Patient Samples and Grading:
The post-operative crude neoplastic tissue fractions were collected from Bangur Institute of Neurosciences, Institute of Post Graduate Medical Education and Research (IPGME&R), Kolkata, India as per institutional ethical clearance (vide Memo No. Inst/IEC/553 dated 15.01.2014) after the neuro-oncosurgery surgery and fixed in selective mediums as per methodological requirements. Relevant clinical details and data of Magnetic Resonance Imaging (MRI) done with 1.5 Tesla multi-sliced MR imager with whilst T1 & T2 weighted contrast enhanced parameters along with MR spectroscopy values on choline/creatine ratio, N-acetylaspertate (NAA) and lactate peaks had been collected. All glioma samples were primarily of adult, pediatric and recurring types from which only the adult non-recurring glioma tissues of six (n=6) low grade [i.e, astrocytoma grade II] and five (n=5) high grade [i.e, anaplastic astrocytoma or grade III and glioblastoma multiforme or GBM or grade IV] samples were included in the study. The pathological grading of post-operative tissues were done by collaborating histopathology department of IPGME&R according to WHO 2007 and 2016 protocol. All the parameters were performed for all samples unless otherwise mentioned in figure legends. Therefore, in low grade n=6 and in high grade n=5. All experiments had been done at least in duplicate.
Tissue Immunohistochemistry with Hematoxylin Counter-staining
Tissues fixed in 4% para-formaldehyde embedded in paraffin blocks were processed as 10 µm thick tissue ribbons and fixed in glass slides. De-paraffinized, gradually hydrated with descending alcohol grades, phosphate buffer Saline (PBS) washed and blocked by 3% Bovine Serum Albumin (BSA) solution (LOBA Chemie, India) for 30 minutes followed by overnight incubation of primary non-conjugated human reactive rabbit monoclonal anti-Ki67 (Santacruz Biotechnology, Dallas, TX, USA) overnight at 40C moist chamber. Slides washed in PBS were treated with Horse Raddish Peroxidase (HRP)-conjugated rabbit reactive mouse secondary antibody (Santacruz Biotechnology, Dallas, TX, USA), treated with 3,3-diaminobenzidine (DAB) (SRL, India) in buffered (1M TRIS, pH 7.4) hydrogen peroxide solution along with 0.5% copper sulfate solution in dark followed by counter-staining with Dellafield’s hematoxylin solution (Merck, India) and dehydrated in alcohol to reach in air dried condition. Similar protocol was administered in detecting total methylation pattern in tissue level among high and low grade of astrocytomas using human reactive rabbit monoclonal DNA Methyl Transferase 1 (DNMT1) with HRP conjugated mouse anti rabbit secondary antibody (both from Santacruz Biotechnology, Dallas, TX, USA). Both the primary antibodies were added at 1:200 dilution and secondary added 1:500 dilution in 1% BSA solution. These slides mounted with DPX, were visualized in bright field under Nikon Microscope (TS 100-F Eclipse, Nikon Corp., Japan), photographed with CCD Camera (DS-Fi2-U3) and analyzed with NIS Element-BR Software (Nikon Corp., Japan) for mitotic activity and epigenetic methylation attributes associated with these tumor types. In both the cases photographs were being evaluated as their expression profiling using ‘Fiji_ImageJ2 software’ (NIH, USA).
Tissue Immunohistochemistry with Fluorescence Microscopy
Tissue samples fixed in glass slides as mentioned earlier and after overnight hit fixation, all samples were stained separately with – (1) primary non-conjugated human reactive mouse monoclonal anti-matrix metalloproteinase 2 (MMP2) antibody (Novus Biologicals, Littleton, CO, USA) counteracted by Fluorescent isothiocyanate (FITC)-conjugated anti-mouse goat secondary antibody (Abcam, Cambridge, MA, USA) to detect expression of total tissue gelatinase A (MMP2), (2) primary non-conjugated human reactive mouse monoclonal anti-matrix metalloproteinase 9 (MMP9) antibody (Novus Biologicals, Littleton, CO, USA) counteracted by phycoerithrene (PE)-conjugated anti-mouse goat secondary antibody (Abcam, Cambridge, MA, USA) to detect expression of total tissue gelatinase B (MMP9) both for invasion and ECM destruction in order to metastasis, (3) primary non-conjugated human reactive mouse monoclonal anti-vascular endothelial growth factor (VEGF) antibody (Novus Biologicals, Littleton, CO, USA) counteracted by PE-conjugated anti-mouse goat secondary antibody (Abcam, Cambridge, MA, USA) to detect expression of neo-angiogenesis, (4) primary non-conjugated human reactive mouse monoclonal anti-ionized calcium-binding adapter molecule 1 (Iba1) antibody (Abcam, Cambridge, MA, USA) counteracted by FITC-conjugated anti-mouse goat secondary antibody (Abcam, Cambridge, MA, USA) to detect distributional pattern of brain macrophage/microglia, (5) primary PE-conjugated human reactive CD204 mouse monoclonal antibody (BioLegend, San Diego, CA, USA) for detection of M2 polarized brain macrophage or microglia. Subsequently, all of these are counterstained with DAPI (Himedia, India). In all cases 1:500 primary non conjugated and 1:1000 primary or secondary conjugated antibody dilution were used, incubated under dark humid chamber at 4ºC. 5% Fetal Bovine Serum (GIBCO, Life Technology, Grand Island, NY, USA) in 1X PBS with 0.25% Tween 20 (MERCK, India) solution had been used to block nonspecific bindings as well as to increase membrane permeability for cytosolic antibody binding. All the antibodies were diluted in 1% Fetal Bovine Serum FBS (GIBCO, Life Technology, Grand Island, NY, USA) in 1X PBS solution. After mounting in DPX, the slides were viewed through ‘Nikon TS 100-F Eclipse’ microscope with epi-fluorescence attachment ( (Nikon Corp., Japan) using Epi-FL filter block B-2A green channel (Nikon Corp., Japan) for Alexa Fluor® 488 / FITC, Epi-FL filter block G-2A red channel for PE (Nikon Corp., Japan) and UV filter for DAPI (Nikon Corp., Japan) . Photographs of fluorescence stained cells were captured with CCD camera DS-Fi2-U3 (Nikon Corp., Japan), processed, analyzed and documented with ‘NIS Element BR’ software, version 4.20 (Nikon Corp., Japan).
Glioma Tissue Cell Suspension and Culture
Freshly ablated post-operative human astrocytoma samples were collected in serum free culture medium maintaining aseptic condition and temperature of around 4ºC. Samples were readily minced treated with 0.25% Trypsin-EDTA solution (Sigma Aldrich, USA) and collagenase (HiMedia, India) with continuous agitation. Serum supplemented culture media added to stop the enzymatic process, passed through 70 µm nylon filter mesh (HiMedia, India) and filtrates were centrifuged at 1800 rpm for 3 minutes, pellets washed and dissolved in media and plated for culture in 1X Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 15% FBS (MP Biomedicals, Santa Ana, CA, USA), 2% antibiotic-antimycotic solution (HiMedia, India) with use of B-27 cell supplement (GIBCO Life Technologies, USA) with 1.5x106 seeding density in 60 mm cell culture dish (Greiner, Cellstar, Germany) and maintained under 37ºC-5% CO2 humidified incubator (New Burnswick, Eppendorf, UK). For sets of experiments, 2-3 days of cultured cells were taken, visualized under bright field microscope and prepared subsequently.
Immunocytochemistry (ICC) of Low and High Grade Astrocytoma Primary Culture
After 48 hrs of culture the cells were washed and fixed in 4% paraformaldehyde and added with 5% FBS in PBS with 0.5% Tween-20 (SRL, India) for blocking and permeabilization. After washing, they are treated individually with: (1) mAb Ki67-FITC conjugated antibody for total cell proliferation (2) MMP2 mAb (10)-PE (20) (3) MMP9 mAb (10)-FITC (20) for total gelatinase (4) VEGF (10)-PE (20) for neo-angiogenic endothelial expression as detailed in earlier methodologies. All the antibodies added with a dilution of 1:500 for primary and 1:700 for secondary and incubated for 1 hr each at ambient temperature in dark, counterstained with DAPI and observed under ‘Nikon TS 100-F Eclipse’ microscope with epi-fluorescence attachment (Nikon Corp., Japan) and captured with CCD camera DS-Fi2-U3 (Nikon Corp., Japan), processed, analyzed and documented with ‘NIS Element BR’ software, version 4.20 (Nikon Corp., Japan).
Cellular Invasion by Transwell Matrigel Assay in Boyden Chamber
Isolated cells from post-operative tumor tissue were plated at about 0.1 x 106 seeding density in serum free 1X DMEM over upper Boyden transwell chamber overlaid with tissue matrigel (Corning, USA) quarterly diluted with serum free DMEM [Ritch et al, 2019]. The lower chamber filled with 1X DMEM+20% FBS+2% antibiotic solution and the preparations were kept at 37ºC-5% CO2 humified environment for 48 hours. Then the media from lower parts were taken, centrifuged and fixed with 4% paraformaldehyde for immunophenotyping vide flow cytometry (discussed later). Upper chamber withdrawn, fixed similarly, washed and treated with 100% methanol (SRL, India) and stained with 10% giemsa and observed under bright field microscope and documented as mentioned earlier to estimate and compare the invaded cells among low and high grades of astrocytoma.
Cellular Immunophenotyping with Flow-cytometry (FC)
After 48 hours of culture cells were removed by accutase cell detachment solution (Sigma Aldrich, USA) followed by PBS wash and fixation by 4% paraformaldehyde for 15 minutes, washed, pellets were treated with permealizing blocking buffer (5% FBS in PBS+0.5% Tween 20), kept for 45 minutes, washed thoroughly and incubated with: (1) Ki67-FITC conjugated antibody for total cell proliferation (2) MMP2 (10)-PE(20) (3) MMP9 (10)-FITC(20) for total gelatinase (4) VEGF(10)-PE(20) for angiogenic endothelial expression (specification of mAb and conjugates were same as mentioned earlier). After respective incubation of 1 hour each at ambient temperature in dark, pellets were washed, suspended in PBS and fluorescent reading were taken in BD FACS Verse (BD Biosciences, USA) and analyzed with ‘FACS Verse Suit 1.0’ (BD Biosciences, USA) with calculation of median fluorescence intensity (MFI) for quantification. Same experimental protocols were followed for invading cells recovered from transwell matrigel assay in Boyden chamber for identical parameters to compare with tumor whole tissue parameters.
Isolation of RNA from Tumor Tissue followed by cDNA Conversion
Total RNA were isolated using ‘AllPrep Isolation Kit’ (Qiagen, India) abiding by manufacturer’s protocol from 15 mg frozen tumor tissue of both high and low grade kept in ‘RNA later solution’ (Thermo Fischer, USA). Isolated RNA quantified in ‘Nanodrop’ (IMPLEN, Germany) at at 260/280 optical density (OD260/280) where OD value ≥ 2 were taken. From this quantified RNA samples 50 ng RNA underwent cDNA conversion using ‘cDNA conversion kit’ (Biobharti Lifesciences, India) following manufacturer’s protocol. cDNA were stored at – 20ºC for future use.
Evaluation of mRNA expression by Semi-quantitative Reverse Transcriptase PCR (RT-PCR)
Number of target gene parameters was evaluated by RT-PCR. Respective primers underwent PCR with previously isolated cDNA. Product size of the primers were calculated from ‘NCBI PCR PRIMER BLAST’ and their optimum annealing temperature were determined by array of gradient PCR runs. As per the cDNA primer sequences, CTCATCGCAGATGCCTGGAA (FP) and TTCAGGTAATAGGCACCCTTGAAGA (RP) for MMP2, ACGCACGACGTCTTCCAGTA (FP) and CCACCTGGTTCAACTCACTCC (RP) for MMP9, TGCAGATTATGCGGATCAAACC (FP) and TGCATTCACATTTGTTGTGCTGTAG (RP) for VEGF, TCCTTTGGTGGGCACCTAAGACCTG (FP) and TGATGGTTGAGGTCGTTCCTTGATG (RP) for Ki67, CCCCTGAGCCCTACCGAAT (FP) and CTCGCTGGAGTGGACTTGTG (RP) for DNMT1, GATGATGCTGGGCAAGAGAT (FP) and CCTTCAAATCAGGGCAACTC (RP) for Iba1, CTCCCCTTTTCCCCTTTCTG (FP) and ATCGAGGTCCCACTGGAGAAAGT (RP) for CD204, TCATGAAGTGTGACGTTGACATCCGT (FP) and CCTAGAAGCATTTGCGGTGCACGATG (RP) for β-actin as housekeeping & CAACGGATTTGGTCGTATTGG (FP) and GCAACAATATCCACTTTACCAGAGTTAA (RP) for GAPDH as housekeeping had been used (GAPDH used for qRT-PCR only; for all semi-quantitative PCR, β-actin used as internal control). PCR amplification was done using ‘PCR Green Master Mix’ (Promega, USA) in ‘Surecycler 8800’ PCR machine (Agilent Technologies, USA). β-actin was taken as internal control. The amplified products were run in 10% PAGE, stained in ethidium bromide (EtBr) solution (HiMedia), and photographed in gel imager (Life technologies, USA). Further the different band intensities were quantified using ‘Fiji_ImageJ2’ software (NIH, USA), graphically plotted and interpolated.
Quantification of mRNA Expression Level by Quantitative Real Time PCR (qRT-PCR)
Number of target gene parameters were evaluated by RT-PCR. Respective primers underwent PCR with already isolated cDNA. Product size of the primers were calculated from ‘NCBI PCR PRIMER BLAST’ and their optimum annealing temperature were determined by array of gradient PCR runs as mentioned earlier. ‘SYBR Green I master mix’ (Agilent Technologies, USA) was used as primary source of fluorescent along with ‘ROX’ (Agilent Technologies, USA) as null reference dye diluted in DEPC water (1:100) in ‘AriaMX Real Time PCR cycler’ (Agilent Technologies, USA) with requisite forward and reverse primers, DEPC water and cDNA. GAPDH used as internal housekeeping control. The amplification and melt curve were obtained along with Cq values by analyzing with ‘AriaMX Software v1.0’ (Agilent Technologies, USA). This Cq values had been plotted graphically. The lesser the Cq value, greater will be the expression level.
Statistical Analysis
Both parametric and nonparametric interpolation has been done comparing mean or median values with standard deviation (SD) using the ‘GraphPad InStat’ (GraphPad Software, San Digeo, USA) taking significant one-tail or two-tail p value within 0.05.