TLR1-N248S polymorphism Reduces the Therapeutic Efficacy of Chemotherapy by Attenuating Antitumor Immunity in Locally Advanced Colorectal Cancer

doi:10.21203/rs.3.rs-2660036/v1

Download PDF

Research Article

TLR1-N248S polymorphism Reduces the Therapeutic Efficacy of Chemotherapy by Attenuating Antitumor Immunity in Locally Advanced Colorectal Cancer

https://doi.org/10.21203/rs.3.rs-2660036/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Regional lymph nodes metastasis is an important predictor for survival outcome and the indicator for postoperative adjuvant chemotherapy in patients with colorectal cancer (CRC) patient. Even the advance in the adjuvant chemotherapeutic regimen, the 5-year distant metastasis and survival are still unsatisfied. Here, we evaluate the clinical significance of single-nucleotide polymorphisms on TLR1 and TLR2, which are the receptors for HMGB1 that is the hallmark for immunogenic cell death (ICD), in patients with stage II-III colon carcinoma (COAD). We found patients with high cytosolic HMGB1 are associated with survival outcome in stage III COAD patients who received adjuvant chemotherapy. Moreover, patients with TLR1-N248S polymorphism (rs4833095) may influence the therapeutic efficacy of adjuvant chemotherapy, suggesting TLR1-N248S is an independent prognostic factor for locally advanced colon carcinoma patients. Moreover, patient bearing TLR1-N248S polymorphism had high risk of distant metastasis after first-line adjuvant chemotherapeutic regimen with 5 year by multivariate COX analysis [HR=1.694, 95%CI=1.063-2.698, p=0.027]. We found that defective TLR1 impaired TLR1/2 signaling on dendritic cells (DCs) maturation for antitumor immune response under immunogenic chemotherapy oxaliplatin (OXP) treatment. Defective TLR1 on DCs impaired its maturation ability by HMGB1 and reduced the secretion of IFN from T cells to eradicate the residual tumor cells in vitro. Moreover, systemic inhibition of TLR1/2 dramatically reduced the tumor-infiltrating immune cells by OXP treatment, leading to poor therapeutic response to OXP. On the contrary, administration with TLR1/2 agonist synergistically increased the benefit of OXP treatment and triggered high density of tumor-infiltrating immune cells. We also observed that less tumor-infiltrating cytotoxic T lymphocyte was located within tumor microenvironment in patients bearing TLR1-N248S polymorphism. Taken together, these results showed that patients bearing TLR1-N248S polymorphism might reduce the therapeutic response to adjuvant chemotherapy by attenuating antitumor immune response via impairing HMGB1-mediated DC maturation in locally advanced colon carcinoma patients.

TLR1

HMGB1

Immunogenic cell death

Colorectal cancer

Lymph nodes metastasis is an important predictor for survival outcome and the indicator for postoperative adjuvant chemotherapy in patients with colorectal cancer (CRC) patient [1-3]. Despite the advance in therapeutic approaches such as combinational chemotherapy regimen, targeted therapy and radiotherapy, metastatic disease remains the leading factor for mortality in CRC. Attractively, not all patients benefit from the standard chemotherapy regimen. Therefore, stratifying patients with predictive and prognostic biomarkers are critical to find out patients with the most benefit from the chemotherapy such as immune-related genes [4].

Toll-like receptors (TLRs) play a crucial role in the intestinal mucosal innate and acquired immunity to maintain gut homeostasis [5]. But TLRs not only recognize exogenous pathogen-associated molecular patterns (PAMP) but sensitize the endogenous damage-associated molecular patterns (DAMP) which are released from injured or dying cells [6]. These DAMPs shape adaptive anticancer immunity through the activation of antigen-presenting cells (APCs) for tumor antigen processing and cross-presenting to CD8⁺ T cells. Therefore, several groups established prognostic biomarkers based on immunogenic cell death (ICD)-associated DAMPs signatures for estimating prognosis as well as the immunotherapy in several malignancies such as triple-negative breast cancer (TNBC) and head and neck squamous cell carcinoma (HNSCC) [7, 8].

Several immunogenic chemotherapeutic drugs such as oxaliplatin (OXP) and doxorubicin (DOX) promotes immunogenic cell deaths (ICDs) to release DAMPs including high-mobility group box 1 (HMGB1), heat shock protein 70 (Hsp70), ATP, annexin A1 (ANXA1), and calreticulin (CRT) [9, 10]. HMGB1 can activate TLR2 and TLR4 on dendritic cells (DCs) to initiate antigen presentation and cytokine secretion to activate antigen‐specific CD4⁺ T cells and CD8⁺ T cells to recognize and eradicate tumor cells. Moreover, TLR2 agonist has significantly inhibited the cancer growth via stimulation of CD8⁺ T cells and natural killer (NK) cells [11, 12]. TLR2 interacts with TLR1 or TLR6 as a functional heterodimer to activate downstream signaling. The expression of TLR1 and TLR2 serve as the prognostic factors in breast cancer and pancreatic ductal adenocarcinoma (PDAC) [13, 14]. Moreover, several single nucleotide polymorphisms (SNPs) in the TLR1 gene, P315L, N248S, and I602I, which impaired the response to several bacterial agonists for this receptor and affected the T helper 1 cytokine production [15, 16]. Moreover, recent studies showed activation of TLR1/2 signaling enhances antitumor efficacy of CTLA-4 blockade, suggesting that TLR1/2 signaling not only participates in innate immunity for bacterial infection but adaptive immunity to eradicate tumor cells. Therefore, several TLR modulators have been linked to anti-cancer therapies in pre-clinical study and clinical trials [17, 18], including TLR2 agonist SMU-Z1 and polysaccharide krestin (PSK)[11, 19], TLR3 agonist AMP‐516 [20], TLR5 agonist entolimod (CBLB502)[21], TLR7 agonist imiquimod [22] and TLR9 agonists CpG‐7909 [23].

In this study, we herein focused on the genetic variation of TLR1 and TLR2 on the differences of clinical outcome in colon carcinoma (COAD) patients treated with postoperative adjuvant chemotherapy, especially regional lymph node metastatic COAD patients. We found patients carrying TLR1-N248 polymorphism were associated with poor distant metastasis-free survival (DMFS) and disease-free survival (DFS) in stage III COAD patients. Defective TLR1 significantly reduced the dendritic cells (DCs) maturation by HMGB1-mediated TLR2 signaling that was triggered by immunogenic chemotherapy. Moreover, blockade of TLR1/2 signaling remarkably attenuated the therapeutic efficacy of immunogenic chemotherapeutic agent oxaliplatin (OXP) with less infiltration of DCs, CD4 and CD8 within tumor microenvironment. But administration with TLR1/2 agonist significantly increased the therapeutic efficacy of OXP by boosting antitumor immune response. Taken together, these results showed that patients with TLR1-N248S polymorphism reduced the extent of antitumor immunity eliciting by immunogenic chemotherapy, leading to poor response to OXP and worse survival outcome in locally advanced CRC patients.

Patient characteristics

From 2006 to 2014, 869 stage II-III colon carcinoma patients who histologically and clinically diagnosed were treated with surgery, followed with postoperative adjuvant chemotherapy (high-risk stage II and stage III patients), and were followed-up once every 6 months postoperatively for 5 year at China Medical University Hospital (CMUH). Adjuvant chemotherapy regimens were administered as previously described [5, 14]. This study was reviewed and approved by the Institutional Review Board (IRB) of CMUH [Protocol number: CMUH105-REC2-073].

Genomic DNA extraction and SNP genotyping

Genomic DNA from non-tumor tissues of rectal cancer patients was extracted from two 5 μm thick FFPE slides using a QIAamp® DNA FFPE Extraction Kit (QIAGEN GmbH, Hilden, Germany). For SNP genotyping, 10 ng of total genomic DNA was used for PCR amplifcation and was performed using the iPLEX® HS panel on the MassARRAY ® System (Agena Bioscience, San Diego, CA, USA), which employs matrix-assisted laser desorption/ionization time-offight mass spectrometry for amplicon detection (MALDITOF-MS; SpectroACQUIRE, Agena Bioscience). Primers designed (Supplementary Table 1) for PCR amplifcation of specifc polymorphisms and extension reactions were prepared using MassARRAY® Assay Design Version 3.1 software (Agena Bioscience, San Diego, CA, USA). Following PCR, SAP addition, and the iPLEX HS® extension reaction, the samples were desalted by resin treatment for 15 min, spotted onto SpectroCHIP® Arrays (Agena Bioscience, San Diego, CA), analyzed by mass spectrometry, and ultimately interpreted using SpectroTYPER v4.0 software (Agena Bioscience, San Diego, CA). The characteristics of the selected polymorphisms are shown in Table 1.

Cell line

Three human colorectal cancer cell line HT29-GFP, monocytic leukemia cell line THP-1 and human T cell leukemia Jurkat cell were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (Hyclone, MA, USA) at 37°C with a humidified atmosphere of 5% CO₂ and 95% air.

Western blot analysis

Total cell lysates (20-40 μg) were separated via 6–12% SDS-PAGE and transferred onto a PVDF membrane (Millipore, MA, USA) [24]. The membranes were blocked with BlockPRO™ Blocking buffer (BioLion biotech, Taipei, Taiwan), probed with specific antibodies overnight at 4°C, and then incubated with HRP-conjugated secondary antibodies for 1 hr. After antibodies incubation, the membranes were incubated with Immobilon Western Chemiluminescent HRP Substrate (Millipore), and analyzed by ImageQuant™ LAS 4000 biomolecular imager (GE Healthcare, Amersham, UK). The digital data were processed using Adobe Photoshop and quantified using Image J software (NIH, MD, USA). Each blot was stripped by Immunoblotting Stripping Buffer (BioLion Tech.) before re-probing with the other antibodies. The antibodies used in western blot analysis were listed: anti-p-IKKa/b (AP0546, Abclonal), anti-p-JNK (AP0631, Abclonal) and anti-TLR1 (A0997, Abclonal)[25, 26].

THP1-derived immature DC and colorectal cancer cell line co-culture

Human monocytic leukemia cell line THP-1 cells were cultured and maintained in RPMI1640 medium supplemented with 10% FCS (Life Technologies, Grand Island, New York, USA), 2 mM glutamine, 1 mM sodium pyruvate, 100 U/ml penicillin, and 100 mg/ml streptomycin at 37 ˚C in a humidified incubator with 95% air and 5% CO₂. After gene was silenced by lentivirus carrying shRNA against indicated genes, immature DC were generated from THP-1 as previously described [27]. Briefly, THP-1 cells were differentiated to immature DC by adding with 1500 IU/ml rhIL-4 (Sino Biological, Beijing, China) and 1500 IU/ml rhGM-CSF (Sino Biological, Beijing, China) in culture medium for at least 7 days, with cytokine-supplemented culture medium changed every 2-3 days at 37 ˚C in a humidified incubator with 95% air and 5% CO₂. These THP1-iDC cells were treated with recombinant human HMGB1 (Sino Biological, Beijing, China) for 24 hr. The DC maturation was measured by flow cytometry. These THP1-iDC cells were also co-cultured with OXP-treated HT29-GFP cells to analyze the DC maturation marker CD86 by flow cytometry. Besides, human T cell leukemia Jurkat cell line was co-incubated with OXP-treated HT29-GFP/THP1-iDC for 15 hr to analyze the level of IFNg .

Animal model

BALB/c mice (female, 5 weeks old) were maintained according to the institutional guidelines approved by the Institutional Animal Care and Use Committee of China Medical University. CT26 (2x10⁵ cells/mouse) were suspended in 100 mL 20% Matrigel, and subcutaneously inoculated into right flank of each mouse. After 10 days, mice were administrated with oxaliplatin (OXP, 6 mg/kg/mouse, intraperitoneal injection) for 4 times with 3-day interval on day 13, 16, 19, 22 and 25. TLR1/2 antagonist CU-CPT22 (2.5mg/kg, HY-108471, MCE) and TLR1/2 agonist Pam₃CSK₄(2.5mg/kg, HY-P1180, MCE). The tumor volume was measured with 3-day interval in the study, and tumor volumes were calculated according to the formula (width² × length)/2. The mice were sacrificed at the end of the experiments, and the tumor tissues were collected for further analysis including immunoblotting analysis and immunohistochemistry [28, 29].

Tumor processing to isolate tumor-infiltrating lymphocytes (TILs) and lymph node for flow cytometry.

For analysis of tumor-infiltrating immune cells, mice from each treatment group were sacrificed on day 28, and their tumors and tumor-draining lymph nodes were isolated. Isolated tumors and lymph nodes were weighed, mechanically dissected into small pieces (1–2 mm) by beaver blade, then filtered through 70-μm nylon cell strainer, and then resuspended in blank RPMI media. Thereafter, the cell suspensions were layered over Ficoll-Paque media, centrifuged at 1,025 g for 20 min, transfer the layer of mononuclear cells into a conical tube and added 20 ml with complete RPMI media, and then gently mix and centrifuge at 650 g for 10 min for twice. Finally, removed the supernatant and resuspended the TILs with complete RPMI media.

For Treg staining, these cells were fixed and permeablized with FoxP3 Fix/Perm buffer kit from Biolegend according to the manufacturer’s instructions and then stained with intracellular antibodies for further analysis by flow cytometry. For quantification, the absolute numbers of different cell types per gram of tumor were measured by flow-cytometric analysis. For surface marker staining, TILs were resuspended in 500-μL staining buffer (2% BSA, 0.1% NaN3 in PBS). The cells were stained with different surface marker panels: (1) T cells phenotype: CD3-FITC (100204, Biolegend, CA, USA), CD4-APC/Fire^TM750 (116020, Biolegend, CA, USA), CD8a-PerCPCy5.5 (100734, Biolegend, CA, USA), CD44-PE (103008, Biolegend, CA, USA), CD45-PECy7 (103114, Biolegend, CA, USA), CD62L-APC (104412, Biolegend, CA, USA) and their isotype; (2) Regulatory T lymphocyte (Treg): FoxP3-Alexa488 (126406, Biolegend, CA, USA), CD25-PE (101904, Biolegend, CA, USA), CD3-PerCPCy5.5 (100218, Biolegend, CA, USA), CD45-PECy7 (103114, Biolegend, CA, USA), CD127-Alexa647 (135020, Biolegend, CA, USA), CD4-APC/Fire^TM750 (116020, Biolegend, CA, USA), and their isotype; (3) IFNg⁺CD8⁺ T cells: CD3-FITC (100204, Biolegend, CA, USA), IFNg-PE (505808, Biolegend, CA, USA), CD45-PECy7 (103114, Biolegend, CA, USA), CD8-APC/Fire^TM750 (100766, Biolegend, CA, USA) and their isotype. Data were acquired on Guava easyCyte flow cytometer and analyzed by FlowJo Software [30, 31].

Statistical analysis

The statistical analysis was analyzed by SPSS (IBM SPSS Statistics 22, WA, USA) and GraphPad Prism 7 (GraphPad Software, San Diego, CA, USA) were utilized. A two-sided p<0.05 as a significance level for all tests such as Student’s t-test, Pearson chi-square test and Fisher’s exact test. The univariate and multivariate analysis was performed by Cox regression analysis to estimate the hazard ratios (HRs) and 95% confidence intervals (CIs). These influential factors were adjusted in the Cox models— including gender (male versus female), age (≥65 versus<65), pT stage (pT 3-4 versus pT 1-2), tumor location (proximal versus distal), tumor differentiation (poor versus well to moderate), LVI (present versus absent), PNI (present versus absent) and TLR1-N248 (Variant versus WT) and TLR2 promoter (Variant versus WT). The Kaplan-Meier analysis was used to assess the distant metastasis-free survival (DMFS) and disease-free survival (DFS) with the survival time between surgery to event such as tumor relapse and death.

Clinical characteristics and genotype of PRRs in stage II-III patients

Our previous studies have demonstrated the density and cytosolic pattern of high mobility group protein B1 (cyto-HMGB1) in post-treatment surgical tissues was an independent prognostic factor in locally advanced rectal cancer patients who received pre-operative concurrent chemoradiotherapy regimen, suggesting that chemoradiotherapy elicited released HMGB1 to promote immunogenic cell death (ICD) and antitumor immunity for favorable outcome [32]. Therefore, we evaluated whether cyto-HMGB1 was associated with the survival outcome in locally advanced colon adenocarcinoma (COAD) who received adjuvant chemotherapy. As shown in Figure 1A and 1B, stage III COAD patients with cytosolic distribution of HMGB1 (Cyto-HMGB1) was associated with poor distant metastasis-free survival (DMFS) and disease-free survival (DFS), suggesting that tumor environment-induced inflammation for cytosolic release of HMGB1 before chemotherapy may promote autophagy and tumor progression [33-36]. Moreover, we found that patients with low Cyto-HMGB1 had negative correlated with higher nuclear HMGB1 expression and associated with favorable survival outcome, which was consistent with previous studies [33]. Previous studies indicated cytosolic HMGB1 was conversely correlated with infiltration of immune cells before chemotherapy treatment [37], suggesting that environment-driven inflammation for cytosolic pattern of HMGB1 might inhibit antitumor immunity with other mechanisms [34, 36]. But chemotherapy-induced immunogenic cell death (ICD) signature may be associated with antitumor immunity to influence the risk of distant metastasis and the therapeutic efficacy of chemotherapy such as HMGB1[8].

We then designed several primers to identify whether immune-related candidate genetic defects in TLR1/2 signaling, which was the receptor for HMGB1, were associated with the distant metastasis and tumor relapse. These genetic polymorphisms of PRRs, namely, TLR1 (N248S/rs4833095), TLR1 (S602I/rs5743618), TLR2 (N729S/ rs61735278) and TLR2 promoter (-196 to -174 deletion/ rs111200466), are nonsynonymous single nucleotide polymorphisms (SNPs). DNA was extracted and genotyped from surgical adjacent normal tissues of stage II-III colon cancer patients (n=869). The individual genotypes and allele frequencies were shown and consistent with the global allele frequencies in Table 2, which was classified based on the NCBI dbSNP. The genotype GG of TLR1 (N248S/rs4833095) and promoter deletion of TLR2 (-196 to -174 deletion/rs111200466) were prevalent among COAD patients. Table 2 presents the clinicopathological characteristics and genotype group of TLR1 and TLR2 within the COAD patients (n = 869). The mean age at diagnosis was 65.14±13.65 years (range, 13–92 years). The majority of the patients were men (53.9%). After surgery, 60 patients (6.9%) were exhibited local recurrence and 147 patients (16.9%) exhibited distant metastasis within 10 years.

Association of SNPs with clinical outcome in stage II and stage III COAD patients

Because the prevalence of TLR1 (S602I/rs5743618) and TLR2 (N729S/ rs61735278) is less, we only evaluated the relation of TLR1-N248S and TLR2 promoter (-196 to -174 deletion) to DMFS and DFS. As shown in Table 3, older age (59% vs 80%, p<0.001) and presence of lymphovascular invasion (LVI, 61% vs 71%, p=0.01) exhibited a significantly higher risk in DMFS and DFS, and presence of perineural invasion (PNI, 59% vs 70%, p=0.033) was significantly associated poor 5-year DFS in stage II COAD patients by Kaplan–Meier survival analysis. The presence of TLR1-N248S and TLR2 promoter (-196 to -174 deletion) was not associated with DMFS and DFS in stage II COAD patients. However, the variants of TLR1-N248 (AG/GG genotype) had a notably higher risk in DMFS (52% vs 68%, p=0.019) and DFS (51% vs 66%, p=0.026) in stage III COAD, suggesting that TLR1-N248S polymorphism may be associate with the regional lymph node metastasis.

In the univariate analysis of DMFS in locally advanced stage III COAD patients, the following parameters were associated with patient survival rate: age, pT stage, LVI and PNI. Moreover, patients with TLR1-N248 polymorphism had an increased risk for a lower DMFS (HR = 1.725, 95% CI = 1.084-2.745, p=0.021, Fig. 1C) compared with patients carrying a wild-type TLR1 (Table 4). These results indicate that TLR1-N248 polymorphism have significant prognostic value for locally advanced stage III COAD patients. Subsequently, we examined whether the inclusion of other variables significantly associated with the survival of locally advanced COAD. Our results showed that age, pT stage and LVI were independent prognostic factors of DMFS. TLR1-N248 polymorphism (HR=1.694, 95% CI=1.063–2.698, p=0.027) was an independent prognostic factor of DMFS for locally advanced COAD patients (Table 4). These data strongly indicated that the TLR1-N248 polymorphism has significant prognostic value for COAD patients with regional lymph node metastasis. Patients with TLR1-N248 polymorphism has poor survival outcome in COAD patients with low cyto-HMGB1 (Fig. 1D), suggesting that loss-of-function in TLR1 may impair immunogenic effect of HMGB1 for antitumor immunity that elicited by immunogenic chemotherapeutic agents such as oxaliplatin.

Defective TLR1 signaling attenuated OXP-elicited TLR2 activation

The convention chemotherapeutic agents for colorectal cancer are oxaliplatin (OXP), 5-Fu and CPT-11 [9, 38]. OXP can trigger immunogenic cell death (ICD) through the release of high mobility group box 1 (HMGB1) to promote DC maturation via TLR2 or TLR4, and induce antitumor immunity [32, 39]. TLR1 forms a heterodimer with TLR2, were suggested to be essential in regulating mucosal immune response within the gut [40] and the polymorphism of TLR1 is associated with the response to FOLFIRI plus bevacizumab in metastatic CRC [41]. Therefore, we assumed that TLR1-N248S polymorphism may attenuate the HMGB1-activated TLR2 signaling for DC maturation by immunogenic chemotherapeutic agent OXP to influence the therapeutic efficacy. We generated TLR1-silencing THP1 cells (Fig. 2A) and differentiated into immature DC cells (THP1-iDC) by cytokines. These THP1-iDC cells were treated with the HMGB1 to analyze the influence on TLR2 signaling (Fig. 2B). We found that silencing of TLR1 led to the impact on the activation of TLR2 signaling, including ERK and NK-kB (Fig. 2B). Treatment with HMGB1 significantly activated TLR2 signaling in THP1^shNC-iDC cells. But the extent of TLR2 activation was remarkably decreased in THP1^shTLR1-iDC cells. Furthermore, the mRNA expression of DC maturation marker CD86 and CD80 was significantly decreased (Fig. 2C). In addition to the mRNA level, we found the surface DC maturation marker CD86 was also significantly decreased, suggesting that defective TLR1 directly impacts the TLR1/2 signaling for DC maturation (Fig. 2D and 2E).

To demonstrate the defective TLR1 impairs TLR1/2 signaling for DC maturation by immunogenic chemotherapy, we treated HT29 cells with OXP for 24 h and analyze the level of released HMGB1 (Fig. 2F). We found released HMGB1 was clearly detected in conditioned medium post-24 h after 25-50 mM OXP treatment (Fig. 2F). Therefore, we cocultured with OXP-treated HT29 cancer cells with THP1^shNC-iDC and THP1^shTLR1-iDC cells for 24 hr, respectively (Fig. 2G). We found that DC maturation marker CD86 was significantly decreased in THP1^shTLR1-iDC cells after coculture with OXP-treated HT29 cells, compared to THP1^shNC-iDC cells (Fig. 2H). Then, we cocultured with Jurkat T lymphocytes to evaluate the level of cytotoxic marker IFNg (Fig. 2G and 2I). As showed in Fig. 2I, we found that the level of IFNg in Jurkat T lymphocytes was also significantly decreased in THP1^shTLR1-iDC (Fig. 2I). These results suggested that defective TLR1 attenuated TLR2 signaling, leading to less DC maturation and T cell activation by immunogenic chemotherapy.

TLR1/2 antagonist CU-CPT22 ameliorates the antitumor immunity of immunogenic chemotherapeutic agent

To further validate that the therapeutic efficacy of chemotherapy to stage III COAD patients was influenced by TLR1/2 signaling via antitumor immunity, we combined TLR1/2 antagonist CU-CPT22 with immunogenic chemotherapeutic agent oxaliplatin (OXP), which is the common first-line chemotherapeutic agent in colorectal cancer. By this pharmacologic inhibition of TLR1/2 signaling, we can validate whether TLR1/2 signaling can benefit the therapeutic efficacy of OXP via boosting antitumor immunity (Fig. 3A). Moreover, we also combined TLR1/2 agonist Pam₃CSK₄ with OXP to analyze whether the therapeutic efficacy of OXP was enhanced by TLR1/2 signaling (Fig. 3A). As shown in Fig. 3A, mice were given a subcutaneous tumor challenge with CT26 for 13 days and treated with OXP with or with CU-CPT22 and Pam₃CSK₄. We found that tumor volume was decreased in mice receiving 5 cycle of OXP (Fig. 3B). The tumor regression was markedly reduced in OXP/Pam₃CSK₄ group, compared to those mice that received OXP only (Fig. 3B and 3C). But the therapeutic efficacy of OXP was significantly inhibited as administrated with CU-CPT22 (Fig. 3B-3D).

We then evaluate the immune cell profile within tumor microenvironment (TME) by flow cytometry and IHC including CD11⁺ DC, CD4, CD8, effector/memory CD4 and CD8, IFNg⁺ CD8, Foxp3⁺ Treg cells. The density of tumor-infiltrating CD11c⁺DC cells and CD8⁺ T cell was remarkably decreased in OXP/CU-CPT22 group. But there was increased in OXP/Pam₃CSK₄ group, compared to OXP group (Fig. 3E). By flow cytometric analysis, we found that tumor-infiltrating CD4 and CD8 cells were also significantly increased in OXP/Pam₃CSK₄ group, compared to other groups (Fig. 3F and 3G). Blockade of TLR1/2 significantly reduced the infiltration of CD4 and CD8 that elicited by OXP treatment (Fig. 3F and 3G).

By evaluating the density of effector/memory CD4 and CD8 cells, we found that there were a remarkably decrease in OXP/CU-CPT22 group but increase in OXP/Pam₃CSK₄ group (Fig. 4A and 4B). The tumor-infiltrating IFNg⁺ CD8 cells were also increased in OXP/Pam₃CSK₄ group (Fig. 4C and 4D). But we found there is no significantly change in immunosuppressive Foxp3⁺ regulatory T cells (Fig. 4E). These results showed that TLR1/2 was critical for immunogenic chemotherapy to elicit antitumor immunity. By administration with TLR1/2 agonist, OXP could induce more effector/memory and cytotoxic immune cells to recognize and eradicate residual tumor cells. Furthermore, the density of tumor-infiltrating CD8 were significantly less in locally advanced stage III COAD patients bearing TLR1-N248S polymorphism (Fig. 4F). Taken together, these results showed that defective TLR1 may reduce the therapeutic efficacy of chemotherapy in locally advanced COAD patients by attenuating HMGB1-dependent antitumor immunity.

Our data showed for the first time that the TLR1-N248S was associated with clinical outcome in patients with locally advanced stage III COAD, suggesting that this SNP might be associated with the risk of lymph node metastasis. This polymorphism also significantly correlated with poor DMFS in both univariate and multivariate analyses. We found that defective TLR1 might attenuate TLR1/TLR2 signaling to reduce the response to immunogenic cell death (ICD), leading to less extent of antitumor response and poor therapeutic efficacy in vitro and in vivo. Furthermore, patients carrying TLR1-N248S polymorphism had less tumor-infiltrating CD8⁺ lymphocytes within TME in locally advanced COAD. These findings indicate that cellular TLR1 signaling plays a critical role in the efficacy of adjuvant chemotherapy including immunogenic chemotherapeutic agent OXP, and may be a novel target for drug development.

Our previous studies reported that the release extent of HMGB1 and immune cell infiltration was associated with favorable survival outcome in locally advanced rectal cancer after pre-operative chemoradiotherapy treatment [32], suggesting that HMGB1-TLR2/TLR4 signaling pathway may participate in the chemotherapy-induced antitumor immunity. TLR2 can form heterodimers with TLR1 or TLR6 to recognize different TLR ligands resulting in different functions [42]. Previous studies showed that activation of TLR1/2 signaling could activate immune response but activation of TLR2/6 signaling could suppress T cell immunity [43, 44]. Moreover, recent studies showed that TLR1/2 agonist enhanced antitumor efficacy of CTLA-4 and PD-L1 blockade by increasing intratumoral Treg depletion [12, 45] and stimulating cytotoxic T Lymphocytes [11] against tumor cells. Here, our studies here showed that TLR1 is essential for TLR1/2 signaling activation on DC in response to immunogenic chemotherapy treatment. Defective TLR1 may attenuate TLR1/2 signaling but enhance TLR2/6 signaling to suppress T cell immunity. Therefore, the released HMGB1 by immunogenic chemotherapy may activate TLR2/6 signaling on DC for suppressing T cell-mediated immunity rather than promoting T cell-mediated immune response. By silencing TLR1 expression on immature dendritic cells, we found that the TLR2 signaling was less activated by HMGB1 compared to wild-type immature dendritic cells. Moreover, direct co-culture of OXP-treated colorectal cancer cells with defective TLR1-iDC showed that DC maturation and T cell activation were remarkably attenuated in vitro, suggesting that TLR1 is essential for HMGB1-TLR2 axis to boost antitumor immunity. Furthermore, systemic inhibition of TLR1/2 signaling remarkably reduced the response to chemotherapy, leading to tumor regrowth. But systemic administration of TLR1/2 agonist significantly delayed tumor growth and increased the response to chemotherapy. Within tumor microenvironment, we found inhibition of TLR1/2 by small molecule CU-CPT22 dramatically decreased the effect of immunogenic chemotherapy OXP, leading to less tumor-infiltrating immune cells including CD4, CD8 and IFNg⁺ CD8. However, co-administration of TLR1/2 agonist boosted the influence of immunogenic chemotherapy, increasing the antitumor immunity to reshape the TME and eradicate the residual tumors. Consistent with these observations, we found that less density of tumor-infiltrating CD8⁺ lymphocytes within tumor microenvironment in locally advanced colon carcinoma bearing TLR1-N2418S polymorphism. Notably, we found there was no significant change in regulatory T (Treg) lymphocytes in these group, which is inconsistent with previous studies [43]. Zhang et al. found that TLR1/2 ligand not only promoted cytotoxic T lymphocyte infiltration but reduced infiltration of Treg [43]. Sharma et al also indicated that TLR1/2 agonist enhance the efficacy of anti-CTLA-4-antibody by depleting regulatory T cells and increasing IFN-γ secretion from T cells to reshape TME in syngeneic melanoma model [12]. Unlike those findings, we did not find the change in the frequency of Treg within TME. We assumed the the tumor immunophenotype might be different in these models. Our syngeneic colon model CT26 had more infiltration of Treg compared to melanoma model B16F10 [46, 47], which may influence the impact of TLR1/2 agonist on immune status within TME. These divergences need to be investigated in different syngeneic animal model in the future.

Previous reports have shown that several SNPs in TLR1 genes may modify the activation of its protein, implying that the genetic variation in the TLR1 gene might affect the innate immune response and clinical susceptibility to a wide spectrum of pathogens and confer a high risk of cancer [15], including N248S, I602S. Here we found that LR1-N248S polymorphism was not only associated with poor survival outcome but might influence the response to adjuvant chemotherapy. In addition to our finding, Okazaki et al. also indicated that TLR1-I602S (rs5743618) could serve as a predictor of clinical response to FOLFIRI plus bevacizumab in patients with mCRC [41]. Moreover, Deng et al. showed that TLR1/2 expression had a positive correlation with lung cancer patients’ survival [42], suggesting TLR1/2 signaling may influence the therapeutic response to chemotherapy by modulating antitumor immunity. Low TLR1/2 expression or defective TLR1/2 signaling may result in poor clinical benefit of chemotherapy, especially immunogenic chemotherapeutic agents.

Taken together, our studies showed that TLR1-N248S polymorphism is a not only prognostic but predictive factor to clinical response to adjuvant chemotherapy in patients with locally advanced colon carcinoma. TLR1-N248S polymorphism might reduce the ability of immunogenic chemotherapeutic agents on reshaping tumor microenvironment, leading to insufficient antitumor immune response and tumor recurrence.

Author contributions

Data curation, Kevin Chih-Yang Huang and Tsung-Wei Chen; Formal analysis, Shu-Fen Chiang, William Tzu-Liang Chen, Kevin Chih-Yang Huang, Ji-An Liang, Wei-Ze Hong, Chia-Ying Lai and Chia-Yi Chen; Funding acquisition, K. S. Clifford Chao and Kevin Chih-Yang Huang; Investigation, William Tzu-Liang Chen, Tao-Wei Ke and Pei-Chen Yang; Methodology, Kevin Chih-Yang Huang, Chia-Yi Chen; Project administration, Kevin Chih-Yang Huang; Resources, William Tzu-Liang Chen, Tao-Wei Ke and K. S. Clifford Chao; Supervision, K. S. Clifford Chao; Writing – original draft, Kevin Chih-Yang Huang; Writing – review & editing, K. S. Clifford Chao.

Acknowledgments

We are grateful for the tissue microarray support from the Translation Research Core, China Medical University Hospital. This study was supported in part by China Medical University Hospital (DMR-CELL-2103, DMR-CELL-2102 and DMR-111-156, Taiwan) and the Ministry of Science and Technology (MOST110-2628-B-039-005 and MOST110-2314-B-039-032, Taiwan). This study was partially based on clinical information from the China Medical University Hospital Cancer Registry. Experiments and data analysis were performed in part through the use of the Medical Research Core Facilities Center, Office of Research & Development at China medical University, Taichung, Taiwan, R.O.C.

Conflict of interest

The authors declare that they have no conflict of interest.

Ethical approval

This study was reviewed and approved by the Internal Review Board (IRB) of China Medical University Hospital [Protocol number: CMUH105-REC2-073]. The method was carried out in accordance with the committee’s approved guidelines.

Informed consent

Informed consents were obtained from all participants in the study.

Yeom SS, Lee SY, Kim CH, Kim HR, Kim YJ. The prognostic effect of adjuvant chemotherapy in the colon cancer patients with solitary lymph node metastasis. Int J Colorectal Dis. 2019;34(8):1483-90. doi: 10.1007/s00384-019-03346-7.
Hashiguchi Y, Muro K, Saito Y, Ito Y, Ajioka Y, Hamaguchi T, et al. Japanese Society for Cancer of the Colon and Rectum (JSCCR) guidelines 2019 for the treatment of colorectal cancer. Int J Clin Oncol. 2020;25(1):1-42. doi: 10.1007/s10147-019-01485-z.
Wang L, Hirano Y, Heng G, Ishii T, Kondo H, Hara K, et al. Prognostic Utility of Apical Lymph Node Metastasis in Patients With Left-sided Colorectal Cancer. In Vivo. 2020;34(5):2981-9. doi: 10.21873/invivo.12129.
Chiang SF, Huang KC, Chen WT, Chen TW, Ke TW, Chao KSC. Polymorphism of formyl peptide receptor 1 (FPR1) reduces the therapeutic efficiency and antitumor immunity after neoadjuvant chemoradiotherapy (CCRT) treatment in locally advanced rectal cancer. Cancer Immunol Immunother. 2021. doi: 10.1007/s00262-021-02894-8.
Abreu MT. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol. 2010;10(2):131-44. doi: 10.1038/nri2707.
Sato Y, Goto Y, Narita N, Hoon DS. Cancer Cells Expressing Toll-like Receptors and the Tumor Microenvironment. Cancer Microenviron. 2009;2 Suppl 1:205-14. doi: 10.1007/s12307-009-0022-y.
Xu M, Lu JH, Zhong YZ, Jiang J, Shen YZ, Su JY, et al. Immunogenic Cell Death-Relevant Damage-Associated Molecular Patterns and Sensing Receptors in Triple-Negative Breast Cancer Molecular Subtypes and Implications for Immunotherapy. Front Oncol. 2022;12:870914. doi: 10.3389/fonc.2022.870914.
Wang X, Wu S, Liu F, Ke D, Wang X, Pan D, et al. An Immunogenic Cell Death-Related Classification Predicts Prognosis and Response to Immunotherapy in Head and Neck Squamous Cell Carcinoma. Front Immunol. 2021;12:781466. doi: 10.3389/fimmu.2021.781466.
Huang KC, Chiang SF, Chen WT, Chen TW, Hu CH, Yang PC, et al. Decitabine Augments Chemotherapy-Induced PD-L1 Upregulation for PD-L1 Blockade in Colorectal Cancer. Cancers (Basel). 2020;12(2). doi: 10.3390/cancers12020462.
Huang KC, Chiang SF, Yang PC, Ke TW, Chen TW, Hu CH, et al. Immunogenic Cell Death by the Novel Topoisomerase I Inhibitor TLC388 Enhances the Therapeutic Efficacy of Radiotherapy. Cancers (Basel). 2021;13(6). doi: 10.3390/cancers13061218.
Cen X, Zhu G, Yang J, Yang J, Guo J, Jin J, et al. TLR1/2 Specific Small-Molecule Agonist Suppresses Leukemia Cancer Cell Growth by Stimulating Cytotoxic T Lymphocytes. Adv Sci (Weinh). 2019;6(10):1802042. doi: 10.1002/advs.201802042.
Sharma N, Vacher J, Allison JP. TLR1/2 ligand enhances antitumor efficacy of CTLA-4 blockade by increasing intratumoral Treg depletion. Proc Natl Acad Sci U S A. 2019;116(21):10453-62. doi: 10.1073/pnas.1819004116.
Wang Y, Liu S, Zhang Y, Yang J. Dysregulation of TLR2 Serves as a Prognostic Biomarker in Breast Cancer and Predicts Resistance to Endocrine Therapy in the Luminal B Subtype. Front Oncol. 2020;10:547. doi: 10.3389/fonc.2020.00547.
Lanki M, Seppanen H, Mustonen H, Hagstrom J, Haglund C. Toll-like receptor 1 predicts favorable prognosis in pancreatic cancer. PLoS One. 2019;14(7):e0219245. doi: 10.1371/journal.pone.0219245.
Trejo-de la OA, Hernandez-Sancen P, Maldonado-Bernal C. Relevance of single-nucleotide polymorphisms in human TLR genes to infectious and inflammatory diseases and cancer. Genes Immun. 2014;15(4):199-209. doi: 10.1038/gene.2014.10.
Yang CA, Chiang BL. Toll-like receptor 1 N248S polymorphism affects T helper 1 cytokine production and is associated with serum immunoglobulin E levels in Taiwanese allergic patients. J Microbiol Immunol Infect. 2017;50(1):112-7. doi: 10.1016/j.jmii.2015.01.004.
Jinushi M, Yagita H, Yoshiyama H, Tahara H. Putting the brakes on anticancer therapies: suppression of innate immune pathways by tumor-associated myeloid cells. Trends Mol Med. 2013;19(9):536-45. doi: 10.1016/j.molmed.2013.06.001.
Pradere JP, Dapito DH, Schwabe RF. The Yin and Yang of Toll-like receptors in cancer. Oncogene. 2014;33(27):3485-95. doi: 10.1038/onc.2013.302.
Lu H, Yang Y, Gad E, Wenner CA, Chang A, Larson ER, et al. Polysaccharide krestin is a novel TLR2 agonist that mediates inhibition of tumor growth via stimulation of CD8 T cells and NK cells. Clin Cancer Res. 2011;17(1):67-76. doi: 10.1158/1078-0432.CCR-10-1763.
Jasani B, Navabi H, Adams M. Ampligen: a potential toll-like 3 receptor adjuvant for immunotherapy of cancer. Vaccine. 2009;27(25-26):3401-4. doi: 10.1016/j.vaccine.2009.01.071.
Yang H, Brackett CM, Morales-Tirado VM, Li Z, Zhang Q, Wilson MW, et al. The Toll-like receptor 5 agonist entolimod suppresses hepatic metastases in a murine model of ocular melanoma via an NK cell-dependent mechanism. Oncotarget. 2016;7(3):2936-50. doi: 10.18632/oncotarget.6500.
Panelli MC, Stashower ME, Slade HB, Smith K, Norwood C, Abati A, et al. Sequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the requirements for tissue rejection. Genome Biol. 2007;8(1):R8. doi: 10.1186/gb-2007-8-1-r8.
Hopkins RJ, Kalsi G, Montalvo-Lugo VM, Sharma M, Wu Y, Muse DD, et al. Randomized, double-blind, active-controlled study evaluating the safety and immunogenicity of three vaccination schedules and two dose levels of AV7909 vaccine for anthrax post-exposure prophylaxis in healthy adults. Vaccine. 2016;34(18):2096-105. doi: 10.1016/j.vaccine.2016.03.006.
Uhlen M, Fagerberg L, Hallstrom BM, Lindskog C, Oksvold P, Mardinoglu A, et al. Proteomics. Tissue-based map of the human proteome. Science. 2015;347(6220):1260419. doi: 10.1126/science.1260419.
Lin TY, Fan CW, Maa MC, Leu TH. Lipopolysaccharide-promoted proliferation of Caco-2 cells is mediated by c-Src induction and ERK activation. Biomedicine (Taipei). 2015;5(1):5. doi: 10.7603/s40681-015-0005-x.
Wang X, Sheu JJ, Lai MT, Yin-Yi Chang C, Sheng X, Wei L, et al. RSF-1 overexpression determines cancer progression and drug resistance in cervical cancer. Biomedicine (Taipei). 2018;8(1):4. doi: 10.1051/bmdcn/2018080104.
Berges C, Naujokat C, Tinapp S, Wieczorek H, Hoh A, Sadeghi M, et al. A cell line model for the differentiation of human dendritic cells. Biochem Biophys Res Commun. 2005;333(3):896-907. doi: 10.1016/j.bbrc.2005.05.171.
Huang KC-Y, Chiang S-F, Ke T-W, Chen T-W, Hu C-H, Yang P-C, et al. DNMT1 constrains IFNβ-mediated anti-tumor immunity and PD-L1 expression to reduce the efficacy of radiotherapy and immunotherapy. OncoImmunology. 2021;10(1):1989790. doi: 10.1080/2162402X.2021.1989790.
Huang KC, Lai CY, Hung WZ, Chang HY, Lin PC, Chiang SF, et al. A Novel Engineered AAV-Based Neoantigen Vaccine in Combination with Radiotherapy Eradicates Tumors. Cancer Immunol Res. 2023;11(1):123-36. doi: 10.1158/2326-6066.CIR-22-0318.
Huang KC, Chiang SF, Chang HY, Chen WT, Yang PC, Chen TW, et al. Engineered sTRAIL-armed MSCs overcome STING deficiency to enhance the therapeutic efficacy of radiotherapy for immune checkpoint blockade. Cell Death Dis. 2022;13(7):610. doi: 10.1038/s41419-022-05069-0.
Chen TW, Hung WZ, Chiang SF, Chen WT, Ke TW, Liang JA, et al. Dual inhibition of TGFbeta signaling and CSF1/CSF1R reprograms tumor-infiltrating macrophages and improves response to chemotherapy via suppressing PD-L1. Cancer Lett. 2022;543:215795. doi: 10.1016/j.canlet.2022.215795.
Huang CY, Chiang SF, Ke TW, Chen TW, Lan YC, You YS, et al. Cytosolic high-mobility group box protein 1 (HMGB1) and/or PD-1+ TILs in the tumor microenvironment may be contributing prognostic biomarkers for patients with locally advanced rectal cancer who have undergone neoadjuvant chemoradiotherapy. Cancer Immunol Immunother. 2018;67(4):551-62. doi: 10.1007/s00262-017-2109-5.
Wang CQ, Huang BF, Wang Y, Tang CH, Jin HC, Shao F, et al. Subcellular localization of HMGB1 in colorectal cancer impacts on tumor grade and survival prognosis. Sci Rep. 2020;10(1):18587. doi: 10.1038/s41598-020-75783-2.
Chen R, Kang R, Tang D. The mechanism of HMGB1 secretion and release. Exp Mol Med. 2022;54(2):91-102. doi: 10.1038/s12276-022-00736-w.
Cheng KJ, Mohamed EHM, Syafruddin SE, Ibrahim ZA. Interleukin-1 alpha and high mobility group box-1 secretion in polyinosinic:polycytidylic-induced colorectal cancer cells occur via RIPK1-dependent mechanism and participate in tumourigenesis. J Cell Commun Signal. 2022. doi: 10.1007/s12079-022-00681-3.
Lu H, Zhu M, Qu L, Shao H, Zhang R, Li Y. Oncogenic Role of HMGB1 as An Alarming in Robust Prediction of Immunotherapy Response in Colorectal Cancer. Cancers (Basel). 2022;14(19). doi: 10.3390/cancers14194875.
Peng RQ, Wu XJ, Ding Y, Li CY, Yu XJ, Zhang X, et al. Co-expression of nuclear and cytoplasmic HMGB1 is inversely associated with infiltration of CD45RO+ T cells and prognosis in patients with stage IIIB colon cancer. BMC Cancer. 2010;10:496. doi: 10.1186/1471-2407-10-496.
Neugut AI, Lin A, Raab GT, Hillyer GC, Keller D, O'Neil DS, et al. FOLFOX and FOLFIRI Use in Stage IV Colon Cancer: Analysis of SEER-Medicare Data. Clin Colorectal Cancer. 2019;18(2):133-40. doi: 10.1016/j.clcc.2019.01.005.
Huang CY, Chiang SF, Chen WT, Ke TW, Chen TW, You YS, et al. HMGB1 promotes ERK-mediated mitochondrial Drp1 phosphorylation for chemoresistance through RAGE in colorectal cancer. Cell Death Dis. 2018;9(10):1004. doi: 10.1038/s41419-018-1019-6.
Sugiura Y, Kamdar K, Khakpour S, Young G, Karpus WJ, DePaolo RW. TLR1-induced chemokine production is critical for mucosal immunity against Yersinia enterocolitica. Mucosal Immunol. 2013;6(6):1101-9. doi: 10.1038/mi.2013.5.
Okazaki S, Loupakis F, Stintzing S, Cao S, Zhang W, Yang D, et al. Clinical Significance of TLR1 I602S Polymorphism for Patients with Metastatic Colorectal Cancer Treated with FOLFIRI plus Bevacizumab. Mol Cancer Ther. 2016;15(7):1740-5. doi: 10.1158/1535-7163.MCT-15-0931.
Deng Y, Yang J, Qian J, Liu R, Huang E, Wang Y, et al. TLR1/TLR2 signaling blocks the suppression of monocytic myeloid-derived suppressor cell by promoting its differentiation into M1-type macrophage. Mol Immunol. 2019;112:266-73. doi: 10.1016/j.molimm.2019.06.006.
Zhang Y, Luo F, Cai Y, Liu N, Wang L, Xu D, et al. TLR1/TLR2 agonist induces tumor regression by reciprocal modulation of effector and regulatory T cells. J Immunol. 2011;186(4):1963-9. doi: 10.4049/jimmunol.1002320.
Skabytska Y, Wolbing F, Gunther C, Koberle M, Kaesler S, Chen KM, et al. Cutaneous innate immune sensing of Toll-like receptor 2-6 ligands suppresses T cell immunity by inducing myeloid-derived suppressor cells. Immunity. 2014;41(5):762-75. doi: 10.1016/j.immuni.2014.10.009.
Wang Y, Su L, Morin MD, Jones BT, Mifune Y, Shi H, et al. Adjuvant effect of the novel TLR1/TLR2 agonist Diprovocim synergizes with anti-PD-L1 to eliminate melanoma in mice. Proc Natl Acad Sci U S A. 2018;115(37):E8698-E706. doi: 10.1073/pnas.1809232115.
Yu JW, Bhattacharya S, Yanamandra N, Kilian D, Shi H, Yadavilli S, et al. Tumor-immune profiling of murine syngeneic tumor models as a framework to guide mechanistic studies and predict therapy response in distinct tumor microenvironments. PLoS One. 2018;13(11):e0206223. doi: 10.1371/journal.pone.0206223.
Taylor MA, Hughes AM, Walton J, Coenen-Stass AML, Magiera L, Mooney L, et al. Longitudinal immune characterization of syngeneic tumor models to enable model selection for immune oncology drug discovery. J Immunother Cancer. 2019;7(1):328. doi: 10.1186/s40425-019-0794-7.

Table 1. SNPs and Primers
	SNP	MAF^a	Base change (AA change)		Primer sequence
	rs5743611		C > G R80T	1st	ACGTTGGATGCCAATTCCTGGTTGAATTTG
		0.0003		2nd	ACGTTGGATGTATCACTGTCAAAACTGAGG
				UEP	AACACTGATATCAAGATACTGGATT
TLR1	rs4833095	0.604	A > G N248S	1st	ACGTTGGATGCCTAAGTATTCTGGCGAAAC
				2nd	ACGTTGGATGCTGGAGGATCCTAATGAAAG
				UEP	TCAATGTTGTTTAAGGTAAGA
	rs5743618	0.006	G > C S602I	1st	ACGTTGGATGGCTGATCGTCACCATCGTTG
				2nd	ACGTTGGATGTGAGATACCAGGGCAGATCC
				UEP	GGGCAGATCCAAGTAG
TLR2	rs61735278	0.001	A > G N729S	1st	ACGTTGGATGGTGGTGCAAGTATGAACTGG
				2nd	ACGTTGGATGCAATGGGCTCCAGAAGAATG
				UEP	gagagTGAGAATGGCAGCATCA
	rs111200466	0.352	Deletion (-196 to -174 deletion)	1st	ACGTTGGATGCCTTTTGCTTACTTCCTAGTC
				2nd	ACGTTGGATGGGTGCAGAGAGACCACACG
				UEP	CCGAGCAGTCACCTG
^aMinor allele frequency (MAF), according to the ALFA allele frequency for Asian.

Table 2. Clinicopathological parameters of stage II-III colon carcinoma patients (n=869)
Clinicopathological parameters	Total no.	TLR1-N248		p value	TLR1-S602		p value	TLR2-N729S		p value	TLR2 promoter (-196~-174)		p value
Clinicopathological parameters	Total no.	WT	Variant	p value	WT	Variant	p value	WT	Variant	p value	WT	Variant	p value
	869	144	725		853	16		867	2		373	494
Gender				0.516			0.846			1			0.416
Female	401	70	331		394	7		400	1		178	222
Male	468	74	394		459	9		467	1		195	272
Age				0.075			0.277			0.199			0.369
<65	388	74	314		383	5		386	2		173	214
≥65	481	70	411		470	11		481	0		200	280
Tumor location				0.272			0.127			1			0.421
Proximal colon	398	59	339		394	4		397	1		165	233
Distant colon	466	82	384		454	12		465	1		205	259
Unspecified	5	3	2		5	0		5	0		3	2
pT stage				0.821			1			1			0.134
pT1-2	33	5	28		33	0		33	0		10	23
pT3-4	835	139	696		819	16		833	2		362	471
pN stage				0.278			0.198			1			0.579
Negative	459	82	377		448	11		458	1		193	265
Positive	410	62	348		405	5		409	1		180	229
TNM stage (7^th AJCC)				0.278			0.198			1			0.579
Stage II	459	82	377		448	11		458	1		193	265
Stage III	410	62	348		405	5		409	1		180	229
Tumor differentiation				1.00			1.00			1.00			0.25
Well to moderate	850	140	710		835	15		848	2		365	483
Poor	7	1	6		7	0		7	0		1	6
Unknown	12	3	9		11	1		12	0		7	5
Lymphovascular invasion				0.998			0.153			1			0.85
Absent	423	70	353		418	5		422	1		183	239
Present	441	73	368		430	11		440	1		188	252
Unknown	5	1	4		5	0		5	0		2	3
Perineural invasion				0.532			0.621			0.529			0.093
Absent	535	85	451		527	9		534	2		242	293
Present	326	57	269		319	7		326	0		128	197
unknown	8	2	6		8	0		8	0		4	4
Local recurrence				0.734			0.619			1			0.116
Absent	809	135	674		793	16		807	2		353	454
Present	60	9	51		60	0		60	0		20	40
Distant metastasis				0.93			1			0.31			0.748
Absent	722	140	602		708	14		721	1		308	412
Present	147	24	123		145	2		146	1		65	82
Adjuvant chemotherapy				0.553			0.435			0.14			0.996
Yes	325	57	268		321	4		323	2		139	184
No	544	87	457		532	12		544	0		234	310
Pearson test was used, and Fisher's exact test was used when counts were less than 5. The test did not include the “unknown or unspecified" group.

Table 3. Correlation between clinicopathologic parameters, DMFS and DFS
Parameters	No^a	Stage II				No^a	Stage III
Parameters	No^a	DMFS (%)	p value*	DFS (%)	p value*	No^a	DMFS (%)	p value*	DFS (%)	p value*
	459	68%		66%		410	54%		53%
Sex			0.133		0.107			0.945		0.986
Female	212	72%		71%		189	54%		53%
Male	247	64%		63%		221	55%		53%
Age			<0.001		<0.001			<0.001		<0.001
<65	194	80%		79%		194	66%		65%
≥65	265	59%		57%		216	44%		43%
pT stage			NA		NA			<0.001		<0.001
pT1-2	1	0%		0%		32	88%		88%
pT3-4	458	68%		67%		377	52%		50%
Tumor location			0.454		0.583			0.052		0.085
Distal colon	245	69%		68%		221	58%		57%
Proximal colon	212	66%		65%		186	50%		50%
Tumor differentiation			0.214		0.232			0.67		0.688
Well to moderate	448	68%		67%		402	54%		53%
Poor	5	40%		40%		2	50%		50%
Lymphovascular invasion			0.010		0.005			0.039		0.021
Absent	309	71%		70%		114	62%		62%
Present	147	61%		59%		294	51%		50%
Perineural invasion			0.055		0.033			0.008		0.002
Absent	326	71%		70%		210	61%		61%
Present	128	62%		59%		198	48%		46%
TLR1-N248			0.34		0.36			0.019		0.026
WT	82	62%		61%		62	68%		66%
Variant	377	69%		68%		348	52%		51%
TLR2 promoter (-196~-174)			0.747		0.806			0.732		0.503
WT	265	66%		66%		229	53%		51%
Variant	193	69%		67%		180	56%		56%
^aNumber of cases may differ due to missing data.

Table 4. Univariate and multivariate analysis of DMFS and known prognostic factors in locally advanced colon carcinoma patients.
Parameters	Univariate analysis			Multivariate analysis
Parameters	HR	95% CI	p value	HR	95% CI	p value
Sex (Male vs Female)	0.99	0.743-1.320	0.946
Age (≥65 vs <65)	1.86	1.377-2.510	<0.001	1.826	1.35-2.469	<0.001
pT stage (pT3-4 vs pT1-2)	5.278	1.959-14.220	0.001	4.489	1.653-12.190	0.003
Tumor location (Proximal vs Distal)	0.753	0.565-1.005	0.054
Tumor differentiation (Poor vs Well to moderate)	1.523	0.213-10.879	0.675
Lymphovascular invasion (Present vs Absent)	1.428	1.014-2.009	0.041	1.26	0.889-1.784	0.194
Perineural invasion (Present vs Absent)	1.476	1.103-1.974	0.009	1.224	0.909-16.49	0.183
TLR1-N248 (Variant vs WT)	1.725	1.084-2.745	0.021	1.694	1.063-2.698	0.027
TLR2 promoter (Variant vs WT)	1.052	0.787-1.406	0.734

Supplementary Table 1 is not available with this version

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

TLR1-N248S polymorphism Reduces the Therapeutic Efficacy of Chemotherapy by Attenuating Antitumor Immunity in Locally Advanced Colorectal Cancer

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Results

Discussion

Declarations

References

Tables

Supplementary Table

Additional Declarations

Status:

Version 1