breast Cancer Cell Line MDA-MB 231

https://doi.org/10.21203/rs.3.rs-2635092/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 13 Oct, 2023

Read the published version in Molecular Biology Reports →

You are reading this latest preprint version

Background: Quercetin (QC) is a natural flavonoid abundant in fruits and vegetables. The anticancer and anti-inflammatory effects of quercetin have been reported previously, but the clinical application has been limited because of its low bioavailability. Triple-negative breast cancer is a type of breast cancer that responds poorly to chemotherapy. This study aims to determine the anti-cancer impact of quercetin-solid lipid nanoparticles (QC-SLN) on the triple-negative breast cancer cell line MDA-MB231.

Materials and Methods: Following a 48-hour treatment with 18.9 µM of QC and QC-SLN for MCF-7 and 13.4 µM for MDA-MB231, cell viability, apoptosis, the colony formation assay, and the anti-angiogenic effect of treatment were assessed.

Results: QC-SLN was constructed with the best properties (particle size of 154 nm, zeta potential of -27.7 mV, and encapsulation efficacy of 99.6%) and continuously released QC in 72 h .in QC-SLN group compared to the QC group, There was a significant decrease in cell viability, colony formation, angiogenesis and in addition, a significant increase in apoptosis, throughout modulation in Bax and Bcl-2 at gene and protein level.

Conclusions: Our findings indicated that SLN enhanced the cytotoxic effect of QC in MDA-MB231 cells by improving bioavailability and apoptotic intrinsic pathways. It may be a promising therapy for the future, but more in vivo study is needed.

solid lipid nanoparticles (SLN)

quercetin

apoptosis

invasive

breast cancer

After cardiovascular disease, cancer is the second cause of death word wide. Amongst cancers, breast cancer is one of the prominent causes of cancer mortality among women and the most common cancer diagnosed globally. It is responsible for around 14% of all females’ malignancies and the 685,000 women deaths in 2020. Chemo and radiation therapy are both potent treatments for breast cancer [dan1, 2-4], but they are associated with several side effects; hence, to reduce complications, recent research efforts have concentrated on discovering safe and effective natural bases remedies [5-7].

Quercetin (QC) a strong flavonoid with anti-inflammatory and anti-cancer properties, is found in numerous fruits and vegetables, including citrus fruits, apples, radish leaves, red onions, and ets. It has been established that QC has cytotoxic properties for a variety of cancer cell types [8-11]. indeed, of the therapeutics effect of QC, its clinical applications have been restricted due to low solubility and poor bioavailability [12, 13]. Several drug delivery methods, including liposomes, polymers, and solid lipid nanoparticles (SLNs), have been developed, which could help improve solubility and bioavailability. Researchers have recently focused on using SLNs as carriers for chemical and natural drugs, including flavonoids [14-20]. For example, SLNs containing tamoxifen can effectively shrink breast cancer [21] , and SLNs containing pomegranate extract can effectively inhibit the growth of several cancer cells, such as prostate, breast, and liver cancer cells [22]. SLNs through protecting the drug from chemical breakdown, increasing the half-life, and slowly releasing of them, enhance the drug's effectiveness [23-25].

Although several investigations have been conducted into the anti-tumor effect of different nature-derived remedies loaded with SLN (27-29), their cytotoxic mechanisms have been less studied. Because Cancer cells' resistance to apoptosis is a major obstacle in cancer treatment, establishing and developing any therapeutic method to overcome drug resistance will be valuable. Several studies have demonstrated that drugs loaded with SLN could partially overcome drug-resistance, so this type of treatment could improve the success of drug therapy. This research aimed to evaluate the cytotoxic and apoptotic effect of quercetin-loaded-SLN (QC-SLNs) on highly invasive MDA-M231 breast cancer cells.

2.1. Preparation of QC-SLN

4.75 gr of Compritol 888 ATO (Glyceryl, Dibehenate, Gattefossé, France) were heated to 75 °C and mixed with 100 mg of QC. In a separate beaker, 0.25 gr of oleic acid and 0.5 gr of lecithin were added to heated (80 °C) deionized water, stirred for 5 minutes, and then completely mixed with a prior solution using a sonicator (Elmasonic S60H, Global Industrial, USA). To generate the nanoemulsion, 4 mL of 1% polyvinyl alcohol (PVA) at 3 °C was added to the prior solution and homogenized at 10,000 rpm using a homogenizer (Heidolph, Germany). The suspension was centrifuged twice at 5 °C and 25,000 RCF for 20 minutes. The QC-SLNs were kept refrigerated in sealed containers until used.

2.2. Fourier Transform Infrared (FTIR)

After loading the QC into the SLN, FTIR spectra (VERTEX 70v, Bruker in the United States) were analyzed to confirm the intermolecular interactions. The pellets were produced by crushing QC, QC-SLN, and blank-SLN at 200 kg/cm² with KBr. The FTIR spectra of the material mentioned above were acquired in the range of 400–4,000 cm^-1 with a resolution of 1 cm^-1.

2.3. Transmission Electron Microscopy (TEM)

Using transmission electron microscopy (TEM), the morphology of SLN was examined. A droplet of the SLN was put onto the carbon-coated copper grid to generate a thin liquid layer. Extra samples were collected on filter paper and permitted to air-dry at room temperature for 5 minutes, and the morphology of SLN was evaluated using TEM (ZEISS LEO 906 E).

2.4. Particle Size and Zeta Potential

The average particle size, zeta potential, and polydispersity index (PDI) of QC-SLNs were analyzed by a nanosizer and a zetasizer (Malvern, England).

2.5. Encapsulation Efficiency (EE)

To determine the EE at the first step, separation of free (untrapped) QC from QC-SLN in the suspension by centrifugation at 25,000 rpm for 25 minutes was done, and the QC content of the supernatant was measured at 256 nm using UV spectrophotometer. The EE was calculated using the following formula [26, 27].

EE (%) =100 (Di - Df) /Di

Where Di and Df represent the initial (total) and free (untrapped) drug concentrations, respectively. By dissolving QC-SLN in methanol and measuring its QC content with a spectrophotometer at 256 nm, the drug loading (DL) was determined via the below formula

DL (%) = 100 (loaded drug/weight of lipid).

2.6. In vitro drug release

At 37°C, the dialysis bag method (MW cut-off of 12,000 Da, Sigma-Aldrich, USA) [28] was utilized to measure QC release from QC-SLNs in PBS (pH 7.42) as the receptor phase. Samples were collected at predefined intervals (from 5 minutes to 72 hours) and their QC content assessed spectrophotometrically (Ultrospec 3000, Pharmacia Biotech, USA) at 256 nm.

2.7. Cell Culture

Design of Experiments

The MCF-7 and MDA-MB231 breast cancer cell lines, as well as the MRC5 normal lung fibroblast cells, were cultured in DMEM high glucose medium supplied with streptomycin (100 U/mL), fetal bovine serum (FBS) (10%), and penicillin (100 mg/mL), which were acquired from the Iranian Pasteur Research Center. The cells were maintained in an incubator at 37 °C, 95 % humidity, and 5% CO₂. Different concentrations of QC (0-400 µM), QC-SLN, and blank SLN (2.5-50 µM) were used to determine the IC50 after 24 and 48 h incubation.

2.8. Cell Viability

The MTT assay was utilized to evaluate the treatment's effect on the cells' viability. Following the culture of breast cancer cells and MRC5 cells (4 x 103 cells/well) in 96-well plates for 24 and 48h, each well was then incubated for four hours at 37 °C with 0.5 mg/mL MTT solution. After removing the supernatant from each well, 100 µL of DMSO was added, and the absorbance of the sample was measured at 570 nm using an Elisa reader (BioTek, ELx800, USA).

2.9. Clonogenic Assay

The Clonogenic assay evaluated the anti-proliferative effect of QC and QC-SLNs on MCF-7 and MDA-MB-231 cells. 2000 cells were cultivated into six-well plates and incubated with 18.9 µM of QC, QC-SLNs, and blank -SLN for MCF-7 and 13.4 µM of QC, QC-SLNs, and blank -SLN for MDA-MB 231 for 48 hours. Then the medium containing treatments was replaced by fresh complete media (DMEM with 10% FBS plus 1% penicillin/strep) without any treatment, and the cells were grown for 14 days. The colonies were fixed with formaldehyde, stained with 0.5% crystal violet in PBS, and counted using a light microscope. Then the media containing treatments were replaced by fresh complete media (DMEM with 10% FBS plus 1% penicillin/strep) without any treatment, and the cells were grown for 14 days. The colonies were fixed with formaldehyde, stained with 0.5% crystal violet in PBS, and counted using a light microscope.

2.10. Flow Cytometry Analysis

In a six-well plate, 4 x 10⁵MCF-7 and MDA-MB-231 cells were cultured and treated with QC and QC-SLN for 48h. Subsequently, Using the Annexin V-FITC/propidium iodide assay kit (IQ Products, Rozenburglaan, Netherlands), the percentage of normal, apoptotic, and necrotic cells were determined according to the manufacturer's instructions. In brief, the cell pellets After rinsing with PBS, were resuspended in 500 µl of the binding buffer, and 5 µl of Annexin V-FITC was incubated for 10 minutes with 5 µl of propidium iodide (PI). The samples were then diluted to 100 µl with binding buffer and examined with a flow cytometer (Becton Dickinson, San Jose, California, United States of America).

2.11. Real-Time Polymerase Chain Reaction

According to the company's directions, 10⁶ cells were used in the RNA extraction process, and total RNA was isolated using the RNX-Plus Solution. The ratio of A260/A280 and agarose gel electrophoresis were evaluated to confirm the purity and integrity of the RNA. The isolated RNA was kept at -70 °C in 50 µl of DEPC-treated water. Following the company's directions, the cDNA synthesis kit was used to do reverse transcription in a 20 µl reaction mixture. SYBR Green qPCR Master mix (Yekta Tajhiz Azuma, Tehran, Iran) was used to quantify the expression of the Bax, Bcl-2, and GAPDH genes. The PCR program was done as follows; 10 min at 96° C, 40 cycles of 15 s at 95° C, 30 s at 60° C, and 34 s at 60° C. GAPDH was used as a housekeeping gene to calibrate expression levels. The 2^-ΔΔCT formula was used to calculate the fold changes. The sequences of the primers are presented in Table 1.

Table 1. Primer sequences for qRT‐PCR

Gene	Forward primer	Reverse primer
Bax	CAAACTGGTGCTCAAGGCCC	GCGTCCCAAAGTAGGAGAGG
Bcl-2	CTCTTCAGGGACGGGGTGAA	TACAGTTCCACAAAGGCATCCCAG
GAPDH	ACCCAGAAGACTGTGGATGG	TTCTAGACGGCAGGTCAGGT

2.11. Western blot Analysis

The treated breast cancer cells were properly washed in cold PBS (pH 7.42) and then harvested in the RIPA (radioimmunoprecipitation) lysis solution containing protease inhibitors. Following the SDS-PAGE and blotting, the PVDF membrane was blocked in %5 non-fat milk. After that, the membrane was incubated for 24h and 1h with primary and secondary antibodies, respectively. Both the primary (anti-Bax, anti-Bcl-2, and anti-GAPDH antibodies) and secondary antibodies were acquired from Santa Cruz Biotechnology. ECL kit (Abcam, USA) was used to visualize the protein band, and Image J software (National Institutes of Health, Bethesda, United States) was employed to determine the band density.

2.12. Chorioallantoic Membrane Assay (CAM Assay)

The CAM experiment was carried out to assess the angiogenic process in vivo. Chicken eggs (provided by Ahvaz University's Department of Poultry) were randomized and separated into four groups (Control, blank SLN, QC, and QC-SLN 130 µM, n = 3 per group) and incubated at 37 °C with 55–60% humidity. On the third day of incubation, a square window with 1- 2 cm size was cut on the top of the living eggs shells, and 1.5 ml of albumin was pulled from the opposite direction of the eggs, because the chorioallantoic membrane (CAM) maturation occurs on the 5th day, the drug-loaded sterile methylcellulose discs were placed on the CAMs then. After medication administration, the eggs were incubated for 48 hours at 37 °C and 55 to 60 percent humidity. After removing the filter discs, the CAM tissue was fixed in 4% formaldehyde, and finally, a stereomicroscope (Leica Zoom 2000) was used to capture photos at 150X magnification. The Wimasis Image Analysis Software, available online, was used to analyze the photos. Angiogenesis was evaluated according to the total of all vessel branch points and all vessel network lengths.

2.13. Statistical Analysis

Each test was conducted independently three times, and the findings were shown as mean ± standard deviation (SD). GraphPad Prism 8 (California, USA) was used to conduct statistical analyses. Using one-way ANOVA and LSD posthoc, the findings of the experimental groups were compared with each other, and P-values <0.05 were regarded as significant.

3.1. FTIR

As seen in Figure 1, Multiple distinct bands exist in the QC-SLN spectra, including O-H stretching (3850–3200 cm1), C-O stretching (1635 cm1), C-C stretching (1659 cm1), C-H bending (1463, 1379 cm1), C-O stretching inside the ring structure (1262 cm1), and C-O stretching the ring structure (1109 - 1056 cm1). The FTIR spectra confirm the interaction between QC and SLN.

3.2. Characterization of QC-SLNs

The negative zeta potential of nanoparticles was about -27.7 mV, which avoids aggregation and ensures maintained long-term stability. PDI indicates a uniform distribution of nanoparticles, and its amount for QC-SLN was 0.50 ± 0.04. Transmission electron microscope (TEM) images showed that the nanoparticles are spherical and smooth (Figure 2), and the average size of nanoparticles was 154±22.5 nm, which is comparable with acquired particle sizes by dynamic light scattering (DLS), which was 156 nm. The data showed that the size of most particles was less than 156 nm.

3.3. Drug Release Profile

As seen in Figure 3, the QC solution has distinct and different release characteristics from QC-SLN. In contrast to QC, drug release from QC-SLN was continued for 3 days. In the first 12 hours, QC-SLN released 65% of the QC, and over the next 72 hours, the release gradually increased to 90%, but in the QC solution releasing vigorously started at first and reached approximately 100% in 5h.

3.4. Cell Viability and Proliferation

Following the treatment of both cancerous cells (MCF-7 and MDA-MB-231) and a normal cell (MRC-5) with different concentrations of Blank-SLN (2.5-50 µM), QC (20-400 µM) and QC-SLN (2.5-50 µM) for 24 and 48h, MTT assay was done (Figure 4) and IC50 values were determined (Table 2). as illustrated in figure 4 QC and QC-SLN decrease the viability of cancer cells without any significant effect on normal cell viability in below 50 µM concentration. Blank-SLN did not affect cell viability in cancerous and normal cells. After 48 h treatment, IC50 values of QC-SLN (Figure 5) for MCF-7 and MDA-MB231 were 18.9 µM and 13.4 µM, respectively. To compare the cytotoxic effect of QC and QC-SLN same concentrations of Blank-SLN, QC, and QC-SLN (according to IC50 values of QC-SLN) were treated with MCF7 and MDA-MB 231.

Table 2. The IC₅₀ value (µM) of QC, QC–SLN, and blank-SLN on MCF-7, MDA-MB231, and MRC5 cells in 24 and 48 h incubation time.

Treatments

Cells

24 h

48 h

MRC5

MCF-7

MDA-MB231

234±12.3

112±4.7

183±12.4

201±8.9

93±3.1

153±11.7

QC- SLN

MRC5

MCF-7

MDA-MB231

ND^*

23.02±2.6

21.48±3.2

18.9 ± 1.9

13.4±1.5

Blank -SLN

MRC5

MCF-7

MDA-MB231

*ND: Not determined

3.5. Clonogenic Assay

Figure 6A shows photographs of MCF-7 and MDA-MB231 colony formation in untreated and treated conditions. Quantification of colony formation assays of both cell lines are depicted in figures 6B and C. for both cell lines, Blank-SLN had an insignificant effect on colony formation., and QC-SLN significantly decreased the colony number compared with the QC group.

3.6. Annexin V-FITC/Propidium Iodide Apoptosis Assay

As illustrated in Figure 7, Blank-SLN had no apoptotic effect on the cells. QC increased the apoptosis rate in MCF-7 by approximately 24% without any significant effect on MDA-MB231. QC-SLN significantly enhanced the apoptotic effect on MCF-7 and MDA-MB231 compared to QC by 45% and 67%, respectively.

3.7. Quantitative Real-Time RT-PCR

In MCF-7 cells, Blank-SLN had an insignificant influence on gene expression. In the QC group, increased gene expression of Bax was observed without any significant effect on Bcl-2 expression compared to the control group. In QC-SLN, a considerable reduction in the gene expression of Bcl-2 and an increase in Bax expression compared to the QC group were seen (figure 8A). In MDA-MB231 cells, however, any significant change in the gene expression in Blank-SLN and the QC group was not seen. However, under QC-SLN treatment significant decreases and increases in the Bcl-2 and Bax gene expression compared to the QC group were revealed, respectively (figure 8B).

3.8. Western Analysis

As illustrated in figure 9, in MCF-7 cells, blank-SLN had no insignificant influence on protein expression. In the QC group, a significant elevation in Bax protein expression was seen without significant change in Bcl-2. In the QC-SLN group, there was a noticeable increase in Bax and a decrease in Bcl-2 expression compared to the control and QC groups. In MDA-MB231 cells, any important change in the Blank-SLN and QC groups was not observed, although in the QC-SLN group, significant enhancement in Bax and reduction in Bcl-2 expression compared to the control and QC groups were seen.

3.9. CAM Assay Analysis

The anti-angiogenic potential of QC-SLN and QC was assessed using the CAM assay. In Figure 10A, the first row depicts the angiogenesis of the CAM assay in different groups, and the second row displays the interpretation of these data by the Wimasis program. Following treatments, the same pattern in both indices of angiogenesis, the total number of branch points and the total length of the vessel network, was seen (figure 10B and C). the patterns indicate that the QC and QC-SLN treatments resulted in a considerable reduction of these markers in comparison to the control. The proportions of this reduction were significantly higher in the QC-SLN treatment compared to the QC group.

In the present study, QC was effectively loaded into SLN using the emulsification method. The QC-SLN displayed remarkable stability along with a uniform size distribution. The in vitro release profile demonstrated that the QC-SLNs gradually released the QC throughout the treatment period. Hence, they are an ideal candidate for delayed drug release in cancer therapy, especially breast cancer therapy.

Current research results have shown that using QC-SLN successfully lowers the total number of MCF-7 and MDA-MB231 cells by preventing cell growth and triggering cell death. Previous research has shown that QC has an inhibitory effect on the viability of these cells [29–31]. According to the findings of this research, the IC₅₀ concentrations of QC after 48 h of treatment were 93 and 183 µM for MCF-7 and MDA-MB-231, respectively. Our IC50 result on MCF-7 is somewhat different from that published by Lin et al. (2013) and Firoozeh Niazvand et al. (2018), which may be because of differences in QC purity and quality [29, 32]. The IC₅₀ value of QC-SLNs on MCF-7 and MDA-MB 231 were 13.4 and 18.9 µM, respectively, which are much lower than IC₅₀ values of QC, indicating that QC-loaded nanoparticles had a higher cytotoxic impact on MCF-7 and MDA-MB231 cells without any significant effect on MRC5.

It has been shown in many studies that SLN is an effective transporter for anticancer medicines and flavonoids. Berberine, oridonin, and resveratrol were encapsulated in SLNs, and the findings revealed that in this way, their antitumor impact was greatly increased in breast cancer cell lines [17, 31, 33, 34]. According to Zhuang et al. (2012), breast cancer therapy with anticancer medications loaded by SLN, such as mitoxantrone and methotrexate, could be more successful than treatment with medicines alone [31]. On the other hand, Abbasalipourkabir et al. (2016) demonstrated that tamoxifen loaded by SLNs had the same influence on breast cancers in rats rather than free tamoxifen [35]. The most recent research, conducted in 2019 by Firoozeh Niazvand et al., demonstrated that loaded SLNs containing QC has a stronger impact on breast cancer than QC [32]. It is possible that the lipophilic quality of the carrier, which facilitates cellular absorption and hence the greater growth-inhibiting effect of QC-SLNs on the cancer cells, is the reason for this phenomenon. In the research carried out by Vijayakumar et al., QC-SLN improved the solubility of QC in distilled water, and SLN significantly boosted the amount of cell uptake of QC [26]. According to research published in 2014 by Sun et al., QC-loaded by lipid carriers significantly improved the solubility and stability of QC and increased the amount of QC present in MCF-7 cells. Based on their research findings, an elevation in cytotoxicity occurred concurrently with a boost in QC absorption by MCF-7 cells [20].

The finding of the clonogenic assay revealed that QC decreased the colony count of MCF-7 and MDA-MB231 by 35% and 25%, respectively, whereas these reductions for QC-SLN were 90% and 80% for MCF-7 and MDA-MB231, respectively. So, this finding confirms the increase in the effectiveness of QC-SLN over QC. Our findings align with those of prior research, which found that QC-SLN significantly reduced colony numbers compared to control and QC [32].

Apoptosis and cell viability are two methods that are often used to evaluate the effectiveness of anti-tumor drugs. In most cases, the anticancer drugs, through apoptosis, can destroy proliferating cells [36–38]. Our flow cytometry results showed that QC elevated the total apoptosis (early and late) in MCF-7 and MDA-MB231 cells compared with the control group. In contrast, this enhancement was significantly greater in QC-SLN than in QC. The results are consistent with Jain et al. (2014) and Firoozeh Niazvand et al. (2019), which showed that QC-SLN promotes DNA damage and apoptosis in cancer cells [32, 39]. On the other hand, in a prior investigation, QC showed the capacity to trigger both necrosis and apoptosis in SCC-9 oral cancer cells and breast cancer cells [32, 40].

The gene and protein expression of Bax and Bcl-2, two key regulatory proteins of the intrinsic apoptosis pathway [32], were assessed to confirm the apoptosis. In both breast cancer cell lines, QC increased Bax and decreased Bcl-2 at gene and protein levels, whereas these expression changes occurred more significantly in QC-SLN treatment than in QC. As a result, QC-SLNs can potentially promote the intrinsic apoptotic pathway in breast cancer cells and hence cause cell death. This part of the study's findings align with Lee et al. (2008), who discovered that QC played a role in the pathway that led to apoptosis in prostate cancer cells [41]. Our results are also consistent with Duo J et al.(2012), which showed that QC, through the modulation of the expression of Bax and Bcl-2, can stimulate apoptosis in MCF-7 cells and inhibit their proliferation [42].

CAM assay as an in vivo angiogenic assay test was carried out, and the number of total branch points and total vessel network lengths were employed as markers of angiogenesis to analyze the effects of QC and QC-SLN on angiogenesis. Treatment with QC compared to the control group showed a reduction in both angiogenic indices, although QC-SLN decreased the indices more greatly and significantly than QC. This result coincides with the findings of Sanaei et al. (2021) showed that QC decreased both indices, and this effect was confirmed with human umbilical vein endothelial cells (HUVECs) culture [43].

This research indicated that SLN successfully enhances the cytotoxic effect of QC by promoting the intrinsic apoptosis pathway in MCF-7 and MDA-MB231 cells. MDA-MB-231 cells are triple-negative breast cancers with invasive properties and resistance to chemotherapy. So QC-SLN with a significant enhancement in apoptosis and a reduction in cell viability can be considered a promising future therapy, but complementary in vivo experiments are required.

Acknowledgements: The research was financially supported by grant number CMRC - 9914 from the Cellular and molecular research center, medical basic sciences research institute Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran. This paper was extracted from PhD thesis of Mahdi Hatami.

Author contributions

Dr. Mojtaba Rashidi significantly contributed to the conceptualization and design of the work. Dr. Maryam Kouchak and Layasadat Khorsandi prepared and updated the material. Dr. Alireza Khairullah: data analysis and interpretation. Mahdi Hatami: the acquisition, interpretation, and analysis of data.

Funding: The research was financially supported by the Cellular and Molecular Research Center of Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran.

Conflicts of Interest: We have no conflict of interest to declare.

Availability of Data and Material: The data and materials used and/or analyzed during the current study are available from the corresponding author on request.

Ethical approval: IR.AJUMS.REC.1399.509.

Research involving human and/or animal participants: This article does not contain any studies with human participants or animals performed by any of the authors.

Informed consent All of the authors declare consent to participate and consent for the publication.

Tinoco G, Warsch S, Glück S, Avancha K and Montero AJJJoC (2013) Treating breast cancer in the 21st century: emerging biological therapies. 4:117. doi: http://dx.doi.org/10.7150/jca.4925
Gadhwal M, Patil S, D’Mello P, Joshi U, Sinha R and Govil GJIJoPS (2013) Synthesis, characterisation and antitumour activity of some quercetin analogues. 75:233.
Gibellini L, Pinti M, Nasi M, Montagna JP, De Biasi S, Roat E, Bertoncelli L, Cooper EL, Cossarizza AJE-bc and medicine a (2011) Quercetin and cancer chemoprevention. 2011. doi: https://doi.org/10.1093/ecam/neq053
Dar RA, Rasool M, Assad AJCiB and Medicine (2022) Breast cancer detection using deep learning: Datasets, methods, and challenges ahead.106073. doi: https://doi.org/10.1016/j.compbiomed.2022.106073
Lv W, Budke B, Pawlowski M, Connell PP and Kozikowski APJJomc (2016) Development of small molecules that specifically inhibit the D-loop activity of RAD51. 59:4511-4525. doi: https://doi.org/10.1021/acs.jmedchem.5b01762
Aiello F, Carullo G, Giordano F, Spina E, Nigro A, Garofalo A, Tassini S, Costantino G, Vincetti P and Bruno AJC (2017) Identification of Breast Cancer Inhibitors Specific for G Protein‐Coupled Estrogen Receptor (GPER)‐Expressing Cells. 12:1279-1285. doi: https://doi.org/10.1002/cmdc.201700145
Dandawate PR, Subramaniam D, Jensen RA and Anant S (2016) Targeting cancer stem cells and signaling pathways by phytochemicals: Novel approach for breast cancer therapy. Seminars in cancer biology, Elsevier, pp. 192-208. doi: https://doi.org/10.1016/j.semcancer.2016.09.001
Srivastava S, Somasagara RR, Hegde M, Nishana M, Tadi SK, Srivastava M, Choudhary B and Raghavan SCJSr (2016) Quercetin, a natural flavonoid interacts with DNA, arrests cell cycle and causes tumor regression by activating mitochondrial pathway of apoptosis. 6:1-13. doi: http://dx.doi.org/10.1038/srep24049
Tummala R, Lou W, Gao AC and Nadiminty NJMct (2017) Quercetin Targets hnRNPA1 to Overcome Enzalutamide Resistance in Prostate Cancer CellsQuercetin Targets hnRNPA1 and Synergizes with Enzalutamide. 16:2770-2779. doi: https://doi.org/10.1158/1535-7163.MCT-17-0030
Lamson DW and Brignall MSJAmrajoct (2000) Antioxidants and cancer, part 3: quercetin. 5:196-208.
Davis JM, Murphy EA and Carmichael MDJCsmr (2009) Effects of the dietary flavonoid quercetin upon performance and health. 8:206-213. doi: https://10.1249/JSR.0b013e3181ae8959
Dhumale SS, Waghela BN and Pathak CJIl (2015) Quercetin protects necrotic insult and promotes apoptosis by attenuating the expression of RAGE and its ligand HMGB1 in human breast adenocarcinoma cells. 67:361-373. doi: https://doi.org/10.1002/iub.1379
Rauf A, Imran M, Khan IA, ur‐Rehman M, Gilani SA, Mehmood Z and Mubarak MSJPR (2018) Anticancer potential of quercetin: A comprehensive review. 32:2109-2130. doi: https://doi.org/10.1002/ptr.6155
Abd-Rabou AA and Ahmed HHJAims (2017) CS-PEG decorated PLGA nano-prototype for delivery of bioactive compounds: A novel approach for induction of apoptosis in HepG2 cell line. 62:357-367. doi: https://doi.org/10.1016/j.advms.2017.01.003
Jain A, Garg NK, Jain A, Kesharwani P, Jain AK, Nirbhavane P, Tyagi RKJDD and Pharmacy I (2016) A synergistic approach of adapalene-loaded nanostructured lipid carriers, and vitamin C co-administration for treating acne. 42:897-905. doi: https://doi.org/10.3109/03639045.2015.1104343
Mombeini M, Saki G, Khorsandi L and Bavarsad NJM (2018) Effects of silymarin-loaded nanoparticles on HT-29 human colon cancer cells. 54:1. doi: https://doi.org/10.3390/medicina54010001
Wang W, Zhang L, Chen T, Guo W, Bao X, Wang D, Ren B, Wang H, Li Y and Wang YJM (2017) Anticancer effects of resveratrol-loaded solid lipid nanoparticles on human breast cancer cells. 22:1814. doi: https://doi.org/10.3390/molecules22111814
Balakrishnan S, Mukherjee S, Das S, Bhat FA, Raja Singh P, Patra CR, Arunakaran JJCb and function (2017) Gold nanoparticles–conjugated quercetin induces apoptosis via inhibition of EGFR/PI3K/Akt–mediated pathway in breast cancer cell lines (MCF‐7 and MDA‐MB‐231). 35:217-231. doi: https://doi.org/10.1002/cbf.3266
Govindaraju S, Rengaraj A, Arivazhagan R, Huh Y-S and Yun KJBc (2018) Curcumin-conjugated gold clusters for bioimaging and anticancer applications. 29:363-370. doi: https://doi.org/10.1021/acs.bioconjchem.7b00683
Abbasalipourkabir R, Salehzadeh A and Abdullah RJJoen (2016) Tamoxifen-loaded solid lipid nanoparticles-induced apoptosis in breast cancer cell lines. 11:161-174. doi: https://doi.org/10.1080/17458080.2015.1038660
Hwang JH, Kim SJ, Kim Y-H, Noh J-R, Gang G-T, Chung BH, Song NW and Lee C-HJT (2012) Susceptibility to gold nanoparticle-induced hepatotoxicity is enhanced in a mouse model of nonalcoholic steatohepatitis. 294:27-35. doi: https://doi.org/10.1016/j.tox.2012.01.013
Badawi NM, Teaima MH, El-Say KM, Attia DA, El-Nabarawi MA and Elmazar MMJIjon (2018) Pomegranate extract-loaded solid lipid nanoparticles: design, optimization, and in vitro cytotoxicity study. 13:1313.
Stella B, Peira E, Dianzani C, Gallarate M, Battaglia L, Gigliotti CL, Boggio E, Dianzani U and Dosio FJN (2018) Development and characterization of solid lipid nanoparticles loaded with a highly active doxorubicin derivative. 8:110. doi: https://doi.org/10.3390/nano8020110
Baek J-S, Na Y-G and Cho C-WJN (2018) Sustained cytotoxicity of wogonin on breast cancer cells by encapsulation in solid lipid nanoparticles. 8:159. doi: https://doi.org/10.3390/nano8030159
Wang W, Chen T, Xu H, Ren B, Cheng X, Qi R, Liu H, Wang Y, Yan L and Chen SJM (2018) Curcumin-loaded solid lipid nanoparticles enhanced anticancer efficiency in breast cancer. 23:1578. doi: https://doi.org/10.3390/molecules23071578
Vijayakumar A, Baskaran R, Jang YS, Oh SH and Yoo BKJAP (2017) Quercetin-loaded solid lipid nanoparticle dispersion with improved physicochemical properties and cellular uptake. 18:875-883. doi: http://dx.doi.org/10.1208/s12249-016-0573-4
Abbasalipurkabir R, Salehzadeh A and Abdullah RJPT (2011) Delivering tamoxifen within solid lipid nanoparticles. 35:74-79.
Nie S, Hsiao WL, Pan W and Yang Z (2011) Thermoreversible Pluronic F127-based hydrogel containing liposomes for the controlled delivery of paclitaxel: in vitro drug release, cell cytotoxicity, and uptake studies. Int J Nanomedicine 6:151-66. doi: 10.2147/ijn.S15057
Lin Y-C, Tsai P-H, Lin C-Y, Cheng C-H, Lin T-H, Lee KP, Huang K-Y, Chen S-H, Hwang J-J and Kandaswami CCJPo (2013) Impact of flavonoids on matrix metalloproteinase secretion and invadopodia formation in highly invasive A431-III cancer cells. 8:e71903. doi: https://doi.org/10.1371/journal.pone.0071903
Wu Q, Kroon PA, Shao H, Needs PW, Yang XJJoa and chemistry f (2018) Differential effects of quercetin and two of its derivatives, isorhamnetin and isorhamnetin-3-glucuronide, in inhibiting the proliferation of human breast-cancer MCF-7 cells. 66:7181-7189. doi: https://doi.org/10.1021/acs.jafc.8b02420
Li X, Zhou N, Wang J, Liu Z, Wang X, Zhang Q, Liu Q, Gao L and Wang RJLs (2018) Quercetin suppresses breast cancer stem cells (CD44+/CD24−) by inhibiting the PI3K/Akt/mTOR-signaling pathway. 196:56-62. doi: https://doi.org/10.1016/j.lfs.2018.01.014
Niazvand F, Orazizadeh M, Khorsandi L, Abbaspour M, Mansouri E and Khodadadi AJM (2019) Effects of quercetin-loaded nanoparticles on MCF-7 human breast cancer cells. 55:114. doi: https://doi.org/10.3390/medicina55040114
Wang L, Wang S, Chen R, Wang Y, Li H, Wang Y and Chen MJJoN (2014) Oridonin loaded solid lipid nanoparticles enhanced antitumor activity in MCF-7 cells. 2014. doi: https://doi.org/10.1155/2014/903646
Wang L, Li H, Wang S, Liu R, Wu Z, Wang C, Wang Y and Chen MJAP (2014) Enhancing the antitumor activity of berberine hydrochloride by solid lipid nanoparticle encapsulation. 15:834-844. doi: http://dx.doi.org/10.1208/s12249-014-0112-0
Zhuang Y-g, Xu B, Huang F, Wu J-j and Chen SJDP-AIJoPS (2012) Solid lipid nanoparticles of anticancer drugs against MCF-7 cell line and a murine breast cancer model. 67:925-929. doi: https://doi.org/10.1691/ph.2012.2033
Sun M, Nie S, Pan X, Zhang R, Fan Z, Wang SJC and Biointerfaces SB (2014) Quercetin-nanostructured lipid carriers: Characteristics and anti-breast cancer activities in vitro. 113:15-24. doi: https://doi.org/10.1016/j.colsurfb.2013.08.032
Fulda SJIjoc (2009) Tumor resistance to apoptosis. 124:511-515. doi: https://doi.org/10.1002/ijc.24064
Naumov GN, Akslen LA and Folkman JJCc (2006) Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. 5:1779-1787. doi: https://doi.org/10.4161/cc.5.16.3018
Jain AK, Thanki K, Jain SJNN, Biology and Medicine (2014) Novel self-nanoemulsifying formulation of quercetin: Implications of pro-oxidant activity on the anticancer efficacy. 10:e959-e969. doi: https://doi.org/10.1016/j.nano.2013.12.010
Haghiac M, Walle TJN and cancer (2005) Quercetin induces necrosis and apoptosis in SCC-9 oral cancer cells. 53:220-231. doi: https://doi.org/10.1207/s15327914nc5302_11
Lee D-H, Szczepanski M and Lee YJJBp (2008) Role of Bax in quercetin-induced apoptosis in human prostate cancer cells. 75:2345-2355. doi: https://doi.org/10.1016/j.bcp.2008.03.013
Duo J, Ying G-G, Wang G-W and Zhang LJMmr (2012) Quercetin inhibits human breast cancer cell proliferation and induces apoptosis via Bcl-2 and Bax regulation. 5:1453-1456. doi: https://doi.org/10.3892/mmr.2012.845
Mohammadzadeh G (2021) Quercetin Synergistically Potentiates the Anti-Angiogenic Effect of 5-Fluorouracil on HUVEC Cell Line. doi: https://orcid.org/0000-0002-6666-8084

Download PDF

Journal Publication

published 13 Oct, 2023

Read the published version in Molecular Biology Reports →

Reviewers agreed at journal
07 Mar, 2023
Editor assigned by journal
05 Mar, 2023
First submitted to journal
04 Mar, 2023

You are reading this latest preprint version

Quercetin-loaded Solid Lipid Nanoparticles Effectively Inhibit the Growth of Invasive Breast Cancer Cell Line MDA-MB 231

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Materials and methods

3. Results

Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Journal Publication

Version 1