Animal grouping, pulmonary fibrosis model preparation and lung section
8–12 weeks old healthy male C57 BL/6 mice, weighing 18–25 g, were purchased from Liaoning Changsheng Biotechnology Co., Ltd., China, (license no: SCXK [liao] 2010-0001. The experiment was approved by the Animal Welfare and Ethics Committee of China Medical University. The mice were randomly divided into 5 groups with 6 mice in each group, including 1 control group and 4 experimental groups which were induce pulmonary fibrosis. Experimental mice were intraperitoneally injected with Bleomycin according to the following protocol that is 1 USP/mouse on days 0 and 2, and 0.5 USP/mouse on days 4 and 6, and 0.25 USP/mouse on days 9, 12, 15, 18, 21, 24, and 27. The experimental groups were harvested on the 7th, 14th, 21st and 28th day respectively to observe the course of disease. The control group was injected with the same volume of normal saline and collected on the 28th day.
To evaluate the effect of different number of injection times on induced pulmonary fibrosis in mice, we truncated modeling process. The mice were randomly divided into 6 groups with 6 mice in each group, including 1 control group and 5 experimental groups. According to the modeling protocol, the mice in the five experimental groups completed 1,2,3,4 and all 11 times intraperitoneal Bleomycin injection respectively. The normal control group was injected with the same volume of normal saline. All six groups mice lung were collected on the 28th day.
Mice were sacrificed by cervical dislocation and the dissected. Normal saline is injected from the right ventricle for pulmonary perfusion to clear the blood from the lungs until they become white. Lung was filled with 4% paraformaldehyde of 20 cm of water pressure, then it was ligated and fixed in a container containing the 4% paraformaldehyde for 16 hours at 4℃. Alcohol gradient dehydration, xylene transparent, and paraffin-embedded. Cut 5 µm thick tissue sections
HE staining, Masson staining
HE staining: Lung tissue sections were deparaffinized and rehydrated, stained with hematoxylin for 1 min, washed with distilled water for 20–30 times, differentiated with 0.5% ethanol for 20 s, washed with distilled water for 20 s; blue with 1% aqueous ammonia for 10 s, washed with distilled water for 20–30 times; washed with 95% ethanol two times, and stained with eosin for 1 min. Then the tissue sections were dehydrated conventionally, transparent, and sealed with neutral gum, then observed under the microscope.
Masson staining: The lung tissue sections were deparaffinized and rehydrated, washed with water; stained with orcein staining solution for 20 min, washed with water; stained with iron hematoxylin staining solution for 10 min; differentiated with hydrochloric acid ethanol for 20 s, washed with water; returned to blue with 1 × PBS for 20 s, washed with water; stained with Ponceau S - acid fuchsin staining solution for 10 min, washed with 0.2% glacial acetic acid for 1 min; color separation with 0.5% phosphomolybdic acid for 40–45 s, washed with 0.2% glacial acetic acid for 1 min; stained with 0.5% aniline blue staining solution for 1 min, washed with 0.2% glacial acetic acid for 1 min; blotting up excess staining solutions with filter paper; the tissue sections were routinely dehydrated, transparent, sealed with neutral gum, and dried, then observed under the microscope.
Immunochemistry Stain
The lung tissue sections were deparaffinized in xylenes. Hydrate sections gradually through graded alcohols, washed with 1 × PBS, treated with methanol/H2O2 solution at room temperature for 10 min, washed with 1 × PBS, boiled for 10 min with citrate buffer (10 mM Sodium Citrate, pH 6.0) for antigen retrieval, allow slides to cool in the buffer for 30 minutes in room temperature. To suppress non-specific binding of IgG, these sections were blocked with non-immune serum of the same species in which the secondary antibody is raised for 10 minutes at room temperature. The primary antibody CD206(R&D,AF2535,USA), CD86(Abcam,ab53004,China), CD68 (Servicebio,18080,China), ADRP(Abcam,ab52356,USA), α-SMA(Santa Cruz, sc-32251,USA), N-cadherin(Genetex,GTX127345,USA), S100A4(Cell Signaling Techonology,13018S,USA), Caspase9(Cell Signaling Techonology,9509S,USA), PCNA(Santa Cruz,sc-7907,USA) was diluted 1:100 or 1:500 with 1% BSA and incubated overnight at 4℃. Then incubate for 20 minutes with biotin-conjugated secondary antibody in at 37℃. The primary antibody was detected using Biotin-Streptavidin HRP detection system (ZSGB-BIO, China). Finally, the color was developed using an AEC Chromogenic Kit (BOSTER, China), and then the sections were washed with distilled water, counterstained with hematoxylin. Mount coverslip with aqueous mounting medium, then observed under the microscope.
Random observation of lung tissue visual field of three different lung fibrosis mice under 10 × 20 times microscope. If the cell is not stained, score 0, if the cell is stained, score 1. Taking the average value of the integral arithmetic of 3 fields as the final integral. The ADRP+ and CD68+ cells and co localization cells were counted, and the proportion of ADRP+ CD68+/ADRP+ cells in different periods was obtained. The same method was used to obtain the ratio of ADRP+CD86+/ADRP+ cells and ADRP+CD206+/ ADRP+ cells in different periods.
Immunohistochemical antibody stripping multiple staining
Photographs were taken under microscope after the first immunohistochemical staining. Wash the AEC stain with gradient alcohol (25%-95%). Antibodies were stripped in the buffer containing 65 mM Tris-HCl pH6.8(Sigma, USA)、1% SDS༈Solarbio, USA༉、0.113 M 2- mercaptoethanol༈Sigma, USA༉、0.1 M NaCl、2 M Urea༈Sigma, USA༉,in 56℃ water bath with agitation in the fume hood twice for 30 minutes each. After antibody stripping, the sections were washed in distilled water for 0.5 hours and replaced every 5 minutes in room temperature. Then the sections can be used for immunohistochemistry staining again according to the above protocol. Without adding first antibody, a negative control was setup to avoid any false staining due to incompletely antibody stripping.
Frozen tissue sections, Oil red O staining and Immunochemistry Stain
The model mice were sacrificed and the lungs were collected, perfused, and fixed with 4% paraformaldehyde for 16 hours following the above protocol. Then the lung samples were immersed in sucrose solutions with concentration gradients of 10%, 20% and 30%, respectively, for 24 hours in each gradient. Treated lungs were embedded with OTC and stored in -80 °C refrigerator, and Cut into 10 microns thick tissue sections under − 25℃.
The lung tissues frozen sections were stained with diluted Oil red O staining solution (Solarbio, USA) for about 10 minutes, 60% isopropanol color separation to the background colorless, counterstained with hematoxylin for 1 minute, washed with 1 × PBS, sealed with 70% glycerol and then took photograph. Next, the sections washed with 60% isopropanol and then ethanol hydrochloride washing to remove any color. The sections were used to stain ADRP following above immunohistochemistry protocol.
Realtime PCR
RNA was extracted from the left lobe of mouse lung. RNA samples were reverse transcribed into cDNA and then amplified and quantitated with Realtime PCR. The program was run on the ABI7500 Realtime PCR System instrument using TaKaRa SYBR PremixExTaq reagent (Cat# RR820A).
ADRP primer: GCGGGTGTGGTTAAGTCG
Ttctggggagtggtcagc
PDGFRα primer: AGGCTCTCATGTCTGAGCTG
TGTCCAGGTCTTTCTTCGGC
α-SMA primer: CCAACTGGGACGACATGGAA
GAGGCATAGAGGGACAGCAC
Collagen primer: ACATGTTCAGCTTTGTGGACC
TAGGCCATTGTGTATGCAGC
CD68 primer: GGGGCTCTTGGGAACTACAC
GTACCGTCACAACCTCCCTG
CD86 primer: TCATTCCCGGATGGTGTGTG
TGAGCAGCATCACAAGGAGG
CD206 primer: TATAGGTGGAGAGCTGGCGA
CGGGAGAACCATCACTCCAG
Data analysis
All experiments were repeated 3 times. The measurement data were expressed as mean±standard deviation (mean±SD). The composition analysis was performed using GraphPad Prism5 data analysis software. Comparison between multiple groups was performed by single factor analysis of variance. When P < 0.05, statistical significance was considered.